ID: 1121168826

View in Genome Browser
Species Human (GRCh38)
Location 14:91836324-91836346
Sequence GTCCCACGCCCGCGCTGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121168807_1121168826 25 Left 1121168807 14:91836276-91836298 CCGCGCCTTTCCCCGCCCGGGTC 0: 1
1: 0
2: 1
3: 33
4: 232
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168804_1121168826 30 Left 1121168804 14:91836271-91836293 CCACGCCGCGCCTTTCCCCGCCC 0: 1
1: 0
2: 7
3: 88
4: 813
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168813_1121168826 9 Left 1121168813 14:91836292-91836314 CCGGGTCCCGCCGCCCTCCTCCG 0: 1
1: 0
2: 4
3: 43
4: 437
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168810_1121168826 14 Left 1121168810 14:91836287-91836309 CCCGCCCGGGTCCCGCCGCCCTC 0: 1
1: 1
2: 3
3: 67
4: 598
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168809_1121168826 15 Left 1121168809 14:91836286-91836308 CCCCGCCCGGGTCCCGCCGCCCT 0: 1
1: 0
2: 8
3: 46
4: 481
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168812_1121168826 10 Left 1121168812 14:91836291-91836313 CCCGGGTCCCGCCGCCCTCCTCC 0: 1
1: 1
2: 4
3: 65
4: 713
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168816_1121168826 3 Left 1121168816 14:91836298-91836320 CCCGCCGCCCTCCTCCGGGTCTC 0: 1
1: 0
2: 3
3: 33
4: 342
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168819_1121168826 -4 Left 1121168819 14:91836305-91836327 CCCTCCTCCGGGTCTCCACGTCC 0: 1
1: 0
2: 1
3: 17
4: 252
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168808_1121168826 20 Left 1121168808 14:91836281-91836303 CCTTTCCCCGCCCGGGTCCCGCC 0: 1
1: 0
2: 6
3: 49
4: 494
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168821_1121168826 -8 Left 1121168821 14:91836309-91836331 CCTCCGGGTCTCCACGTCCCACG 0: 1
1: 0
2: 0
3: 1
4: 105
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168811_1121168826 13 Left 1121168811 14:91836288-91836310 CCGCCCGGGTCCCGCCGCCCTCC 0: 1
1: 0
2: 1
3: 72
4: 683
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168820_1121168826 -5 Left 1121168820 14:91836306-91836328 CCTCCTCCGGGTCTCCACGTCCC 0: 1
1: 0
2: 1
3: 23
4: 316
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168817_1121168826 2 Left 1121168817 14:91836299-91836321 CCGCCGCCCTCCTCCGGGTCTCC 0: 1
1: 0
2: 1
3: 54
4: 560
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130
1121168818_1121168826 -1 Left 1121168818 14:91836302-91836324 CCGCCCTCCTCCGGGTCTCCACG 0: 1
1: 0
2: 0
3: 28
4: 272
Right 1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121168826 Original CRISPR GTCCCACGCCCGCGCTGGGC CGG Intronic
900408987 1:2504439-2504461 GGCCCAGGCCCAGGCTGGGCAGG - Exonic
900418759 1:2546644-2546666 GTCTGTCGCCTGCGCTGGGCAGG + Intergenic
902747006 1:18481111-18481133 TTCCCACCCCACCGCTGGGCTGG - Exonic
902896854 1:19485351-19485373 GTCCCAGGCCAGGGATGGGCAGG + Intronic
903048992 1:20587136-20587158 GTCCCAGGCCTGGGCAGGGCTGG + Intergenic
904792832 1:33036634-33036656 GTCCCCGGCCCGCTCCGGGCAGG + Intronic
904822721 1:33256127-33256149 GCCCCCCGCCCGCGCCGCGCCGG - Intergenic
905569188 1:38990978-38991000 CCCCCACGCCCGCGCAGCGCAGG + Intergenic
908473757 1:64469951-64469973 CTCCCCTGCCCGGGCTGGGCCGG + Intergenic
919539599 1:198830543-198830565 GTCACACGCCTGAGCTGGGAGGG + Intergenic
919640391 1:200039870-200039892 CTCCCGCGCCCGCGCGGGGCGGG - Intronic
1063117745 10:3084232-3084254 GTCCCAGCCCCGCGCAGGGAAGG + Intronic
1063978764 10:11437439-11437461 GTCCCACCCATGCCCTGGGCAGG - Intergenic
1064859781 10:19815598-19815620 GCCACCCTCCCGCGCTGGGCTGG + Intergenic
1065188704 10:23192336-23192358 GGCCCGCGCTCGCGCTGCGCTGG - Exonic
1067176079 10:43946661-43946683 GTCCCACGCCCTCGAGGAGCGGG + Intergenic
1070923799 10:80205228-80205250 GCCGCAGGGCCGCGCTGGGCTGG + Intronic
1071568064 10:86681629-86681651 GTCCCGGGCCCCCTCTGGGCTGG - Exonic
1074586022 10:114768289-114768311 CACCCGCGGCCGCGCTGGGCGGG + Intergenic
1082836872 11:57657518-57657540 GTTGCGCCCCCGCGCTGGGCAGG - Exonic
1083608619 11:63994157-63994179 GTCCCAGGCCTGAGCAGGGCGGG + Intronic
1084749305 11:71193731-71193753 GTCCCACGCCCCCGGAGGCCAGG + Intronic
1090977251 11:131688535-131688557 CTCCCAGGCACACGCTGGGCAGG + Intronic
1091356623 11:134942410-134942432 GTCCTACGCCCCTGCTGGGAGGG - Intergenic
1091400849 12:179725-179747 CTCCCAGGCCCGGGCTGAGCTGG - Intergenic
1094025773 12:25958734-25958756 CTCCTACGCCCGCGCTCGTCCGG + Intergenic
1095942658 12:47736979-47737001 CTGCCACGCCCACTCTGGGCTGG + Intronic
1097041805 12:56160450-56160472 CTCCCACTCCTGGGCTGGGCTGG - Intronic
1097269441 12:57765270-57765292 GTCCCAGGACAGAGCTGGGCAGG - Intronic
1100978123 12:100142929-100142951 GGCCAACGCCGGCTCTGGGCGGG + Intergenic
1102913757 12:116737897-116737919 GCCCCACGTCCGCGCCGGGATGG - Exonic
1103509957 12:121467363-121467385 CTCGCACGCCCGCGCTGGAGGGG + Intronic
1104887202 12:132117603-132117625 GTCACAGGCCAGCGCAGGGCAGG + Intronic
1111445960 13:88345861-88345883 GTCCCAGCCCCTCTCTGGGCTGG - Intergenic
1113837437 13:113337732-113337754 GGGCCACGCCCCCGTTGGGCTGG - Intronic
1114483203 14:23047943-23047965 GCCCCCCCCCCGCGGTGGGCCGG + Exonic
1116811608 14:49545098-49545120 GGCACAAGCCCTCGCTGGGCAGG - Intergenic
1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG + Intronic
1119693604 14:76695521-76695543 GTCACCTGCCTGCGCTGGGCTGG + Intergenic
1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG + Intronic
1125762150 15:42104057-42104079 TTCCCACACCCACGATGGGCAGG - Intergenic
1126626097 15:50686898-50686920 GCCGCGCGCACGCGCTGGGCAGG + Intergenic
1130370622 15:83283495-83283517 GTCCCAAGGCCAGGCTGGGCGGG + Intronic
1132314559 15:100880242-100880264 GTCCAGCGCCCGCGCGGGGCCGG + Intronic
1132398140 15:101489260-101489282 TTCCCACGCGCGCGCGGGGCCGG + Intronic
1133198033 16:4184504-4184526 GGACCCCGCCCGCCCTGGGCGGG - Intergenic
1137707442 16:50545352-50545374 GTCCCAGGCGCCTGCTGGGCTGG + Intergenic
1141620851 16:85235884-85235906 GCCCCGCCCCCGCGCTGGCCGGG + Intergenic
1142376873 16:89711139-89711161 GCCCCCCGCCCCCGCTGGGGAGG + Intronic
1142694847 17:1628065-1628087 GTCCCAGGTCCGGGCAGGGCTGG - Exonic
1143099830 17:4498971-4498993 GGCGCACGCACGCGCTGAGCGGG + Exonic
1143105875 17:4530396-4530418 GTCCCATACCAGCACTGGGCCGG + Intronic
1146880592 17:36439848-36439870 ATCCCACGACCACCCTGGGCGGG - Intergenic
