ID: 1121169390

View in Genome Browser
Species Human (GRCh38)
Location 14:91840833-91840855
Sequence CATTGTTACCTTAGTTTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121169390_1121169397 9 Left 1121169390 14:91840833-91840855 CCCACTAAACTAAGGTAACAATG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1121169397 14:91840865-91840887 GTGGTCACAGATGCTCCACCAGG 0: 1
1: 0
2: 1
3: 10
4: 150
1121169390_1121169396 -10 Left 1121169390 14:91840833-91840855 CCCACTAAACTAAGGTAACAATG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1121169396 14:91840846-91840868 GGTAACAATGGGATAATGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121169390 Original CRISPR CATTGTTACCTTAGTTTAGT GGG (reversed) Intronic
901569049 1:10144329-10144351 CATTGTTCCCTTATTTTTCTGGG - Intronic
907068889 1:51517027-51517049 CATTGTTATCTTAGTGTATTGGG + Intronic
919191303 1:194223392-194223414 CATTTTTAGCTTGATTTAGTCGG - Intergenic
919710778 1:200726055-200726077 CACTGTTTCCATAGTATAGTTGG + Intergenic
924703936 1:246482703-246482725 ACTTGTTACCTTAGTTTTATTGG - Intronic
1063739385 10:8800484-8800506 CATTGTTTCCTCAGTTTTGCTGG - Intergenic
1063980760 10:11449894-11449916 CATTGAGACCTAAGTTTTGTTGG + Intergenic
1064130396 10:12704353-12704375 CATTATTATCTTAGTTTTGTAGG + Intronic
1064202792 10:13299224-13299246 CATTGTTTCTTTAGCTTAATCGG + Intronic
1064785862 10:18893454-18893476 CATTTTTACATTAGATTACTTGG - Intergenic
1068928785 10:62567441-62567463 CATTATTATCTTAGTATATTTGG + Intronic
1069407945 10:68122327-68122349 CATTTTTACCTTACTTGAGGTGG - Exonic
1076620904 10:131786924-131786946 CACTGTTACCTTAGTCTCCTTGG - Intergenic
1077712047 11:4547127-4547149 AATTCTTACCTTAGTGTGGTTGG - Intergenic
1079351668 11:19697156-19697178 CATTCTTACGTTAGTTTGCTAGG - Intronic
1080392696 11:31863052-31863074 CATTGTTACTTTATTGTTGTTGG + Intronic
1080752167 11:35160748-35160770 AAATGTTAACTTGGTTTAGTGGG - Intronic
1081404151 11:42676915-42676937 CTCTGTGACCTTAGGTTAGTGGG - Intergenic
1081817894 11:45962547-45962569 CATTGTTATTTTAGTTTGCTGGG - Intronic
1083125118 11:60557430-60557452 CATTTTTAAATTAGATTAGTTGG - Intergenic
1088396546 11:109376167-109376189 CTTTGTTAGCTTGGTTGAGTTGG + Intergenic
1090856086 11:130610306-130610328 CTTTGTTACCTTTTTGTAGTCGG + Intergenic
1092674070 12:10897005-10897027 CATTGTGACCTCAGAGTAGTTGG - Intronic
1093628456 12:21380532-21380554 CATTATTTCCTTAGTTAGGTTGG + Intronic
1098641906 12:72849044-72849066 TATTGTTTCCTTAGTATAGATGG + Intergenic
1100366628 12:93927277-93927299 CATTGTTATATTAGTTTGCTAGG - Intergenic
1104109991 12:125695837-125695859 CATTGGTATCTTAGTCTACTTGG + Intergenic
1105540109 13:21308872-21308894 TATTGTTAATTTAGTTTTGTTGG + Intergenic
1106116076 13:26818840-26818862 CTTTTTTAACTTAGTTTATTTGG + Intergenic
1106788990 13:33135787-33135809 CTTTGTTATCTAAGTTAAGTGGG - Intronic
1108883697 13:55153808-55153830 TATTATTTCCTTAGTTTAGGAGG + Intergenic
1111791304 13:92858792-92858814 CATTTTTATCTTAGTTTCATGGG - Intronic
1112263230 13:97897694-97897716 CATTTTTACTTTAGATTATTTGG + Intergenic
1114836254 14:26205631-26205653 CATTGTTTACTAAGTTAAGTGGG - Intergenic
1114839981 14:26252076-26252098 CATTTTTACCTTAGAGTAGCTGG - Intergenic
1115633131 14:35265380-35265402 CATTTATAGCTTAGTTTAATAGG + Intronic
1117626299 14:57642811-57642833 CATTTTTTTCTTATTTTAGTTGG - Intronic
1120007262 14:79373198-79373220 AATTTTTACATTTGTTTAGTAGG - Intronic
1121169390 14:91840833-91840855 CATTGTTACCTTAGTTTAGTGGG - Intronic
1130623834 15:85492885-85492907 CTTTGATACCTTAGTTAAGGTGG + Intronic
1130623956 15:85494159-85494181 CTTTGATACCTTAGTTAAGGTGG - Intronic
1131622747 15:94084416-94084438 CATTTTTACCATAGTTTATGTGG - Intergenic
1131884280 15:96894144-96894166 CATTTTTATTTTAGTTTTGTAGG + Intergenic
1132105077 15:99057646-99057668 CATGCTTACCTTAGATTAGATGG - Intergenic
1138987952 16:62354169-62354191 CTTTGTTATCTAAGTATAGTTGG + Intergenic
1149923450 17:60679805-60679827 GATTGTTAAATCAGTTTAGTGGG + Intronic
1151071102 17:71212781-71212803 TCTTTTTACCTTTGTTTAGTGGG - Intergenic
1156691371 18:39711007-39711029 AATTGTTCAGTTAGTTTAGTTGG + Intergenic
1157120094 18:44901127-44901149 TATTGTTAATTTAGTTTTGTTGG + Intronic
1158371757 18:56814227-56814249 CATTGATCCCTTAATTTTGTAGG + Intronic
1158959749 18:62579681-62579703 AGTGGTTACCTTAGTGTAGTGGG - Intronic
1163068258 19:14815650-14815672 CATGTTTCCCTTAGTTTAGAAGG + Intronic
926937100 2:18096911-18096933 CATTGTTACCATAGCCTAATGGG - Intronic
927070096 2:19519317-19519339 CATTGCTGCCTTAGTTTTGGTGG - Intergenic
930704157 2:54487638-54487660 CAATGGTACTCTAGTTTAGTGGG - Intronic
932246263 2:70199193-70199215 CATCAGTACTTTAGTTTAGTGGG + Intronic
932478634 2:72024802-72024824 CATTGCTGCCATAGTTTGGTTGG - Intergenic
933582990 2:84148392-84148414 TACTGTTACCTTAATGTAGTGGG + Intergenic
935347012 2:102117804-102117826 AATAGTTACCTTAGTTTATTAGG + Intronic
937814247 2:126233639-126233661 AATGGTTCCCTAAGTTTAGTGGG - Intergenic
943954477 2:194170904-194170926 CTTTGTTTGTTTAGTTTAGTGGG + Intergenic
944078796 2:195760983-195761005 CACTGGTGCCTTAGTTTATTTGG - Intronic
945165660 2:206940937-206940959 CATTTTTCCATTAGTTTACTTGG + Intronic
945698094 2:213134343-213134365 TCTTTTTACTTTAGTTTAGTGGG - Intronic
946636472 2:221733759-221733781 CATTCTTATTTTAGTTTATTGGG - Intergenic
947790673 2:232866398-232866420 CATTGTTAAATTCGTTTCGTAGG + Intronic
1169934913 20:10873058-10873080 CATTGTTTCCTGATTTTTGTTGG + Intergenic
1171095419 20:22328142-22328164 TATTTTTACCTTATTATAGTGGG + Intergenic
1173639518 20:44590961-44590983 CATTTTTACATTAATTTAGCAGG + Intronic
1174271060 20:49368898-49368920 TATTGTTACTTGAGATTAGTTGG + Exonic
1174986195 20:55455611-55455633 CATTGTTTCTTTATTTTATTTGG + Intergenic
1177889687 21:26790513-26790535 CATTTTTATTTTATTTTAGTTGG - Intergenic
1182171623 22:28235834-28235856 TATTGTTAACTTCGTTAAGTTGG + Intronic
1183245062 22:36686984-36687006 CATTTTTGCCTTAGTTTCATTGG - Intronic
952668909 3:35942301-35942323 CATTGTTACCTTGGTTCTCTTGG + Intergenic
953443910 3:42946033-42946055 CATTGTTACCTTTCTGTAGATGG + Intronic
955025108 3:55160101-55160123 CATTGATACTCAAGTTTAGTTGG - Intergenic
956756174 3:72389444-72389466 AAAGTTTACCTTAGTTTAGTTGG - Intronic
966218841 3:177530658-177530680 CACTGTTACCTTCCTTCAGTAGG - Intergenic
967742331 3:193016994-193017016 CTTTCTTAGCTTAGTTCAGTAGG + Intergenic
973075975 4:45926231-45926253 CATTTTTACCTTTGCTTATTAGG - Intergenic
973649421 4:52983450-52983472 TGTATTTACCTTAGTTTAGTGGG + Intronic
974422863 4:61700549-61700571 CATTGGCACCTTAGCTCAGTTGG - Intronic
980522077 4:133948328-133948350 GATTTGTGCCTTAGTTTAGTTGG - Intergenic
981138920 4:141244921-141244943 AATTTTTATCTTAGTGTAGTAGG + Intergenic
982912200 4:161157460-161157482 AATTGTTACTTTAGTTTTTTAGG + Intergenic
983514490 4:168641870-168641892 GATTGTAAACTTAGTTTAGTAGG - Intronic
984988722 4:185356705-185356727 CATTGTTAGCTTTTCTTAGTGGG + Intronic
989154808 5:38334242-38334264 CTTTGTTATCTTAGTTTGTTTGG + Intronic
989358990 5:40577932-40577954 AAATGTTACCTTAGTTTACGAGG - Intergenic
990742575 5:58927164-58927186 CATTTTTGCTTTAGTTTTGTAGG - Intergenic
990781070 5:59364005-59364027 CATTGTTACCTTTGGTTGGATGG - Intronic
993032476 5:82721116-82721138 CATTGTTATCCTTGTTTTGTGGG + Intergenic
993738497 5:91507127-91507149 GTTTGTTGCCTTAGTTTAATAGG - Intergenic
994509037 5:100680112-100680134 CATTTTAACCTTATTTTTGTGGG + Intergenic
994899748 5:105756715-105756737 CATTGATCACTTGGTTTAGTTGG - Intergenic
996696006 5:126395933-126395955 CATAGTTACCTTTGATTTGTGGG + Intronic
996834059 5:127771732-127771754 CATTATTACATTACTTTAATTGG - Intergenic
1001076278 5:168630559-168630581 CATTGATACACTGGTTTAGTAGG + Intergenic
1001797993 5:174518262-174518284 CCTTGTTTCCTCACTTTAGTGGG - Intergenic
1008390422 6:50944664-50944686 CATTGTTACTTTAGGTTTGAGGG + Intergenic
1010808384 6:80266502-80266524 CATTGTGACCTTTTTTCAGTAGG + Intronic
1010942818 6:81939087-81939109 CATTATTGCCTAAGTTTTGTGGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018571449 6:165215331-165215353 TATTCTTTCCTTATTTTAGTGGG - Intergenic
1024686951 7:51756405-51756427 AATTGTTTCCTTGGTTTAGAGGG - Intergenic
1029911398 7:104152806-104152828 CATTGGTACTTTATTTTTGTGGG - Intronic
1035659953 8:1339664-1339686 CATTGTGACCTTCGTTTAATAGG + Intergenic
1037328050 8:17714657-17714679 CATTATTACCTCAGTTTTGCTGG + Intronic
1040360503 8:46659753-46659775 CATTGTTACCACAGCATAGTTGG - Intergenic
1043427430 8:80161632-80161654 CATTGTATCCTTAGTTTATTTGG - Intronic
1050019785 9:1270950-1270972 CCTTTTTACCTGAGTTAAGTAGG + Intergenic
1051067634 9:13123492-13123514 CATTGTTAATTTAGGGTAGTGGG + Intronic
1052562544 9:30105009-30105031 AATAATTACCTTAGTTCAGTGGG + Intergenic
1055664270 9:78537985-78538007 CATTGTCACCATTGTTTGGTTGG + Intergenic
1055852422 9:80648361-80648383 CATTGTAACCAGAGTTTTGTAGG + Intergenic
1056287878 9:85109628-85109650 CACTGTTTCCTTTATTTAGTTGG + Intergenic
1058016128 9:100034207-100034229 CATTGTCATCTTGGTTTTGTTGG - Intronic
1058427833 9:104890890-104890912 CATTGTTACTTCAGTTTACTAGG - Intronic
1060387789 9:123248625-123248647 CATTGTTACCCTATTTTTATAGG - Intronic
1187972526 X:24673436-24673458 GACTGTTACCTCAGTTTAGAGGG + Intergenic
1188505561 X:30879568-30879590 CATTCTGTCCTTAGTTTATTAGG - Intronic
1189768842 X:44401506-44401528 CATTGTTGTCTTAGTTCATTTGG - Intergenic
1192791756 X:74388813-74388835 CATTGAAACCTCAGTTTAGGGGG + Intergenic
1194134803 X:90128107-90128129 CATTGGTAACTTAGTATATTAGG - Intergenic
1196084381 X:111668732-111668754 CAATGGTCCCTCAGTTTAGTTGG - Intronic
1199623295 X:149717801-149717823 CATTGTCACCTTCCTTTTGTAGG - Intergenic
1200480588 Y:3698218-3698240 CATTGGTAACTTAGTATACTAGG - Intergenic
1202265836 Y:23018079-23018101 TATTGTTATCTTATTTTAGATGG + Intergenic
1202418829 Y:24651822-24651844 TATTGTTATCTTATTTTAGATGG + Intergenic
1202451957 Y:25018264-25018286 TATTGTTATCTTATTTTAGATGG - Intergenic