ID: 1121161281

View in Genome Browser
Species Human (GRCh38)
Location 14:91743712-91743734
Sequence CCTCCCATGCAGAAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 1, 2: 8, 3: 43, 4: 350}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121161281_1121161286 -1 Left 1121161281 14:91743712-91743734 CCTTCTGCCTTCTGCATGGGAGG 0: 1
1: 1
2: 8
3: 43
4: 350
Right 1121161286 14:91743734-91743756 GGCACGGCACTCTTCCCCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 163
1121161281_1121161291 17 Left 1121161281 14:91743712-91743734 CCTTCTGCCTTCTGCATGGGAGG 0: 1
1: 1
2: 8
3: 43
4: 350
Right 1121161291 14:91743752-91743774 TCTGGAGGATGCAACAACACAGG 0: 1
1: 0
2: 0
3: 12
4: 142
1121161281_1121161292 18 Left 1121161281 14:91743712-91743734 CCTTCTGCCTTCTGCATGGGAGG 0: 1
1: 1
2: 8
3: 43
4: 350
Right 1121161292 14:91743753-91743775 CTGGAGGATGCAACAACACAGGG 0: 1
1: 0
2: 1
3: 21
4: 239
1121161281_1121161293 27 Left 1121161281 14:91743712-91743734 CCTTCTGCCTTCTGCATGGGAGG 0: 1
1: 1
2: 8
3: 43
4: 350
Right 1121161293 14:91743762-91743784 GCAACAACACAGGGCCATCTTGG 0: 1
1: 0
2: 0
3: 35
4: 379
1121161281_1121161287 2 Left 1121161281 14:91743712-91743734 CCTTCTGCCTTCTGCATGGGAGG 0: 1
1: 1
2: 8
3: 43
4: 350
Right 1121161287 14:91743737-91743759 ACGGCACTCTTCCCCTCTGGAGG 0: 1
1: 0
2: 4
3: 36
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121161281 Original CRISPR CCTCCCATGCAGAAGGCAGA AGG (reversed) Intronic
900174865 1:1287207-1287229 CCTCCCATGCCGCGGGCAGCAGG - Exonic
900640280 1:3685129-3685151 CTCCCCCTGCAGAGGGCAGAAGG + Intronic
900652407 1:3736350-3736372 CCTCCGAGGCACAGGGCAGAGGG - Intergenic
900781969 1:4624296-4624318 CCTCCCCTGCAGCAGGGAGGAGG - Intergenic
901665832 1:10825716-10825738 CCTGCCATCCAGGAGGCTGAAGG + Intergenic
902108282 1:14056322-14056344 TCTTCCATGATGAAGGCAGAAGG + Intergenic
902634845 1:17728551-17728573 CCTCCCTTGTAAAATGCAGAGGG - Intergenic
902778803 1:18691604-18691626 CCTCCCAAGCACAAGATAGAAGG - Intronic
904430887 1:30463272-30463294 CCCACCATGCAGAATCCAGAAGG - Intergenic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
904839736 1:33364633-33364655 CCTCCCATATGGAAGGCAGCTGG - Intronic
905205172 1:36339313-36339335 CCTTGCATGCAGGAGGCAGCGGG - Intergenic
905434503 1:37947254-37947276 CTTCCCACCCAGAAGGAAGATGG + Intergenic
906931802 1:50177405-50177427 CCTCCAATTAAGAGGGCAGATGG + Intronic
907294536 1:53441341-53441363 CCTCCCAGGCACATGGCAGCAGG + Intergenic
907897015 1:58701535-58701557 AGTCCAGTGCAGAAGGCAGACGG - Intergenic
907942903 1:59106272-59106294 CCTTCCATGCAGAAGGGCAAGGG + Intergenic
908927226 1:69270260-69270282 CCACCCCTCCAGAAGGCACAGGG - Intergenic
910300210 1:85697331-85697353 CATCCCATCCAGAAGCCAAAAGG - Intronic
910773626 1:90853283-90853305 CCTCCCATGCAAAAGTCATGGGG - Intergenic
911639362 1:100270538-100270560 ACTCCTAAGGAGAAGGCAGAAGG - Exonic
912050785 1:105525827-105525849 TGCCCCATGCAGAAGACAGATGG - Intergenic
913584984 1:120266089-120266111 CCTCCTATGCAGAGGCCATAAGG - Intergenic
913623198 1:120632273-120632295 CCTCCTATGCAGAGGCCATAAGG + Intergenic
913685496 1:121228068-121228090 ACTCCCAAGCACAAGGCAAATGG - Intronic
914037341 1:144015672-144015694 ACTCCCAAGCACAAGGCAAATGG - Intergenic
914152112 1:145052260-145052282 ACTCCCAAGCACAAGGCAAATGG + Intronic
914566987 1:148877946-148877968 CCTCCTATGCAGAGGCCATAAGG - Intronic
914605837 1:149252296-149252318 CCTCCTATGCAGAGGCCATAAGG + Intergenic
914778148 1:150757484-150757506 TCTCCCATTAAGAAAGCAGATGG + Intronic
916585543 1:166146684-166146706 GCTCAAATTCAGAAGGCAGAGGG + Intronic
917768649 1:178251194-178251216 TCTCCCATGACGTAGGCAGATGG - Intronic
918080335 1:181203114-181203136 CCTGCCATCCGAAAGGCAGATGG - Intergenic
918847843 1:189641792-189641814 CATCCCATGAAGAAGGTAGAAGG + Intergenic
920472814 1:206246626-206246648 ACTCCCAAGCACAAGGCAAATGG - Intronic
920853292 1:209643725-209643747 CCTCCCATGAGGAAGCCAGAGGG + Intronic
921824885 1:219661231-219661253 GCTCCCATGTACACGGCAGAGGG - Intergenic
921955559 1:220980118-220980140 CCCCCCATGCCCCAGGCAGATGG + Intergenic
922163893 1:223098770-223098792 TTTCCCATTCAGAAGGAAGAGGG + Intergenic
923565038 1:235070124-235070146 AGTCCCATGCAGCAGGGAGAAGG - Intergenic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
1064067679 10:12196408-12196430 CCTCCCATGCAGTCGCTAGAAGG - Intronic
1064258739 10:13767725-13767747 CAGCCCCTGCATAAGGCAGATGG - Intronic
1064741547 10:18439804-18439826 ACTGGCATGCAGTAGGCAGAAGG - Intronic
1066054444 10:31667286-31667308 CCACTCATGCAGAAGACAAAGGG - Intergenic
1066336099 10:34480068-34480090 CCTTGCAGGCACAAGGCAGACGG + Intronic
1066524523 10:36262000-36262022 TCTCACATGCAGAAGGCAGGAGG - Intergenic
1067271516 10:44795669-44795691 CCTCCCATTCAGTTGGCACATGG - Intergenic
1067288350 10:44923783-44923805 CTTCCCAGGCATAAAGCAGAAGG - Intronic
1069558380 10:69412789-69412811 GTCTCCATGCAGAAGGCAGAGGG + Intronic
1069815109 10:71188712-71188734 CCTCCCCAGCAGTGGGCAGAAGG + Intergenic
1069854937 10:71434908-71434930 CATGCCAAGAAGAAGGCAGATGG - Intronic
1069856693 10:71444908-71444930 CCTCCCAACCAGGAGGCAGCTGG - Intronic
1070068604 10:73063316-73063338 CCTCACATGGTGAAGGCTGAAGG + Intronic
1070935523 10:80291620-80291642 CCTCCCATGCAGCATGGAGAAGG + Intergenic
1071230584 10:83580711-83580733 CTTCCCATCCTGAAGGCAGCAGG + Intergenic
1072693924 10:97589470-97589492 GATTCCAAGCAGAAGGCAGAAGG + Intronic
1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG + Intronic
1073265768 10:102227604-102227626 CCTGGCAAGCAGAAGGCAGAGGG - Exonic
1074015609 10:109530726-109530748 TCTCCCAGCCAGAAGGCACAGGG - Intergenic
1074078743 10:110151615-110151637 CCATCCATGTAGAAGGAAGAGGG - Intergenic
1074290051 10:112131593-112131615 GCTCCCAGACAGAAGGCAGGTGG - Intergenic
1074453374 10:113577318-113577340 CCTTCCATGCAGAAGGGTGCAGG - Intronic
1075410170 10:122221883-122221905 AGCCCCATGCAGAAGCCAGAAGG - Intronic
1075716355 10:124558045-124558067 CCTCCAAAGCACCAGGCAGATGG - Intronic
1076121926 10:127943473-127943495 TCTCCCATGCAGGAGGGAGACGG + Intronic
1076634663 10:131874317-131874339 CCTCCCAGGAAGAAGCCAGGAGG - Intergenic
1076692354 10:132230350-132230372 CCTCCCATGCACACGGCCGCAGG + Intronic
1076693083 10:132233642-132233664 CATCCACTGCAGATGGCAGAGGG + Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1082838941 11:57672837-57672859 CCTCCCCAGAACAAGGCAGAAGG - Exonic
1083201724 11:61124865-61124887 CCTCCCAGGAAGAAAGGAGAGGG + Intronic
1083289831 11:61683627-61683649 CATCCCAAGCAGAAGGCAAAGGG - Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1084541112 11:69787779-69787801 CCTCCCATTCACCAGGCAGGAGG + Intergenic
1084670589 11:70604403-70604425 CCAACCATTCAGAGGGCAGAGGG - Intronic
1086511464 11:87562587-87562609 GGCCCCATTCAGAAGGCAGAAGG + Intergenic
1088156822 11:106815736-106815758 CCTCACAAGAGGAAGGCAGAGGG + Intronic
1089267405 11:117274794-117274816 CCTCCCAAGTAGAACACAGATGG + Intronic
1089442439 11:118528714-118528736 CCTCTCAGGCAGCAGGCAGATGG - Exonic
1090511399 11:127379305-127379327 CCTACCATGCAGTAGGGAAATGG - Intergenic
1090873761 11:130770684-130770706 CCTCACATGGATAAGGCACACGG + Intergenic
1091888000 12:4030977-4030999 CCACCATTGCAGAAGGCAGCGGG - Intergenic
1092090830 12:5802452-5802474 CCTCCCCTGCAGGTGACAGAAGG - Intronic
1092963852 12:13622699-13622721 CATCCCACGCAGAAGGCAGAAGG + Intronic
1093071812 12:14713786-14713808 ACTGCCATGCAGAAGGCATGTGG + Intergenic
1096536547 12:52278773-52278795 CCTCCTCTTGAGAAGGCAGAAGG + Intronic
1097161461 12:57049206-57049228 GCCCCCATGCAGTAGGCACATGG + Intronic
1097988023 12:65804762-65804784 CCTCCCTTCCTGAAAGCAGAGGG - Intergenic
1098063541 12:66587794-66587816 CATTCCGTGCAGAAGGCAGAGGG + Intronic
1099012809 12:77312215-77312237 CATCTCAGGCAGAAGGCTGAGGG + Intergenic
1100123696 12:91397740-91397762 CATCCCATGGAGAAGGCAGAAGG + Intergenic
1100489438 12:95064634-95064656 CCTCCCCCCCAGATGGCAGATGG - Intronic
1102625597 12:114233093-114233115 CCTCCCAACCTGAAGCCAGAGGG - Intergenic
1103282937 12:119775396-119775418 CCTGCCCTGCAGAAGGCTGGAGG - Intronic
1103377044 12:120465047-120465069 ACTCCCATGCAATATGCAGAAGG + Intronic
1103919087 12:124390149-124390171 CCTCCCCTGCAGAGGGCAGAGGG - Intronic
1104081909 12:125436529-125436551 CGTCGCATGAAGAAGGCAGAGGG + Intronic
1104605431 12:130184315-130184337 CCTGCCATGCGGGAGGCACAGGG - Intergenic
1104748012 12:131221920-131221942 CCTCGCTGGCAGAGGGCAGAGGG + Intergenic
1104810361 12:131616855-131616877 CCTCCCAAACAGAAGTCACAAGG + Intergenic
1105304775 13:19160753-19160775 CCACTCACTCAGAAGGCAGAAGG + Intergenic
1105370903 13:19801107-19801129 CTTCATATGCACAAGGCAGAAGG - Intergenic
1105577531 13:21668001-21668023 CCACACATGGAGTAGGCAGAGGG + Intergenic
1106676270 13:31961833-31961855 CATCCTCTGCAGAAGGCAGTTGG + Intergenic
1106769543 13:32948555-32948577 CCTCCCATGGGGAAGCAAGAAGG - Intergenic
1107457076 13:40564858-40564880 CCAGGCATGCAGATGGCAGATGG - Intronic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1112464158 13:99629126-99629148 CCTCCAATGCATAAGCCAAATGG - Intronic
1113645114 13:111989369-111989391 GATCTCAGGCAGAAGGCAGAAGG - Intergenic
1113681919 13:112250485-112250507 CCCTCCAGGCAGAAGGCAGAAGG + Intergenic
1114870055 14:26645258-26645280 TCTCCCATGCAGGAGGCATGGGG + Intergenic
1115530229 14:34320284-34320306 CCTCTAATGCAGCAGCCAGAAGG - Intronic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1116511823 14:45756061-45756083 TCTCCCAGGCAGGAGGCACAAGG + Intergenic
1117028752 14:51648771-51648793 TCTCCCATGCACCAGGCAAAGGG - Intronic
1117727912 14:58692468-58692490 TCTCCCATGCAGGAGTCAGGAGG + Intergenic
1118605222 14:67497890-67497912 ACAACCATACAGAAGGCAGAAGG - Intronic
1118912750 14:70075511-70075533 CCAACAAGGCAGAAGGCAGAAGG - Intronic
1119168729 14:72516466-72516488 CCTCTCACCCAGAAGCCAGAAGG + Intronic
1120247035 14:82019640-82019662 CCTCCCATGCACAAGGTAGCTGG + Intergenic
1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG + Intergenic
1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG + Intergenic
1121078809 14:91090948-91090970 CCTCTCTTGCAGAGGGCAAAGGG - Intronic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121668736 14:95692031-95692053 CCTTGCAGGCAGAAGGCAGTAGG + Exonic
1121831512 14:97056219-97056241 GCTCCCATGCAGGTGGCAGGGGG + Intergenic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122742573 14:103880722-103880744 CCTCCCATGACGAAGGGAGGTGG - Intergenic
1122878054 14:104677860-104677882 CCTCCCAAGGAGGAGGCAGATGG + Intergenic
1123003198 14:105307608-105307630 CCCCCCATGCAGCAGTCAGCAGG + Exonic
1124821514 15:33051082-33051104 CCCCCCTTTAAGAAGGCAGAGGG + Intronic
1126317257 15:47383375-47383397 CCTCCCATGACGAGGGAAGATGG + Intronic
1126786133 15:52179432-52179454 CCTCCCATGCGGAGGGCAGGGGG - Intronic
1127256309 15:57296664-57296686 TCTCACATGCAGAAGGCAATGGG + Intronic
1127467404 15:59257693-59257715 CTTCCCATGCTGTAGGCAGGGGG + Intronic
1127729864 15:61789824-61789846 CCACCTAGGCAGAAGCCAGAGGG - Intergenic
1127847507 15:62884067-62884089 CCTCCCAGGCCTAAAGCAGATGG - Intergenic
1128568786 15:68718558-68718580 CGGCCCATGCAGAGGGCAGGGGG - Intronic
1128704827 15:69831376-69831398 TCTTCCAGGGAGAAGGCAGAGGG - Intergenic
1128883748 15:71266145-71266167 TCTCCCAGTCAGAAGGCACAGGG - Intronic
1129976518 15:79826696-79826718 GCTTTCATGCAGAAGGCAGAGGG - Intergenic
1130256303 15:82327584-82327606 CCTGCCATGGAGAGGGCAGCTGG - Intergenic
1130598648 15:85262404-85262426 CCTGCCATGGAGAGGGCAGCTGG + Intergenic
1131247993 15:90812520-90812542 CCTACTAGCCAGAAGGCAGAGGG - Intronic
1131313535 15:91312191-91312213 CCTCCCAGGAAGAAAGCAGTGGG - Intergenic
1132415350 15:101615233-101615255 CCTACCATGGGGAATGCAGAAGG + Intergenic
1132549269 16:547637-547659 GCTCCCCTGCAGCCGGCAGAGGG - Exonic
1132971894 16:2693210-2693232 CCTGCCATGCTGAGGGCAGTGGG + Intronic
1133791595 16:9013350-9013372 CCACCCCTGCAGGCGGCAGATGG - Intergenic
1134053619 16:11155446-11155468 TCTCCCCTGCAGATAGCAGAAGG + Intronic
1134243105 16:12520249-12520271 CCTCCTCTTCACAAGGCAGATGG + Intronic
1135137770 16:19897531-19897553 ACCCCCATACAGAGGGCAGAGGG - Intergenic
1135787563 16:25364013-25364035 GCTCCTATCCAGCAGGCAGAGGG + Intergenic
1135991990 16:27223916-27223938 GCTACCATGAAGAAGGCAGCTGG + Intergenic
1136737488 16:32477096-32477118 GCTCCCAGGCCGAAGGCAGCAGG + Intergenic
1137031573 16:35528902-35528924 TGTCTCATGCAGAATGCAGATGG + Intergenic
1138840147 16:60491757-60491779 TCTCTGATGCAGAAGGGAGAAGG + Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139650943 16:68361764-68361786 CCACACATGCAGGAGGCAGGTGG + Intronic
1141007374 16:80364899-80364921 CCTCTCATGGTGACGGCAGAGGG - Intergenic
1203015583 16_KI270728v1_random:352481-352503 GCTCCCAGGCCGAAGGCAGCAGG - Intergenic
1203033918 16_KI270728v1_random:625639-625661 GCTCCCAGGCCGAAGGCAGCAGG - Intergenic
1142728301 17:1832245-1832267 CCACCCAGGCAGTGGGCAGAGGG - Intronic
1143415911 17:6749971-6749993 TCTGCCATGAAGAAGACAGAAGG + Intergenic
1144711334 17:17403563-17403585 CTGTCCATGCAGACGGCAGATGG - Intergenic
1145980388 17:29007682-29007704 AGTCCCAGGCAGCAGGCAGATGG + Intronic
1147383853 17:40070693-40070715 CCACCCTAGCAGCAGGCAGAGGG + Intronic
1148864133 17:50619791-50619813 CCTCCCAGGCTGGGGGCAGAAGG - Exonic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151745897 17:76011663-76011685 CTTCTCCTGGAGAAGGCAGAGGG + Exonic
1152089047 17:78237040-78237062 GCTCCCAGGCACAATGCAGAGGG - Intronic
1152570595 17:81119727-81119749 CCTCCCATGCAGCACGGACAAGG + Intronic
1153300337 18:3586571-3586593 CCACCTATTCAGCAGGCAGAGGG - Intronic
1153519925 18:5941967-5941989 CTCCCCAGGCACAAGGCAGATGG + Intergenic
1153583061 18:6594726-6594748 CCGCTCATGGGGAAGGCAGAAGG + Intergenic
1153963223 18:10157840-10157862 CATCCTCTGCAGAAGTCAGAGGG + Intergenic
1155273835 18:24167118-24167140 CCTCCCAGCCAGATGCCAGAGGG + Intronic
1157675281 18:49563929-49563951 CCACTCATGCAGAGGCCAGATGG - Intronic
1158201557 18:54947313-54947335 GCTCCCAGGGAGGAGGCAGAGGG + Intronic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1163192574 19:15688187-15688209 GCTCCCATGCAGTTGGCACAAGG - Intronic
1163250348 19:16123000-16123022 CCTCCCCTGCACCAGGCAGTGGG + Intronic
1163302649 19:16457597-16457619 GCAGCCATGCAGAGGGCAGAAGG + Intronic
1164457855 19:28423492-28423514 CCTCCCCTTCAGTATGCAGATGG - Intergenic
1164684476 19:30157839-30157861 CCTCACGTGGTGAAGGCAGAAGG - Intergenic
1164826087 19:31285904-31285926 GCTCCCATGGAGGAGGCAGCTGG + Intronic
1166129394 19:40736974-40736996 CCTGCCCTACAGAAGGCAGATGG + Exonic
1167460407 19:49621539-49621561 CCCCCCATGCGGAAGATAGACGG + Exonic
1168115657 19:54220320-54220342 CCTGGCATGCAGAAGGCACCAGG - Intronic
1168118644 19:54240066-54240088 CCTGGCATGCAGAAGGCACCAGG - Intronic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
926204814 2:10828554-10828576 CCGCCCATGCAGATGGCAGCTGG + Intronic
926385159 2:12328510-12328532 CAGCCTATGCAGAAGTCAGATGG - Intergenic
926811557 2:16759405-16759427 CCTCATATGGACAAGGCAGATGG - Intergenic
927191082 2:20517364-20517386 CCTTTCCTGAAGAAGGCAGAGGG - Intergenic
930222242 2:48756320-48756342 CTTACCATGTAGAAGCCAGAAGG - Intronic
931831190 2:66053178-66053200 CATCCATGGCAGAAGGCAGAGGG + Intergenic
931874409 2:66496319-66496341 TCTCCCCTGCAGGAGGCATACGG - Intronic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935738837 2:106128640-106128662 TCTTGCTTGCAGAAGGCAGACGG + Intronic
937198253 2:120179667-120179689 TCTCCCAGGCAGAAAACAGAGGG - Intergenic
937280832 2:120716213-120716235 CCTCCCAGGCAGCAGGCAGCAGG + Intergenic
938365531 2:130730153-130730175 CCTCCCATCCAGGAGGCACCAGG + Exonic
938945688 2:136210147-136210169 CCCCACTTGCAGAAGGCACACGG + Intergenic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
939955813 2:148526968-148526990 CCTCCCATGGAGAAGTCACTGGG + Intergenic
939955836 2:148527078-148527100 CATCCCATGCAGATAGAAGATGG + Intergenic
940542225 2:155035427-155035449 CTACCCAGGCAGCAGGCAGATGG + Intergenic
940718755 2:157258497-157258519 CCTAACAAGCAGAAGACAGACGG + Exonic
941571446 2:167175590-167175612 TCTCCCAGGCAGGAGGCAGGCGG + Intronic
942277039 2:174330851-174330873 CCTGCCATGAACAAGGGAGAAGG - Intergenic
942681469 2:178481050-178481072 CCTCCCCTGAAGAGGCCAGAAGG - Intronic
944920212 2:204404801-204404823 CCTCCAATGCACAAGGCAGACGG - Intergenic
945389066 2:209242115-209242137 TCTCCCAGTCAGAAGGCACAGGG - Intergenic
945570378 2:211459671-211459693 CATATCATGCAGAAGGCAAAAGG - Intronic
945818222 2:214631668-214631690 CATCCTATGCAGAATGCAGGGGG - Intergenic
946658044 2:221970070-221970092 TCCCCCATGAAGAAGGCAGAAGG - Intergenic
947263015 2:228245771-228245793 CCGCCACCGCAGAAGGCAGATGG - Intergenic
948016310 2:234693480-234693502 CCTTCCATACAGCAGCCAGAGGG - Intergenic
1170789615 20:19496984-19497006 ACTCACAAGGAGAAGGCAGAAGG - Intronic
1171079753 20:22166792-22166814 CCACACATTCAGAAGGCACAGGG - Intergenic
1171443712 20:25187796-25187818 TATCCCATGCTGAAGGCAGGAGG + Intergenic
1173827122 20:46055212-46055234 CCTCCCAGCCAGGAGGCAGAGGG + Intronic
1173957787 20:47047843-47047865 CCTCCCATGGAGCCTGCAGAAGG - Intronic
1174106161 20:48163885-48163907 CCTCCCGTGAAGGAGGCAGCTGG + Intergenic
1174884012 20:54311816-54311838 CCTCACATTCAGGAGGCAGAAGG + Intergenic
1175963471 20:62648494-62648516 GCTCCCATGCAGCCGGCAGGTGG - Intronic
1177486043 21:21757573-21757595 CCTCACATGGCAAAGGCAGAAGG + Intergenic
1178410733 21:32361845-32361867 TGTCCCATGCAAAAGGCAGAGGG + Intronic
1179392764 21:41008982-41009004 GCTCCCATCCAGAGGCCAGACGG - Intergenic
1179805627 21:43835341-43835363 TCTCCTCTGCAGAAGACAGATGG - Intergenic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1181788464 22:25244375-25244397 AATCCCACGCAGAAGTCAGAGGG + Intergenic
1181820145 22:25469073-25469095 AATCCCATGCAGAAGTCAGAGGG + Intergenic
1182300895 22:29336332-29336354 CCTCCCATGACCAAGGCAGTGGG + Intronic
1183473982 22:38025889-38025911 CATCCCATGTAGAAGACAGGAGG - Intronic
1184174754 22:42782005-42782027 GCTTCAAAGCAGAAGGCAGAAGG - Intergenic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
949472972 3:4415877-4415899 CTCCCCTGGCAGAAGGCAGAAGG - Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949591087 3:5495039-5495061 CTTCCCATGCAGATGACAAAAGG - Intergenic
950635873 3:14314157-14314179 CCCCCCTTGAAGCAGGCAGAGGG + Intergenic
950749859 3:15120096-15120118 TATCCCATGCAGAGGTCAGATGG - Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
953389825 3:42527641-42527663 CTTCCCCTGGAGAAGGCAGGTGG + Intronic
953833597 3:46324207-46324229 CCTATGATTCAGAAGGCAGACGG - Intergenic
953897496 3:46813405-46813427 CGGCCTGTGCAGAAGGCAGATGG - Intergenic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956765500 3:72481141-72481163 CCTCCCACGCAGAAGGCAGAAGG - Intergenic
957582340 3:82090318-82090340 AGTCCCATGAAGAAGGCAAAAGG + Intergenic
958907061 3:99953863-99953885 CTGCCCATGCTGGAGGCAGAAGG + Intronic
959195199 3:103171547-103171569 TATCTCATGCAGAAGGCAGAAGG + Intergenic
960148237 3:114226052-114226074 CCTGTCATGCAGCAGGCACATGG + Intergenic
960632435 3:119745816-119745838 TCTCCCATAGAGAAGGCATAGGG + Intronic
961435375 3:126912905-126912927 CCTTCCCTGCAGAAGGCCGAGGG + Intronic
962883587 3:139601857-139601879 CCTACAATGTTGAAGGCAGATGG + Intronic
963017502 3:140839839-140839861 CAGCCCAGGGAGAAGGCAGAGGG - Intergenic
965023979 3:163274263-163274285 CTCCCCATGAAGAAGACAGAAGG - Intergenic
965224614 3:165972290-165972312 CAGCCCATGAAGAAGGCAGGAGG + Intergenic
966608371 3:181844304-181844326 CCTCCCCTCCAGCAGGTAGAGGG - Intergenic
967949234 3:194828039-194828061 CATCCCAGGAAGAAGGCAGTAGG + Intergenic
968066354 3:195761751-195761773 CCGCCCCTCCCGAAGGCAGACGG - Intronic
968453518 4:686202-686224 CCACCCATGAGGAAGGCAAATGG + Exonic
968455978 4:700006-700028 CCTCCCACGGAGCAGCCAGAGGG + Intergenic
968900582 4:3429815-3429837 CCTCCCAGGCCTAGGGCAGAGGG - Intronic
969479490 4:7440473-7440495 CCTGCCATGCAGAAGGGAAGGGG + Intronic
971360885 4:25937386-25937408 CATCCCATGGTGAAGGCAAAAGG + Intergenic
971381323 4:26100997-26101019 CCTCCCAAGTAGAAGGCATAAGG + Intergenic
972192340 4:36610105-36610127 CTCCCCAGGCAGAAGGCAGGTGG - Intergenic
974286288 4:59871854-59871876 CATCCAATACAGAGGGCAGAAGG + Intergenic
974350533 4:60738878-60738900 TCCTGCATGCAGAAGGCAGATGG - Intergenic
975466276 4:74713413-74713435 CCTCCCAGTCAGGAGGCACAGGG + Intergenic
975524316 4:75331989-75332011 TCTCCCAGTCAGGAGGCAGAGGG - Intergenic
977154545 4:93555793-93555815 TCTCCCAGGCAGGAGGCACAAGG - Intronic
979048119 4:115895642-115895664 TGTCCTATGCAGAAGACAGATGG + Intergenic
980865975 4:138553466-138553488 CCTCCCATCCAGAGGACAGTCGG - Intergenic
981359337 4:143829187-143829209 CCTCCCTTTCTGAAGGCACAGGG - Intergenic
981379872 4:144060201-144060223 CCTCCCTTTCTGAAGGCACAGGG - Intergenic
981534641 4:145786601-145786623 TTTTCCATGCAGAAAGCAGAGGG + Intronic
981794880 4:148585048-148585070 TCTCCCAGTCAGAAGGCACAGGG + Intergenic
982331361 4:154185192-154185214 CCTACATGGCAGAAGGCAGAGGG - Intergenic
982345176 4:154349553-154349575 CCTCCCATGAAGTAAGGAGAAGG - Intronic
982382329 4:154762293-154762315 CCTCACAATCAGAATGCAGAGGG + Intergenic
982784235 4:159523350-159523372 CCTCCCTCCCAGACGGCAGACGG - Intergenic
984058765 4:174965189-174965211 CCTCCGTGGCAGAAAGCAGAAGG + Intronic
985652693 5:1114239-1114261 CCTGCCAGGCAGAAGGCAGGTGG + Intergenic
985653001 5:1115714-1115736 CCTGCCAGGCAGAAGGCGGGTGG - Intergenic
986239175 5:5941806-5941828 CCTCCCAGCCAGAAGCCAGGTGG - Intergenic
986283945 5:6346319-6346341 GCTTCCGTTCAGAAGGCAGAAGG - Intergenic
986417637 5:7544890-7544912 ACTCCCATGGAGAAAGCACAAGG + Intronic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
987210592 5:15678041-15678063 TTTCCCATGCAGGAGACAGAAGG - Intronic
988468401 5:31513191-31513213 CCTCACACGCAGGATGCAGAGGG - Intronic
989521034 5:42400314-42400336 CCCCTCATGCAGAAGACAAAAGG + Intergenic
990481916 5:56220016-56220038 CCTCCGGTGCAGCAGGCAGCTGG - Intronic
991408969 5:66328330-66328352 CCTCCCATGTGGAAGGCAGAAGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992479685 5:77138233-77138255 CCTCCCATCCTGAAGCCACATGG + Intergenic
992596999 5:78357301-78357323 CCACTCATGCAGAAGGCAAAGGG - Intergenic
992661878 5:78970023-78970045 ACTCCCAAGCAGCAGTCAGATGG - Intronic
992787113 5:80181032-80181054 ACACCCCTGGAGAAGGCAGAAGG - Intronic
993460088 5:88172599-88172621 TCTCCCAGTCAGAAGGCACAGGG + Intergenic
995401449 5:111746930-111746952 CCTCTGATGCAGAAGGCACTAGG + Intronic
996220030 5:120919889-120919911 CCTCTCCTGCAGCAGGCACATGG - Intergenic
997386804 5:133480135-133480157 CCCCGCATGCAGTAGGCAGATGG + Intronic
999644050 5:153700649-153700671 CCTTCCCTGCACAAGGCAGCTGG - Intronic
1001154780 5:169263485-169263507 CCTCCCCTGCAGATTTCAGAAGG + Intronic
1001534352 5:172488382-172488404 CCTGCCATGCACCAGGCAGGGGG - Intergenic
1002673599 5:180890384-180890406 TCTCCCAATCAGAAGGCACAGGG - Intergenic
1003186790 6:3839169-3839191 CCACTCAAGCAGAAGGCAAAAGG + Intergenic
1003303253 6:4903870-4903892 TCTCCCAGGCAGACGGCTGATGG - Intronic
1003442349 6:6154933-6154955 CATACCATGGAGAAGACAGATGG - Intronic
1003920333 6:10826768-10826790 CATCCCATCCAGAATGCATAGGG - Intronic
1004335147 6:14757642-14757664 CCTCCCTTGCAGACCTCAGAAGG - Intergenic
1004522772 6:16377990-16378012 CTTGCCATGAAGTAGGCAGAAGG - Intronic
1006149493 6:31979107-31979129 CATCCCATGGAGAGGGCACAGGG + Intronic
1007064637 6:38977421-38977443 GCTCCCATAAGGAAGGCAGAAGG - Intronic
1007509539 6:42364672-42364694 CAGCCCCTGCAGAAGGCAGGAGG + Intronic
1007512240 6:42382432-42382454 GCTGCCAAGCAGAAGGCAGTAGG + Intronic
1007709000 6:43809721-43809743 ACTGCCATACAGAAGGCGGATGG + Intergenic
1010410644 6:75557665-75557687 CCTCCCCTGCAAAAGACAGTGGG - Intergenic
1011191911 6:84738346-84738368 CATACCATGCAGAAGACAGATGG + Intronic
1011298873 6:85853338-85853360 TCTCCCAGTCAGGAGGCAGATGG + Intergenic
1013079779 6:106802039-106802061 CCTTCCCAGCAGAAGGCAGGAGG - Intergenic
1016542232 6:145178634-145178656 TCTCCCATTCAGGAGGCAGGGGG - Intergenic
1016798554 6:148144215-148144237 CCCCCCAGTCAGAAGCCAGATGG + Intergenic
1016827038 6:148397997-148398019 CTTCCCAATCAGAAGGCACAGGG + Intronic
1017038443 6:150288085-150288107 CTTGCCATGCAGAACACAGAAGG + Intergenic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1018163380 6:161069811-161069833 GCTCCCATGGAGCAGGGAGAAGG + Intronic
1018719229 6:166560204-166560226 CTTCCCCTGCAGAACACAGAGGG - Intronic
1019682517 7:2359336-2359358 CCTGCCACCCAGAAGGAAGAGGG + Intronic
1019907370 7:4074991-4075013 CCTCCCAGGGAGAGGGGAGAAGG - Intronic
1020049440 7:5072278-5072300 CCTGGCACGCAGAAGCCAGAGGG + Intronic
1020130451 7:5556225-5556247 CCTGGCCTGCAGCAGGCAGAGGG - Intronic
1020396607 7:7724626-7724648 TGGCCTATGCAGAAGGCAGATGG + Intronic
1021653417 7:22853236-22853258 CCTCCCCTGCAGATTTCAGAGGG - Intergenic
1021986808 7:26105261-26105283 CCTGCCCTGCAGAAGGCTGGAGG - Intergenic
1022151165 7:27608284-27608306 CCTCCAAGGCAAAAGACAGAAGG + Intronic
1022781522 7:33589294-33589316 CGTCCCATGCAGGATGGAGAAGG + Intronic
1022800395 7:33771412-33771434 GGTCCCAGGCAGAAGACAGAGGG - Intergenic
1023793204 7:43770131-43770153 CCTAGCTTGCAGAGGGCAGAAGG - Intronic
1023922892 7:44643474-44643496 ACTCCCCTGCATGAGGCAGATGG + Intronic
1025102927 7:56150697-56150719 CCTCCCTCCCAGACGGCAGACGG - Intergenic
1027775905 7:82463829-82463851 TCTGCCATGCAGAAAGGAGAGGG + Intergenic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1029374369 7:100168969-100168991 CCTCCCATCCTGAAGGCAGGGGG + Intergenic
1029446025 7:100613118-100613140 CCTCCGGGGCAGAAGGCAGAGGG + Intronic
1029639783 7:101813949-101813971 CCTCCCATGGGGAAGGCTCAAGG - Intergenic
1030116294 7:106064751-106064773 CCTCCCAGCCAGCAGGCAGCAGG + Intergenic
1030242481 7:107343646-107343668 ACTCCCACGTAGAAGACAGAGGG + Intronic
1033969306 7:147019630-147019652 CCTTACATGCAATAGGCAGAAGG - Intronic
1034237413 7:149583145-149583167 CCTCCCAGGCAGCAGGAAGATGG - Intergenic
1034240432 7:149606516-149606538 CCTCCCAGGCAGCAGAAAGATGG - Intergenic
1034563104 7:151894313-151894335 CCTCCCATGCAGCCTTCAGAGGG + Intergenic
1035283473 7:157792194-157792216 CACACCTTGCAGAAGGCAGATGG - Intronic
1036480391 8:9134074-9134096 AATCCCATGCAGAAAGCAAAAGG + Intergenic
1037038149 8:14194936-14194958 CCTCACGTGCAGAATTCAGAGGG + Intronic
1039494446 8:37970022-37970044 CCGCCCAAGCAGATGGCAGGGGG + Intergenic
1040473797 8:47759578-47759600 TCTCCCAGTCAGAAGGCACAGGG + Intergenic
1043253594 8:78106048-78106070 TCTCCCATTCAGGAGGCACAGGG + Intergenic
1044286072 8:90413360-90413382 CAGCCTGTGCAGAAGGCAGATGG - Intergenic
1044632480 8:94292832-94292854 CCTCTCATCCATGAGGCAGATGG - Intergenic
1048394948 8:134005270-134005292 AGTCCCAAGAAGAAGGCAGAAGG - Intergenic
1048874952 8:138829277-138829299 CTGCCCATGCAGGAGGAAGATGG + Intronic
1049039210 8:140099639-140099661 TCTCCCTTGCAGAAGGCTGTGGG - Intronic
1049574562 8:143384328-143384350 CCCACCATGCAGGAGGCAGGTGG - Intergenic
1050208723 9:3228656-3228678 CCTCATATGTAGAAGGCATAGGG + Intronic
1050301386 9:4262199-4262221 CCTCCCATCCAGGAGGTAGCCGG - Intronic
1051095308 9:13459310-13459332 CATCCCATTCAGAAGGCTGGGGG + Intergenic
1051336444 9:16070444-16070466 GCTCCCTTGCAGAAGCCAGAAGG + Intergenic
1053107789 9:35427144-35427166 CCTGCCATGAAGAAAGAAGAAGG - Intergenic
1054748139 9:68876401-68876423 CTTCCCAGGAAGAAGGCACAAGG + Intronic
1055127990 9:72741628-72741650 GTTCCACTGCAGAAGGCAGATGG + Intronic
1056824051 9:89864559-89864581 CCTTCCCTGAAGAAGCCAGAGGG - Intergenic
1057125469 9:92612810-92612832 CCTCCCAGGCTGAATGCACAGGG + Intronic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1058930388 9:109713200-109713222 GCTCCCAAGAAGAAGGAAGAAGG - Intronic
1059306473 9:113357109-113357131 CCTCCTATTGAGAAGACAGAAGG + Intronic
1059901439 9:118930739-118930761 CCTAGGAGGCAGAAGGCAGAAGG - Intergenic
1060110249 9:120901777-120901799 CCTCCCATCCAGCAGGAAGCAGG + Intergenic
1060936893 9:127521355-127521377 ACTCCCAGGCAGCAGACAGAGGG + Intronic
1061237100 9:129349578-129349600 CCTCCCCTGAAGAAGCCACAGGG - Intergenic
1061679419 9:132235705-132235727 CCTCCCGTGCAGAAGGTATGGGG + Intronic
1062005949 9:134238536-134238558 CCACCCTGGCAGAAGGCAGTGGG + Intergenic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1190782802 X:53614669-53614691 CCATCAATCCAGAAGGCAGATGG - Exonic
1190946068 X:55095352-55095374 TCTCCCATTCAGGAGGCACAGGG + Intronic
1191875072 X:65787772-65787794 ACTCCCATGCAGAGTGAAGATGG + Intergenic
1192502851 X:71664839-71664861 CCTCCCAGGCTGTAGGCAGAGGG + Intergenic
1192661681 X:73048670-73048692 TGGCCCATGCAGAAGACAGATGG - Intergenic
1193642975 X:84034495-84034517 TCTCTCATGCAGAAGGGAGTTGG - Intergenic
1195222793 X:102762502-102762524 CCTCCCAAGCAGAAGTGATAAGG - Intergenic
1198127682 X:133662404-133662426 CCTCTCATGGAGAACGCAGAGGG - Intronic
1198301904 X:135341773-135341795 TGGCCTATGCAGAAGGCAGATGG + Exonic
1198727597 X:139692948-139692970 TCTCCCATGCCCATGGCAGATGG - Intronic
1198792110 X:140356975-140356997 CCTCCCATGCTGCAAGCATATGG - Intergenic
1199549173 X:149039932-149039954 ACTCCATGGCAGAAGGCAGAAGG + Intergenic
1199843330 X:151672823-151672845 CCACACATGCAGAAGGATGATGG - Intronic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic