ID: 1121167663

View in Genome Browser
Species Human (GRCh38)
Location 14:91822756-91822778
Sequence CACGCCACTGCACTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696546
Summary {0: 22044, 1: 109955, 2: 188319, 3: 217928, 4: 158300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121167663_1121167665 9 Left 1121167663 14:91822756-91822778 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1121167665 14:91822788-91822810 CACTGTAAGCTCTGTCTTCTGGG 0: 1
1: 15
2: 724
3: 11996
4: 72796
1121167663_1121167664 8 Left 1121167663 14:91822756-91822778 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1121167664 14:91822787-91822809 TCACTGTAAGCTCTGTCTTCTGG 0: 1
1: 33
2: 1481
3: 23621
4: 110388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121167663 Original CRISPR CACGCCACTGCACTCCAGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr