ID: 1121167662

View in Genome Browser
Species Human (GRCh38)
Location 14:91822755-91822777
Sequence ACGCCACTGCACTCCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 715583
Summary {0: 20980, 1: 129116, 2: 240855, 3: 208608, 4: 116024}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121167662_1121167665 10 Left 1121167662 14:91822755-91822777 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1121167665 14:91822788-91822810 CACTGTAAGCTCTGTCTTCTGGG 0: 1
1: 15
2: 724
3: 11996
4: 72796
1121167662_1121167664 9 Left 1121167662 14:91822755-91822777 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1121167664 14:91822787-91822809 TCACTGTAAGCTCTGTCTTCTGG 0: 1
1: 33
2: 1481
3: 23621
4: 110388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121167662 Original CRISPR ACGCCACTGCACTCCAGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr