ID: 1121170957

View in Genome Browser
Species Human (GRCh38)
Location 14:91854279-91854301
Sequence TATTTCCTATAGAAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121170954_1121170957 -5 Left 1121170954 14:91854261-91854283 CCTGGGCTTGATTTTCCTTATTT 0: 1
1: 0
2: 5
3: 59
4: 745
Right 1121170957 14:91854279-91854301 TATTTCCTATAGAAACTGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 259
1121170953_1121170957 -4 Left 1121170953 14:91854260-91854282 CCCTGGGCTTGATTTTCCTTATT 0: 1
1: 0
2: 6
3: 58
4: 465
Right 1121170957 14:91854279-91854301 TATTTCCTATAGAAACTGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121170957 Original CRISPR TATTTCCTATAGAAACTGGA AGG Intronic
900809522 1:4791004-4791026 TCTTTCCTGGAGAAACAGGATGG + Exonic
901278152 1:8009296-8009318 TCCTTCCTATAGAAAGTGGGAGG + Intronic
906646025 1:47475700-47475722 TACCTTCTATAGAAGCTGGATGG - Intergenic
907802104 1:57779305-57779327 CATTTATTATAGAAACTGAAAGG + Intronic
909163546 1:72186093-72186115 TATTTCCTTTACAAATTTGAGGG - Intronic
909921444 1:81385887-81385909 TAATTCCTAAAGAAAATGAAAGG + Intronic
910423012 1:87089528-87089550 TAGCTCCTATAGAAACTAGCTGG + Intronic
910567999 1:88667099-88667121 TATTTCCTGAAGGAACTAGAAGG - Intergenic
911248661 1:95549446-95549468 TATGTACTACAGAAACTGGAAGG - Intergenic
913430692 1:118788046-118788068 TAATTCCTATAAAAACTATAAGG - Intergenic
913522200 1:119655319-119655341 TATTTCCCAAAGGAAGTGGAGGG + Intergenic
913840525 1:123414390-123414412 ATCTTCCTATAGAAACTAGACGG + Intergenic
919229748 1:194758652-194758674 TCTTTCTTATAGAACCTTGAAGG + Intergenic
919594450 1:199544896-199544918 TATTTCCTACAGAAATCAGATGG + Intergenic
919962657 1:202487278-202487300 TATTTTCTATAGGAACAGAAGGG + Intronic
921241868 1:213193164-213193186 TATTTTCTATAGCCATTGGAAGG + Intronic
924748395 1:246860312-246860334 TATTTCTCATAGCTACTGGAAGG + Intronic
1064635508 10:17362184-17362206 TATTTCCTTTTTAATCTGGATGG - Intronic
1066211430 10:33243037-33243059 TATTTCCTTCAAAGACTGGAGGG + Intronic
1066232120 10:33445974-33445996 AATTTCCTTTAGAAAATGGAAGG + Intergenic
1066762284 10:38766867-38766889 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1066808848 10:39297483-39297505 TATCTTCAATAAAAACTGGAAGG - Intergenic
1066959306 10:42205603-42205625 AATTTCCTTTGGAAGCTGGATGG + Intergenic
1068034568 10:51743342-51743364 TCTTTCCTGAAGAAACTGAAAGG - Intronic
1068996567 10:63212501-63212523 AATTTGCTATAGAAACTACATGG + Intronic
1070259163 10:74837421-74837443 TTTTTTCTATAAAAACTTGAAGG - Intronic
1071033546 10:81214565-81214587 TATTTCCTTGAGAATCTTGAAGG + Intergenic
1071871353 10:89798192-89798214 GATTTCCTTTTGAAATTGGAAGG - Intergenic
1074264173 10:111884592-111884614 CAATTCCTGTAGAAACTCGAAGG + Intergenic
1078379151 11:10824122-10824144 TATTTCATATAAAAGCCGGATGG + Intronic
1078693318 11:13603780-13603802 TATGCCCTAGAGATACTGGATGG - Intergenic
1079515181 11:21259078-21259100 TTGTTCCTATAGAAGCGGGAGGG + Intronic
1079985889 11:27200608-27200630 TATTCTCTAAAGAAATTGGATGG - Intergenic
1080372749 11:31671106-31671128 GATTTCCGATAGAAACTAAAGGG + Intronic
1081543659 11:44054241-44054263 TGTTTCTTATGGAAAATGGAAGG - Intronic
1081714210 11:45237065-45237087 TCTTTCCTATAGGAACTAGGAGG - Intergenic
1081896375 11:46590656-46590678 CATTTCCTTTAAAAACTGGACGG - Intronic
1082464395 11:53150607-53150629 TCTTCCCTATAAAAACTAGATGG + Intergenic
1082772644 11:57220244-57220266 TATTTATTATAGAGACTGGATGG + Intergenic
1083327705 11:61881562-61881584 TGTTTCCTTTAGCAACTGGGAGG - Intronic
1085511913 11:77092664-77092686 TATTTTCTACAGAGACTGGTGGG - Intronic
1086390124 11:86355189-86355211 TTTTTCCTAGAGAACTTGGAAGG + Intergenic
1086467222 11:87067353-87067375 CATTTCAAATAAAAACTGGATGG - Intronic
1087998593 11:104845240-104845262 TATTTGCTAAAGAAACTGGAAGG + Intergenic
1090696365 11:129247026-129247048 TATTTACTATAGAGCGTGGAAGG - Intronic
1095079340 12:37979302-37979324 TATTCCATATAAAAACTAGAAGG + Intergenic
1095150730 12:38793728-38793750 TAATTCATATAGAACCTCGAGGG + Intronic
1097906368 12:64923525-64923547 TATTTTCTATTGAAATTGGTTGG + Intergenic
1099412452 12:82348076-82348098 CATATCCTCTAGGAACTGGAAGG + Intronic
1100038688 12:90283911-90283933 TATTTTCTACAGAAATTGAATGG - Intergenic
1101359328 12:104011207-104011229 TAATTCCTAAAGAAACTGCAAGG - Intronic
1105084631 13:16174217-16174239 TACTTCCCATAAAAACTAGACGG + Intergenic
1105567895 13:21569459-21569481 TATTTCCTAAGGAAAATGGTAGG - Intronic
1106516000 13:30454496-30454518 TGTTATATATAGAAACTGGAAGG + Intergenic
1107219331 13:37962624-37962646 TAACTGCTACAGAAACTGGATGG - Intergenic
1107686641 13:42907208-42907230 TATTTCCTACACAAAATGCAAGG + Intronic
1107711201 13:43152159-43152181 TATTTCCTAAAGTTCCTGGAGGG - Intergenic
1108832232 13:54494523-54494545 TATTACCTATAGAAGATAGATGG + Intergenic
1109134514 13:58630112-58630134 TATTTACTAGGGAAACTTGAAGG - Intergenic
1110240714 13:73263465-73263487 TCTTGCCTCTAAAAACTGGAAGG + Intergenic
1111264862 13:85795740-85795762 TACTTCCTTTAAAAAATGGAGGG + Exonic
1113789406 13:113019640-113019662 TTTATCCTATAGCAACTGGTTGG - Intronic
1114214241 14:20643849-20643871 CAATTTCTATAGAAGCTGGAGGG - Intergenic
1115518955 14:34213697-34213719 AATTTCCTTCAGAAATTGGAAGG + Intronic
1116102530 14:40459569-40459591 TACTTCCTATAGGAAATTGATGG - Intergenic
1121170957 14:91854279-91854301 TATTTCCTATAGAAACTGGAAGG + Intronic
1121944057 14:98102400-98102422 TATTTCCTAGAGATTTTGGAGGG - Intergenic
1202933617 14_KI270725v1_random:63120-63142 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1126526126 15:49656648-49656670 TATTTGCTTGAGAAACTGGAAGG - Intergenic
1126893578 15:53233814-53233836 TATTTACTATAGGAAATGCAAGG + Intergenic
1127312017 15:57760781-57760803 TCTTTCCTACAGAAACAAGAAGG - Intronic
1127617523 15:60701714-60701736 TCTCTCCTATAGAAACAGCATGG - Intronic
1127720447 15:61694086-61694108 TGTTTGCTATAGAAACTAGGTGG + Intergenic
1128587694 15:68864822-68864844 TATTACTTAAAGACACTGGAAGG + Intronic
1128826188 15:70719632-70719654 TCTTGCCTATAGAAAATCGAGGG - Intronic
1135284788 16:21184136-21184158 TATTTTCTTTAGAAACTGAATGG + Intergenic
1135642562 16:24133748-24133770 TATATCATATAGAAATTGTAAGG + Intronic
1135826065 16:25730042-25730064 TATTTTATTTTGAAACTGGATGG + Intronic
1138790892 16:59902806-59902828 TTTTTCCTACAGGAACTAGAGGG - Intergenic
1139437623 16:66945525-66945547 TTTTTGCTATAGCAACTGAATGG - Intergenic
1143617626 17:8063272-8063294 CAATTCCTAAACAAACTGGAGGG - Intergenic
1150029092 17:61712542-61712564 TATTTCCTAGTGAAGCTGTAAGG - Intronic
1151302489 17:73237590-73237612 CATGTCCAGTAGAAACTGGATGG + Intronic
1152370818 17:79887541-79887563 TATTTGCTGGAGCAACTGGAAGG + Intergenic
1153811666 18:8757471-8757493 TATTTTCTATAAAAACTTTATGG - Intronic
1154097053 18:11427977-11427999 TACTATCTATAGAAACTGGAAGG + Intergenic
1154946750 18:21169489-21169511 AATATCCTATAGAAAGGGGAAGG - Intergenic
1155604988 18:27594906-27594928 CATTTGCTAGAGGAACTGGAGGG + Intergenic
1156049944 18:32920409-32920431 AATTTCCAATAGAAACTCTATGG + Intergenic
1158703300 18:59768858-59768880 GATTTCCTGTAGAAACAGAAAGG - Intergenic
1164519820 19:28970420-28970442 CATTTCTAATGGAAACTGGAGGG - Intergenic
1164817305 19:31214606-31214628 TATTTCCTAAAGAATCAGGCAGG + Intergenic
1166040080 19:40196964-40196986 TATTCCCTAAACATACTGGATGG - Intronic
929372052 2:41237188-41237210 TATTACTTATAGTAACTGGAAGG + Intergenic
929499772 2:42480474-42480496 TAGTTGCAATAGAAACTGTATGG - Intronic
930702145 2:54469295-54469317 AATTTCCTTTAGAAACTTGGGGG + Intronic
931644692 2:64411346-64411368 TGTTTCCTTGAGAAAATGGAAGG + Intergenic
932028152 2:68156640-68156662 TATCTCCTTAAGAAACTAGAGGG - Intronic
932898260 2:75666423-75666445 TATTTTATAAAGAAATTGGATGG + Intronic
933246441 2:79980059-79980081 TTTTCCCTTTAAAAACTGGAAGG - Intronic
934325596 2:92011482-92011504 AATTTCCTTTGGAAGCTGGATGG - Intergenic
935509455 2:103953048-103953070 TATTTCATAAAGAAAGTGGTAGG - Intergenic
935613071 2:105046293-105046315 TATTTCATAGAGAAAATAGAGGG + Intronic
936670944 2:114655220-114655242 TATTGACTTTTGAAACTGGAGGG + Intronic
938735573 2:134183557-134183579 TCTTGTCTATAGAAACTGAATGG + Intronic
939606893 2:144264606-144264628 TATTTCCCATAGCTTCTGGATGG - Intronic
941286442 2:163619285-163619307 TATTTCCTACAGAAAGTTGTTGG + Intronic
941361262 2:164554198-164554220 TATTTCCTATACATACTAAAAGG + Intronic
941628941 2:167862790-167862812 TATTTCTCCTAGAAACTGCATGG - Intergenic
942336064 2:174887470-174887492 TACCTCCTAGAGACACTGGAGGG - Intronic
942381632 2:175397835-175397857 TGTTTCATTTAGAAAATGGAAGG - Intergenic
944542834 2:200769810-200769832 TGTTTGCTAGAGAAACTGGAAGG + Intergenic
946684036 2:222249216-222249238 TATTTTTTGTAGAAACTGAAAGG - Intronic
946980431 2:225208048-225208070 TATTTCCTAGAAAAAATGAATGG + Intergenic
1169157177 20:3341503-3341525 TATTTCCTGCAAGAACTGGAAGG - Intronic
1169544166 20:6634089-6634111 TGTTTCCCATAAAAACTGTACGG + Intergenic
1170041996 20:12048860-12048882 TATTTCCTAGAGAAACTGATGGG + Intergenic
1173337774 20:42126748-42126770 TATTTCCCATACACAGTGGAGGG + Intronic
1176595017 21:8685276-8685298 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1177595200 21:23231188-23231210 TAGTTTCTATAGAGACTGTATGG - Intergenic
1177819833 21:26018882-26018904 TATTTCCTGTAGAAAGACGAAGG - Intronic
1180277870 22:10662434-10662456 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1180585103 22:16881267-16881289 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1183021639 22:35031954-35031976 TAGTTGCAATAGAGACTGGATGG + Intergenic
949244904 3:1915565-1915587 CATTCCCTTTAGAAACTGGCAGG - Intergenic
949491443 3:4593383-4593405 TATTTCCTCTTGAAAATAGAAGG - Intronic
949607786 3:5673421-5673443 TATGTCTGTTAGAAACTGGAAGG - Intergenic
951699615 3:25482113-25482135 TTTTTCCTACAGAACCTGGCTGG + Intronic
952166623 3:30756839-30756861 TCTTTCCTAATGAATCTGGATGG - Intronic
952421951 3:33140496-33140518 TATGTCCTTTGGAAAATGGAAGG - Intronic
953173295 3:40526606-40526628 GATGTACTCTAGAAACTGGAAGG + Intronic
953354662 3:42245500-42245522 GATTACCTATATAAACTGTAGGG + Intergenic
953658084 3:44870117-44870139 TGTTTCCCAAAGGAACTGGATGG - Intronic
954621949 3:52001530-52001552 CATTTCCAGCAGAAACTGGAAGG + Intergenic
957123738 3:76131354-76131376 TGTTTCCTTTAGAAACTTAACGG + Intronic
958008002 3:87837731-87837753 TATTTCCTATAGAAAATATGAGG - Intergenic
958316554 3:92246035-92246057 TACTTCGTATAAAAACTAGACGG + Intergenic
958506087 3:94978827-94978849 GATTTCCCATAGAAACTTGAAGG - Intergenic
959055994 3:101568226-101568248 TGTTGACTAGAGAAACTGGAAGG + Intergenic
959869703 3:111312422-111312444 TATTTAATATAAAATCTGGAGGG - Intronic
962196140 3:133365305-133365327 TATTTCCCATATAAGCTGGCAGG - Intronic
966262609 3:177997635-177997657 TATATTCTACAGAAACTGAAAGG - Intergenic
968397919 4:260755-260777 GATTACCTAGAGAAACAGGAGGG + Intergenic
969292282 4:6247757-6247779 TATTTCCTATGGTGACAGGAAGG - Intergenic
970448973 4:16148410-16148432 TAGTTCCTAGAGCGACTGGAAGG - Intergenic
970457769 4:16242358-16242380 TACTTCTTAAGGAAACTGGAGGG + Intergenic
971803403 4:31321866-31321888 TATATCTTTTAGAAACTGGGTGG - Intergenic
972734015 4:41822570-41822592 TTTTCCCTATAGAATGTGGAGGG + Intergenic
976307371 4:83573924-83573946 TAAATCCCATAGAGACTGGAAGG - Intronic
976570984 4:86610624-86610646 GATTTCATATAAAAATTGGAGGG - Intronic
976615486 4:87071698-87071720 AATTGCCTTTAGAAAATGGAGGG - Intronic
977473745 4:97476582-97476604 TATTTCCATTAAAATCTGGATGG - Intronic
981426955 4:144614397-144614419 AATTTCCTTTACAAGCTGGAAGG - Intergenic
985140621 4:186836886-186836908 TATTTGCTAAAGCAATTGGAAGG + Intergenic
986069287 5:4266315-4266337 AATTTCCTTCAGAACCTGGAGGG + Intergenic
987514342 5:18886487-18886509 TAATTCCCATAGTAACTGGTGGG - Intergenic
987627805 5:20425017-20425039 TATTTCCCTTAGAAACTGTCCGG + Intronic
988517156 5:31915049-31915071 TATTTCTTTTAGAAGCTGTAGGG + Intronic
990510425 5:56484397-56484419 GATGTCCTATAGCAACTTGAAGG - Intergenic
991172453 5:63644615-63644637 TATTGCTGATAGAAACTGCATGG - Intergenic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
993537478 5:89104634-89104656 CATTTGCTATAGAACCAGGAAGG + Intergenic
996329562 5:122313025-122313047 TATTTCCTGTGGAAACTGTATGG - Intronic
996682115 5:126238930-126238952 AATTTCCAATAGAAACAGGTGGG - Intergenic
996689836 5:126328579-126328601 TATATCATATGGAAACTTGAAGG - Intergenic
998864383 5:146481641-146481663 TATTCCCTATACAAACTTAAGGG - Intronic
1000877364 5:166657458-166657480 TATTTCTTAGAGTAACTGGAAGG + Intergenic
1001003178 5:168026949-168026971 TATTTCATGTAGAAATTGGGAGG - Intronic
1003213953 6:4091674-4091696 CAATTTCTATTGAAACTGGATGG - Intronic
1004965057 6:20839513-20839535 TAGTTACTATTGAAAATGGATGG + Intronic
1005560754 6:27038520-27038542 TGTTTCCTCTAGAAAATGGTGGG + Intergenic
1006339595 6:33439463-33439485 GATTAGCTTTAGAAACTGGAAGG + Intronic
1008514481 6:52306674-52306696 TTTTTCCTATAGAAATCGCAGGG - Intergenic
1009266156 6:61557309-61557331 TATTTACTAGAAAAATTGGATGG - Intergenic
1011067309 6:83341203-83341225 TATTTCATATCCATACTGGAAGG + Intronic
1011527575 6:88281956-88281978 GATTTCCTGGAGAAAGTGGAGGG - Intergenic
1011779250 6:90768534-90768556 TGTTTCCTAGGGAAACTGAAGGG + Intergenic
1012747188 6:103106478-103106500 TATATGGTATAGAAAGTGGAAGG - Intergenic
1012832921 6:104228510-104228532 TATTTCCTATAAGGAATGGAAGG - Intergenic
1013878429 6:114863603-114863625 CATTTCCTCTAAGAACTGGAAGG + Intergenic
1014291096 6:119559735-119559757 TCTTTCCCATAGAAAGTTGAAGG + Intergenic
1015093492 6:129387088-129387110 GATGTCCTATAGAAACTTTATGG + Intronic
1015472885 6:133626167-133626189 GATGTCCTATAGAAACTTTATGG - Intergenic
1016380636 6:143475001-143475023 GATTTCCTACTCAAACTGGAGGG + Intronic
1016648415 6:146435806-146435828 TATTTGCTACAGTAAGTGGAAGG - Exonic
1016785334 6:148005341-148005363 TATTTACTGTAGAAATCGGATGG + Intergenic
1018483330 6:164214131-164214153 TATTTCTTATAGAAAAGGAAGGG + Intergenic
1019208784 6:170387036-170387058 TATTTCCTACAGAAGCCTGAAGG - Intronic
1019487709 7:1296878-1296900 TATTTTCTCTAAAAACAGGATGG + Intergenic
1021110344 7:16687198-16687220 TATTAGTTATAGAAACTAGATGG + Intronic
1021329092 7:19312738-19312760 TTTTTCCAATAGATACTAGATGG - Intergenic
1023752686 7:43387006-43387028 TATTTCAAATAGAGTCTGGATGG + Intronic
1024214295 7:47233656-47233678 TAGTTCCTATAGAGACTGTATGG - Intergenic
1026103354 7:67400890-67400912 TATTTCTTATAGCAAGTGAATGG + Intergenic
1028674359 7:93442035-93442057 TATTTACTATGAAAACTGGAGGG + Intronic
1030429809 7:109430986-109431008 TATTTCCTATAAAATATGGAAGG - Intergenic
1031101371 7:117484418-117484440 TACATCCTATAGGAATTGGAGGG + Intronic
1031147706 7:118015368-118015390 CATTTCCTGTAGAGACTGGCAGG + Intergenic
1031228752 7:119076576-119076598 TATTTTCTATAGAAAGTAGAGGG + Intergenic
1032888800 7:136170808-136170830 TTTTTCCTACAGCAACTGGTAGG - Intergenic
1032891910 7:136205834-136205856 TATTTGTCATAGAAACTGTAAGG + Intergenic
1032916851 7:136500402-136500424 TAAAGCCTATTGAAACTGGAAGG + Intergenic
1032942774 7:136814213-136814235 AATTTTCTAAAGAAACTTGATGG + Intergenic
1033192373 7:139293359-139293381 TATCTCCAAGGGAAACTGGAAGG - Exonic
1033717702 7:144019890-144019912 TATGTCCTATAAGAACTGCAGGG + Intergenic
1035579922 8:732996-733018 TTTTTCGTTTGGAAACTGGAAGG + Intronic
1039205656 8:35151212-35151234 TGTTTACTATACATACTGGAAGG + Intergenic
1039437545 8:37570414-37570436 CATTTCCTATCAAAATTGGACGG + Intergenic
1040346072 8:46496676-46496698 TATTTGCAATAAAAACTAGAAGG - Intergenic
1040623875 8:49122405-49122427 TATTTACTAGAAAAACTGTATGG - Intergenic
1040891459 8:52321271-52321293 TATTTCCTTAAGAAATTGAATGG - Intronic
1040980423 8:53241351-53241373 TATTTACTATTGAAATTGTAGGG + Intronic
1041563937 8:59253774-59253796 TATTAGCTATAGAATCTGTACGG + Intergenic
1042396893 8:68302696-68302718 TATTTACTAAAGAAATTTGAGGG - Intergenic
1044119886 8:88381997-88382019 CATTTCCTATGGAATGTGGATGG + Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044927604 8:97222818-97222840 TCTTTACTATAGGACCTGGAGGG + Intergenic
1046371043 8:113306911-113306933 TATTTATTATACAAACTTGATGG - Intronic
1050062136 9:1720469-1720491 TATTTCTTATCCAAACTAGAAGG + Intergenic
1050605437 9:7296523-7296545 TATTTCTAATAGAAACAGAAAGG - Intergenic
1051846260 9:21454787-21454809 GATTTCCTATGCAAAATGGAGGG + Intergenic
1052133544 9:24881778-24881800 TATATCCTAAAGAAACTGCAGGG - Intergenic
1052196486 9:25722147-25722169 TATTTTAAATAGAAACTGAATGG - Intergenic
1052938274 9:34111734-34111756 TATTCCCTAAAGAATCTGAATGG - Intronic
1053694042 9:40618910-40618932 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1053941033 9:43249329-43249351 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054270793 9:63021217-63021239 AATTTCCTTTGGAAGCTGGATGG + Intergenic
1054305287 9:63418134-63418156 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054404034 9:64742123-64742145 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054437655 9:65227623-65227645 AATTTCCTTTGGAAGCTGGATGG - Intergenic
1054492748 9:65794344-65794366 AATTTCCTTTGGAAGCTGGATGG + Intergenic
1055075390 9:72209809-72209831 TATTTTCTAGAGAAAATGAATGG - Intronic
1055703749 9:78975085-78975107 TATTTAATATTGAATCTGGAAGG + Intergenic
1056237239 9:84607185-84607207 CATTTTCTATAGAAACTGTGTGG - Intergenic
1059003790 9:110379303-110379325 TATTTCTTAGTGAAACTGCAGGG - Intronic
1060570698 9:124636964-124636986 ACTTTCCTCTAGAATCTGGAGGG + Intronic
1061530415 9:131207627-131207649 TATCTCCTCTTGAACCTGGATGG - Intronic
1186227956 X:7421541-7421563 TATTTTCTATGGCACCTGGAAGG - Intergenic
1186368044 X:8916005-8916027 GATTTCTTTTAGAAACTTGATGG - Intergenic
1186400942 X:9258947-9258969 TTTTTCCTATTGAAACTGAAAGG + Intergenic
1186439359 X:9572207-9572229 TCTTTCCTTTAAAAACTGAAAGG - Intronic
1186540634 X:10396487-10396509 TATTTCCTTCAGAAATTTGAAGG + Intergenic
1187710636 X:22050086-22050108 TAGTTGCAATGGAAACTGGATGG + Intronic
1190454376 X:50612368-50612390 TTTTTCCTATGGTAACTGGTGGG - Intronic
1191300012 X:58919266-58919288 AACTTCCTATAAAAACTAGACGG + Intergenic
1191304563 X:58979776-58979798 AACTTCCTATAAAAACTAGACGG + Intergenic
1191332487 X:59353423-59353445 AACTTCCTATAAAAACTAGACGG + Intergenic
1191338043 X:59427481-59427503 AACTTCCTATAAAAACTAGACGG + Intergenic
1191346552 X:59541009-59541031 AACTTCCTATAAAAACTAGACGG + Intergenic
1191375687 X:59930300-59930322 AACTTCATATAAAAACTGGACGG + Intergenic
1191392141 X:60150245-60150267 AACTTCCTATAAAAACTAGACGG + Intergenic
1191404890 X:60321124-60321146 AACTTCCTATAAAAACTAGACGG + Intergenic
1191413801 X:60440927-60440949 AACTTCCTATAAAAACTAGACGG + Intergenic
1191447359 X:60889773-60889795 AACTTCCTATAAAAACTAGACGG + Intergenic
1191451330 X:60943099-60943121 AACTTCCTATAAAAACTAGACGG + Intergenic
1191454318 X:60983040-60983062 AACTTCCTATAAAAACTAGACGG + Intergenic
1191455540 X:60999325-60999347 AACTTCCTATAAAAACTAGACGG + Intergenic
1191459829 X:61056929-61056951 AACTTCCTATAAAAACTAGACGG + Intergenic
1191461362 X:61077504-61077526 AACTTCCTATAAAAACTAGACGG + Intergenic
1191472023 X:61220113-61220135 AACTTCCTATAAAAACTAGACGG + Intergenic
1191478740 X:61310284-61310306 AACTTCCTATAAAAACTAGACGG + Intergenic
1191493862 X:61512612-61512634 AACTTCCTATAAAAACTAGACGG + Intergenic
1191511597 X:61749644-61749666 AACTTCCTATAAAAACTAGACGG + Intergenic
1191516300 X:61812740-61812762 AACTTCATATAAAAACTGGACGG + Intergenic
1191517537 X:61829201-61829223 AACTTCCTATAAAAACTAGACGG + Intergenic
1191517688 X:61831258-61831280 AACTTCCTATAAAAACTAGACGG + Intergenic
1191523346 X:61906856-61906878 AACTTCCTATAAAAACTAGACGG + Intergenic
1191558884 X:62382168-62382190 AACTTCCTATAAAAACTAGACGG + Intergenic
1191561808 X:62471258-62471280 AACTTCATATAAAAACTGGACGG - Intergenic
1191562129 X:62475370-62475392 AACTTCATATAAAAACTGGACGG - Intergenic
1191563666 X:62495938-62495960 AACTTCCTATAAAAACTAGACGG - Intergenic
1193018902 X:76768778-76768800 TATTTCTTATAGAAACAAGGAGG + Intergenic
1193681022 X:84518899-84518921 TATTTGCTTTCGCAACTGGAAGG - Intergenic
1193813575 X:86080827-86080849 TTTTTCCTATAGTAATTGAAAGG + Intergenic
1195792162 X:108599783-108599805 TAGTTGCTACAGAGACTGGATGG + Intronic
1196157514 X:112447269-112447291 TATTTTCTAGAGCCACTGGAAGG - Intergenic
1196933785 X:120708554-120708576 TATTTGTTGAAGAAACTGGATGG + Intergenic
1197417924 X:126198089-126198111 TATTTCCTGAAGAAAAAGGAAGG - Intergenic
1198632843 X:138660785-138660807 TATTTGCCATAGAAAATAGAGGG - Intronic
1200332204 X:155310029-155310051 TATTTCCTAGATACAATGGAGGG + Intronic
1201191813 Y:11450463-11450485 AATTTCCTTTGGAAGCTGGATGG - Intergenic