1148534801 17:48430234-48430256 GCCCCGCGGCCGGGCTGGGCGGG - Intronic
1148550716 17:48549430-48549452 GTCCCAGGCAGGGGCTGGGCAGG - Exonic
1150462802 17:65366584-65366606 TTCCCACGCCCACGCTTCGCTGG + Intergenic
1152196917 17:78923872-78923894 GTCCCACCTCCACTCTGGGCAGG + Intronic
1152855507 17:82663096-82663118 GGGCCATGCCCTCGCTGGGCTGG - Intronic
1163426974 19:17245425-17245447 TTCCCACGCGTGCGCGGGGCCGG + Exonic
1164462310 19:28459308-28459330 GTCCCAGGCCTGCTCTGGACAGG + Intergenic
1164732849 19:30519210-30519232 GCCCCACCCCAGAGCTGGGCTGG - Intronic
1165077762 19:33290322-33290344 GTCCCACACCCCCAGTGGGCGGG + Intergenic
1167040590 19:47020746-47020768 GCCTCACGCCCGCGCCGGGCCGG - Intronic
1167605522 19:50479842-50479864 GACCCACTCCATCGCTGGGCTGG + Intronic
1168145310 19:54416851-54416873 GACTCACGCCCGCTCTGGCCCGG + Intronic
1168327219 19:55544613-55544635 GTCCCTCGCCCTCTCTGGGGTGG + Intronic
925398967 2:3558295-3558317 GGCTCGCGCCCACGCTGGGCCGG - Exonic
925730727 2:6917948-6917970 GACCCGCGACCGCGCAGGGCAGG - Intronic
927052091 2:19339802-19339824 GTACCACCCCCGTGGTGGGCAGG - Intergenic
928093694 2:28391762-28391784 GTCCTCCTCCCTCGCTGGGCGGG - Intergenic
930782127 2:55233161-55233183 GGCCGCCGCCCGCTCTGGGCTGG + Intronic
939969684 2:148645031-148645053 GTCCAGCGCCCGCGCTCGGAAGG - Exonic
946401169 2:219469093-219469115 CTCCCACCCCAGGGCTGGGCTGG - Intronic
948115701 2:235493608-235493630 GTCCCACGGCCTCGCTTGGTTGG - Intergenic
948823156 2:240560513-240560535 GTCCCCCGCGGGCGCTGGGCCGG - Exonic
1172485947 20:35297981-35298003 GTCCAACGCGCTGGCTGGGCGGG + Intergenic
1173657425 20:44709975-44709997 GTCCCAAGCCGACGCTGGGGAGG - Intergenic
1175074016 20:56358866-56358888 GCCGCGCGCGCGCGCTGGGCGGG - Intergenic
1175428802 20:58888984-58889006 GGCCCACGCCCGCGCGGTCCCGG + Intronic
1176308224 21:5135478-5135500 GACCCACTCCTGGGCTGGGCTGG - Intronic
1176550669 21:8219447-8219469 GTCTCACGCCCGCGGGCGGCAGG - Intergenic
1176577511 21:8446717-8446739 GTCTCACGCCCGCGGGCGGCAGG - Intergenic
1177905398 21:26966808-26966830 CTCCCGCCCCCGCGCTGCGCTGG + Intergenic
1179848836 21:44126554-44126576 GACCCACTCCTGGGCTGGGCTGG + Intronic
1181639785 22:24190426-24190448 GTGCCACGCCAGGCCTGGGCCGG + Intergenic
1182309637 22:29395439-29395461 GTGCCAGGCCTGGGCTGGGCGGG - Intronic
1183069612 22:35387008-35387030 GGCCCTCGCCAGAGCTGGGCAGG - Exonic
1183220203 22:36507166-36507188 GCGCCTCTCCCGCGCTGGGCCGG - Intergenic
1185043558 22:48517826-48517848 CTCCCCCGCCCTCTCTGGGCAGG + Intronic
1185052892 22:48563000-48563022 CTCCCACACCAGAGCTGGGCTGG + Intronic
1203255570 22_KI270733v1_random:135790-135812 GTCTCACGCCCGCGGGCGGCAGG - Intergenic
950273985 3:11642919-11642941 GTCCCTCTCCCGCGTGGGGCCGG - Intronic
950940194 3:16884438-16884460 GCCCCCCGCCCGCCCGGGGCCGG + Intronic
952152394 3:30606985-30607007 GTCCCCAGCCCGGGCTCGGCGGG + Intronic
952885983 3:38011160-38011182 GTCGCAGGGCCGCACTGGGCTGG - Intronic
953748722 3:45594088-45594110 GTCCCGAGCCCGCGCCGGGGCGG - Intronic
961559719 3:127720254-127720276 GTCTCACCCCAGTGCTGGGCAGG - Intronic
965757436 3:172040371-172040393 GTCCCGAGCCCGCGCCGGCCTGG + Intronic
968612248 4:1562645-1562667 GGCCCACGCCAGCCCTGGGCTGG - Intergenic
968631648 4:1655107-1655129 CGTCCACGCCTGCGCTGGGCGGG - Exonic
969134440 4:5019266-5019288 GTCCCCCGCCCGCTCAGGACAGG - Intronic
971264910 4:25088767-25088789 GTTCCAAACCCGCGCGGGGCGGG + Intergenic
985549114 5:524328-524350 GTCCCAGCCCTGCGCTGAGCAGG - Exonic
985595047 5:784293-784315 GTTCCAGCCCCGGGCTGGGCAGG + Intergenic
986784397 5:11098925-11098947 ATCCCAAGCTCTCGCTGGGCAGG - Intronic
989584810 5:43066504-43066526 GGGCGACGCCGGCGCTGGGCGGG - Intronic
992080895 5:73233745-73233767 GGACCCCGCCCGCGCTGGGCCGG + Intergenic
996738184 5:126776639-126776661 TTACCACGCCCGCGGTGGCCGGG + Intronic
997253627 5:132410679-132410701 GACCCGGGCCCGGGCTGGGCGGG - Intronic
999462938 5:151772275-151772297 GTCCAACGGCCTCGCGGGGCAGG + Intronic
1001842311 5:174888651-174888673 GGCCCACTCCCTCCCTGGGCAGG + Intergenic
1003618124 6:7673387-7673409 GTCCCCAGCCCGGGCTGGGGCGG + Intergenic
1005851728 6:29827968-29827990 GTCCTGCGCCCCCGCCGGGCCGG - Intronic
1005859104 6:29887875-29887897 GTCCTGCGCCCCCGCCGGGCGGG - Intergenic
1005931695 6:30489646-30489668 GTCCTTCGCCCCCGCCGGGCCGG - Intronic
1006610388 6:35291136-35291158 ATCCCACCCCTGCCCTGGGCAGG - Intronic
1006913893 6:37582427-37582449 GCCCCTCCCCCGCCCTGGGCCGG + Intergenic
1013225940 6:108119471-108119493 CTGCCACGCCTGCGCTGGGGTGG - Intronic
1015244800 6:131063386-131063408 GTCCCCCGCCCGCGCAGGGGCGG - Intergenic
1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG + Intronic
1019281017 7:200261-200283 GTCCCAGGGCCTCGCTCGGCCGG + Intronic
1019351694 7:557042-557064 CTCCCACCCCCGGCCTGGGCCGG + Intronic
1019427663 7:985008-985030 GGCCCACGCCCAGGCTGTGCAGG - Exonic
1019892204 7:3955584-3955606 GTCCCACGCATGCCCTCGGCTGG - Intronic
1020100724 7:5393030-5393052 GTCCCTCCCCCGGGCAGGGCTGG + Intronic
1023043805 7:36194666-36194688 GTCCCAGGCCAGGCCTGGGCTGG + Intronic
1026858258 7:73769055-73769077 CCCCCATGCTCGCGCTGGGCAGG - Exonic
1028148490 7:87345497-87345519 GTCCCACTACCGCGCAGGCCCGG + Intergenic
1032125369 7:129189162-129189184 CTCCGGCCCCCGCGCTGGGCGGG - Exonic
1035022690 7:155808628-155808650 CTCCTCCGCCCGCGCTGGGCGGG + Intronic
1043372848 8:79613036-79613058 GTCTCGCGCCCGGGCTGGGTGGG - Intronic
1047693819 8:127383611-127383633 TTCCCTGGCCAGCGCTGGGCTGG + Intergenic
1056643252 9:88388545-88388567 GACCCACGCCCGCCCTGCGCGGG - Intronic
1057192831 9:93096808-93096830 GTCCCGCGACCTCGCTGGGGTGG - Intronic
1057752414 9:97803495-97803517 GCCCCGCCCCCGCGCTGGGCCGG - Intergenic
1059374766 9:113873491-113873513 GACCCACGCCCGGGCTGGGTAGG + Intergenic
1061994895 9:134178330-134178352 GCCCCACTCCTGCGCTGGCCAGG + Intergenic
1062394715 9:136348163-136348185 GTCCCACGGCAGAGCTGGTCTGG + Intronic
1062696190 9:137877602-137877624 CTCCCACCCCGGGGCTGGGCCGG - Intergenic
1203471968 Un_GL000220v1:118925-118947 GTCCCACGCCCGCGGGCGGCAGG - Intergenic
1186541751 X:10408420-10408442 CTCCCACGGCTGTGCTGGGCAGG + Intergenic
1188156364 X:26748135-26748157 GTCCCAGGACAGCGCTGGGAGGG + Intergenic
1190760510 X:53434254-53434276 GTTCCACGGCCGCGCTGTCCCGG + Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic