ID: 1121167664

View in Genome Browser
Species Human (GRCh38)
Location 14:91822787-91822809
Sequence TCACTGTAAGCTCTGTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135524
Summary {0: 1, 1: 33, 2: 1481, 3: 23621, 4: 110388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121167663_1121167664 8 Left 1121167663 14:91822756-91822778 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1121167664 14:91822787-91822809 TCACTGTAAGCTCTGTCTTCTGG 0: 1
1: 33
2: 1481
3: 23621
4: 110388
1121167662_1121167664 9 Left 1121167662 14:91822755-91822777 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1121167664 14:91822787-91822809 TCACTGTAAGCTCTGTCTTCTGG 0: 1
1: 33
2: 1481
3: 23621
4: 110388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121167664 Original CRISPR TCACTGTAAGCTCTGTCTTC TGG Intronic
Too many off-targets to display for this crispr