ID: 1121171097

View in Genome Browser
Species Human (GRCh38)
Location 14:91855084-91855106
Sequence ATGAAGAAACAAGTTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 1, 2: 4, 3: 47, 4: 572}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121171097 Original CRISPR ATGAAGAAACAAGTTGAGCA GGG Intronic
900985325 1:6069804-6069826 ACAGGGAAACAAGTTGAGCAGGG + Intronic
901907287 1:12424587-12424609 ATGAAGGAGCCAGGTGAGCAGGG + Intronic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
902877157 1:19347608-19347630 CTGGACAAACAAGTTGACCAAGG - Intronic
903610728 1:24610082-24610104 ATCAGGAAACAGGTTCAGCAAGG + Intergenic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
904982165 1:34514969-34514991 ACTAATAAACAAGTTTAGCAAGG + Intergenic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
906276571 1:44521049-44521071 ATAAAAAAACTAGTTGGGCATGG - Intronic
906619492 1:47263906-47263928 ATACAGAAACTAGCTGAGCATGG - Intronic
906749995 1:48250173-48250195 ATGAAGTCCCAAGTTTAGCATGG - Intergenic
906773062 1:48502426-48502448 ATGAGGAACCTAGTTGAGAAAGG + Intergenic
907458421 1:54590908-54590930 ATAAATAAATAAGCTGAGCATGG - Intronic
907534177 1:55134078-55134100 CTAAAGAATCAAGTTGATCAAGG + Exonic
907563310 1:55411100-55411122 AAGAAGCAACATTTTGAGCATGG - Intergenic
907774192 1:57497208-57497230 ATAAAGAAAATAGTAGAGCAAGG - Intronic
909245396 1:73274981-73275003 ATGAAGAAATAAGTTAATCATGG - Intergenic
910881046 1:91922648-91922670 ATGAAAAAATTAGCTGAGCATGG - Intergenic
911533470 1:99073573-99073595 ATGCAGAAACGAGTAGAGCCTGG + Intergenic
913257716 1:116969953-116969975 ATTAATAAACAAGTTCAGCAAGG - Intronic
913395883 1:118371638-118371660 ACTAAGAAATAAGTTCAGCAAGG - Intergenic
914924284 1:151871032-151871054 AGAAGGAAACAGGTTGAGCAAGG + Intergenic
914937844 1:151995392-151995414 ATGAAGAAATCAGATGAGTAGGG - Intergenic
915703308 1:157818892-157818914 ATGAAGAAACATATTGATGATGG + Intronic
916168073 1:161981037-161981059 ATGAAGATTCAAGTAAAGCAAGG - Intergenic
917218574 1:172703506-172703528 ATGAAGAATAAAGTGGAGGATGG + Intergenic
917289559 1:173458544-173458566 ATCAACAAACAAGTAGAGAAAGG + Intergenic
917350878 1:174076420-174076442 ATGCAGAAATTAGTTGGGCATGG + Intergenic
917617296 1:176759039-176759061 ATGAAGAAAGTAGTAGACCAAGG - Intronic
917791617 1:178502807-178502829 ATGAGGAAACAAGTTCAGAGAGG + Intergenic
917954265 1:180076631-180076653 ATAAAAAAATTAGTTGAGCATGG + Intronic
918039314 1:180902815-180902837 ATTAAGAACTAAATTGAGCAGGG - Intergenic
919094076 1:193009144-193009166 ATGCAGTAACAATTTGATCAAGG + Intergenic
920409290 1:205746524-205746546 ATGAAGACACAAGTTTAATATGG - Intronic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
920751851 1:208685813-208685835 ACCAAGAAACAAGCTGAGCTTGG + Intergenic
921412444 1:214850186-214850208 ATGAAGAAAGAAGGTGATGAAGG + Intergenic
922575351 1:226657708-226657730 ATGATGAAACATGTTGAGAGGGG + Intronic
922892987 1:229075876-229075898 ATGAATAAATAAGTAGACCAAGG - Intergenic
923720069 1:236459249-236459271 ATGCAAATACAAGTAGAGCACGG - Intronic
923872122 1:238006788-238006810 ATGAAGAGAGAAGCTGGGCACGG - Intergenic
1063732321 10:8711770-8711792 ATGAAAAAACGAGTGCAGCAAGG - Intergenic
1064031978 10:11888337-11888359 ATGAAGAAATTAGTTGGGCAGGG + Intergenic
1065277696 10:24102172-24102194 ATGAAGAAGCAATTATAGCAAGG + Intronic
1065577020 10:27131198-27131220 ATGGAGGAAAAAGTAGAGCAGGG - Intronic
1065792033 10:29269221-29269243 TTGAAAATACAATTTGAGCAAGG - Intergenic
1066548332 10:36526206-36526228 AAGAAAAGAGAAGTTGAGCAGGG + Intergenic
1067730620 10:48808596-48808618 ATGCATATACAGGTTGAGCAAGG - Intronic
1068061739 10:52076399-52076421 ATGCAGAAATTAGTTGGGCATGG + Intronic
1068953490 10:62801790-62801812 ATTAAAAAATTAGTTGAGCATGG - Intergenic
1069187593 10:65444900-65444922 ATGAAGACACAAGGTGAAGATGG + Intergenic
1071144361 10:82550317-82550339 ATGAGAAAACATGTTCAGCAAGG + Intronic
1071355910 10:84794878-84794900 ATTAAGAAACACATTCAGCAAGG - Intergenic
1072880421 10:99221612-99221634 AAGGAGAAAAAACTTGAGCAGGG + Intronic
1072945550 10:99807004-99807026 ATAAGGAAACAAGTTGAGAGAGG - Intronic
1074392336 10:113068766-113068788 ATGAAGGTACAAGTACAGCAAGG - Intronic
1074748405 10:116558778-116558800 ATGCAAAAATTAGTTGAGCATGG - Intronic
1074950065 10:118325100-118325122 GGGAAAAAACAAGTTGAGAAAGG - Intronic
1075581549 10:123622580-123622602 ATGCAGAAACAATTTAAGTAAGG - Intergenic
1076914137 10:133412398-133412420 ATGAATAAATGAGTTTAGCAGGG - Intronic
1077377890 11:2214064-2214086 AGGAACAAACAGGTGGAGCATGG - Intergenic
1077971061 11:7190767-7190789 GCTAATAAACAAGTTGAGCAAGG + Intergenic
1078093317 11:8281208-8281230 ATGAAGAGACAAGTAGAGATGGG + Intergenic
1078204808 11:9219312-9219334 AGGAAGAAACAAATTTACCAAGG + Intronic
1078207867 11:9245922-9245944 ATGAAGAGATAGGTTGGGCATGG - Intronic
1078635896 11:13049794-13049816 ATGAATAAATAAGTGGAGAAGGG - Intergenic
1078644051 11:13122218-13122240 ACTAATAAACAAGTTCAGCAAGG - Intergenic
1078877074 11:15409658-15409680 ATGAAGAAAAATGTTGTCCATGG + Intergenic
1079071992 11:17355239-17355261 ATGAAAAAATTAGCTGAGCATGG + Intronic
1079314028 11:19392348-19392370 AGGAATATACAATTTGAGCAGGG + Intronic
1080124372 11:28714374-28714396 ATGTAGAATCTAATTGAGCATGG + Intergenic
1081903087 11:46646617-46646639 ATAAAGAAACTAGCTGGGCATGG - Intronic
1081913171 11:46713739-46713761 ATAAAAAAATAAGTTGGGCATGG + Intergenic
1082945821 11:58758061-58758083 ATGAAGTAAGAAGAAGAGCAAGG + Intergenic
1084141938 11:67237789-67237811 ATTAAGAAATTAGCTGAGCATGG + Intronic
1084425161 11:69080429-69080451 ATGAAGAGACAACCTGGGCAGGG + Intronic
1084912354 11:72401037-72401059 ATGAAGAAACAGGCTGTCCATGG + Intronic
1085193019 11:74645571-74645593 ATGAGGAAACAAGTTCAGAGAGG - Intronic
1085262914 11:75218558-75218580 AGGAAGATACAAGATGAGCCTGG - Intergenic
1085279681 11:75321656-75321678 ATGAAGAAACAAGTTGAGTGAGG - Intronic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1086534269 11:87825244-87825266 ATGAAGGAACAAATTAAGAAAGG + Intergenic
1086537886 11:87870546-87870568 ATAAAGAAACAAATTTAGTATGG - Intergenic
1086572675 11:88303533-88303555 ATGAAGAAATGAGTAGGGCAAGG + Intronic
1087068481 11:94050202-94050224 ACTAACAAACAAGTTTAGCAAGG - Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087371150 11:97286287-97286309 ATAAAACAACAAGTTGAGTAGGG + Intergenic
1089085880 11:115816261-115816283 ATGAAGAAACCAGTCCAGCTGGG - Intergenic
1089918627 11:122185133-122185155 ATGTAGAGACTAGATGAGCAGGG - Intergenic
1090309227 11:125720115-125720137 TTTAAGAAACAAGATGACCAGGG - Intergenic
1090376016 11:126290173-126290195 ATGGAGAAACGAGTTTAGCAAGG + Intronic
1090520372 11:127473004-127473026 AGCAAGAAACTAGTTGAGGATGG - Intergenic
1090813919 11:130273691-130273713 ACTAATAAACAAGTTGAGCAAGG - Intronic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091081704 11:132675571-132675593 ATGAATAAAGAAATTTAGCAAGG + Intronic
1091537388 12:1424646-1424668 ATGAAGAAACAAGAGGAAAAGGG - Intronic
1092170678 12:6372181-6372203 AAGAGGAAATAATTTGAGCAAGG - Intronic
1092801722 12:12175096-12175118 ATGAAAAAACAGGTCGGGCATGG + Intronic
1093396300 12:18686982-18687004 ATGAAGATTCAAGTAGAGGATGG + Intronic
1094600400 12:31903964-31903986 AAGAAGAAACAAGCTGGGTATGG - Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095900724 12:47325398-47325420 ATGAAGAAAAATGTTCAGAAAGG + Intergenic
1096939973 12:55332716-55332738 ATAAAGAAACTAGGAGAGCAAGG - Intergenic
1097018131 12:56001635-56001657 ATGAGGAAGCAAGTTCAGAACGG + Exonic
1098413496 12:70206587-70206609 ATGAAAAAATTAGTTGGGCATGG + Intergenic
1099068809 12:78019152-78019174 ATGAACAAACAAGTTCAGAGAGG + Intronic
1099335447 12:81350946-81350968 TTGAAAAAACAAGTTAAGAATGG + Intronic
1099363395 12:81736406-81736428 ATGAATAAACCAATTCAGCAAGG - Intronic
1099939417 12:89167509-89167531 TTTAAGAAACAAGTTAAGAAAGG + Intergenic
1100198848 12:92277350-92277372 ATTAAAAAACTAGCTGAGCATGG + Intergenic
1100578006 12:95910706-95910728 ATTAAAAAATTAGTTGAGCATGG + Intronic
1100626360 12:96337290-96337312 AAGAAGATAAAAGCTGAGCAAGG - Intronic
1100882492 12:99034469-99034491 ATGCAAAAACTAGCTGAGCATGG - Intronic
1102041463 12:109803607-109803629 ATTAAAAAATTAGTTGAGCATGG - Intronic
1102198867 12:111043791-111043813 AGGAAGAAAGAAGTAGAGCTAGG + Intronic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1102747807 12:115265319-115265341 TTGCAGAAAGAAGATGAGCATGG + Intergenic
1103304700 12:119954852-119954874 ATAAAAAAATTAGTTGAGCATGG + Intergenic
1103431937 12:120895135-120895157 ATGAAAAAACAGGTCGGGCATGG + Intronic
1103817728 12:123671892-123671914 AGGAAGAAACAAGTTCAGAGAGG + Intronic
1105063979 12:133180963-133180985 ATAAAGATACAAGTCGAACAAGG - Intronic
1105960351 13:25329281-25329303 TTGATAAAACAAGTTCAGCAGGG - Intronic
1106534122 13:30623896-30623918 ATGAAGAAATGAGTAGGGCAAGG - Intronic
1107031491 13:35858417-35858439 ATGAAGAAACATGTTTAGTCAGG + Intronic
1107053721 13:36080188-36080210 ATGAAGAAGGAAGGTGAGAAAGG + Intronic
1107516920 13:41138302-41138324 ATGAAGAGACATGCAGAGCAAGG - Intergenic
1107537249 13:41347705-41347727 ACGAATAAACAAGTTCAGCAAGG - Intronic
1107647417 13:42509359-42509381 ATGATGAAACAGGTTGTTCAAGG - Intergenic
1107695969 13:43000308-43000330 CTGAAAAAACAAAGTGAGCAGGG + Intergenic
1108200202 13:48035729-48035751 TAGAAGAAATAAGTTTAGCAAGG - Intergenic
1108296916 13:49030641-49030663 ACTAATAAACAAGTTCAGCAAGG + Intronic
1108645027 13:52418960-52418982 AAGATGAAATAACTTGAGCAAGG - Intronic
1109233727 13:59790439-59790461 ATGAACAAAGAACTTGAGCCTGG - Intronic
1109402458 13:61853088-61853110 ATGAAGACACAAGATGAAAATGG + Intergenic
1109471216 13:62806828-62806850 AGGCTGAAACAATTTGAGCAAGG + Intergenic
1109667847 13:65562635-65562657 ATTAAGACACAAGATGAGAATGG + Intergenic
1109762688 13:66850361-66850383 ATGCAGAAACTAGCTGGGCATGG + Intronic
1109838190 13:67886456-67886478 CTGATGAAACAAGATGAGCCGGG - Intergenic
1110402286 13:75106805-75106827 ATGAACAAATGAGTTCAGCAAGG + Intergenic
1111130533 13:83969363-83969385 ATACAAAAACTAGTTGAGCATGG - Intergenic
1111209482 13:85058448-85058470 ATGTAAAAACAAGCTGTGCACGG - Intergenic
1113322226 13:109245223-109245245 ATGAAGAAAGAAAATGAGAAGGG - Intergenic
1113349957 13:109519453-109519475 GGGAAGAAACAATTGGAGCAGGG + Intergenic
1113471548 13:110550261-110550283 ATGAAGAGACACATGGAGCAAGG - Intronic
1114188151 14:20419298-20419320 ATGAAGAAAGAGGTCGGGCATGG - Intergenic
1114803212 14:25802889-25802911 ATGTAAAAACAAGTTTAGCTGGG + Intergenic
1114845996 14:26322688-26322710 ATGGAGAAACGACTTGACCAAGG - Intergenic
1115946475 14:38666918-38666940 ATAAAGAAATAAGTTGATTAGGG - Intergenic
1116059596 14:39905130-39905152 TTGAAGAAACAAGCTGAAAATGG - Intergenic
1116064950 14:39970811-39970833 CAGAAGAAACAATTTGACCAAGG - Intergenic
1116088166 14:40268006-40268028 ATGAGGCAAGAAGTTGAGGATGG - Intergenic
1117105378 14:52393023-52393045 ATTAAGAAACCAGCTGGGCATGG - Intergenic
1117331189 14:54713424-54713446 ATGAGGAAGCCAGGTGAGCAGGG + Intronic
1117392835 14:55278975-55278997 ATAAAGAAACAGGGTGGGCATGG - Intronic
1117598659 14:57350790-57350812 ATGAAAAAGTAAGTTGGGCATGG + Intergenic
1117860357 14:60085218-60085240 ATACAGAAACAAGTTGCCCAGGG + Intergenic
1118815980 14:69314296-69314318 AAGAAGAAACATGTTCAGAAAGG + Intronic
1119116029 14:72022435-72022457 AGGGAGAAAAAAGTAGAGCAAGG + Intronic
1119822511 14:77629995-77630017 CAGAAGAAAGAATTTGAGCAAGG + Intergenic
1120244600 14:81992223-81992245 ATTAAGAAATAAGCTGGGCATGG + Intergenic
1120474339 14:84968712-84968734 ATGAAAAAGCAATTTGACCAAGG - Intergenic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121656503 14:95600381-95600403 ATCTAGAAATAAGTTGAGGATGG + Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122253333 14:100456910-100456932 ATGAAGAAAAAAGTTCACCAAGG + Intronic
1124711146 15:32013255-32013277 ATGAAGAGACAAGTGGATAAAGG - Intergenic
1125049941 15:35284963-35284985 ATGAAAAAATTAGCTGAGCATGG - Intronic
1125060451 15:35415195-35415217 ATGAATATACAAGGTCAGCATGG + Intronic
1125307488 15:38336212-38336234 AAAAAGAAACAACTTGAACATGG - Intronic
1125400147 15:39293626-39293648 ATGAAAAAATTAGTTGGGCATGG - Intergenic
1125553309 15:40564325-40564347 ATGAAAAAACAAGTTCAGAAGGG + Intronic
1125785999 15:42318742-42318764 ATGAAAAAATTAGTTGGGCATGG - Intronic
1125857815 15:42967206-42967228 AAAAAAAAACTAGTTGAGCATGG - Intronic
1125914017 15:43468389-43468411 ATTAAGAAATTAGTTGGGCATGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126992091 15:54389882-54389904 ATGCAGAAACTAGCTGGGCATGG - Intronic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1128307303 15:66607801-66607823 ATTAAAAAATAAGCTGAGCATGG - Intronic
1128436085 15:67650183-67650205 ATTAGTAAACAAGTTCAGCAAGG - Intronic
1128485729 15:68085648-68085670 ATGAGGAGACAAGTTCAGAAAGG - Intronic
1129083564 15:73064618-73064640 ATTAAGAAACTAGCTGGGCATGG - Intronic
1129127366 15:73454282-73454304 ATGAAGAAACATGATGACTAAGG + Intronic
1129639444 15:77359585-77359607 ATTAACAAATAAGTTCAGCAAGG + Intronic
1129965493 15:79731505-79731527 TTGAAAAAACAAGTTAAGCCAGG + Intergenic
1130053649 15:80504610-80504632 ATAAAAAAACAAGCTGGGCATGG + Intronic
1132311726 15:100862330-100862352 CTGAAGAACCAAGGTGAGCTGGG + Intergenic
1132957044 16:2599799-2599821 ATAGGGAAACAAGTGGAGCAGGG + Exonic
1132969391 16:2678218-2678240 ATAGGGAAACAAGTGGAGCAGGG + Intergenic
1133423486 16:5666953-5666975 ATGAAGAAAAAAATAGGGCAAGG + Intergenic
1134071332 16:11261732-11261754 ATGAAAAAATTAGTTGGGCATGG + Intronic
1134411806 16:14009374-14009396 ATGACTAAACAAGTTTAGTATGG - Intergenic
1134505348 16:14801394-14801416 AAGAAGAAACAAGATGCTCAAGG - Intronic
1134575230 16:15327516-15327538 AAGAAGAAACAAGATGCTCAAGG + Intergenic
1134727216 16:16428976-16428998 AAGAAGAAACAAGATGCTCAAGG - Intergenic
1134940221 16:18282879-18282901 AAGAAGAAACAAGATGCTCAAGG + Intergenic
1134970763 16:18528810-18528832 AAGAAAAAAAAAGCTGAGCATGG + Intronic
1135764730 16:25167600-25167622 ATTAGGCAACAAGCTGAGCATGG - Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136421546 16:30137079-30137101 ATAAATAAATAAGCTGAGCATGG + Intergenic
1137797229 16:51232234-51232256 ATGAAAAAATCAGCTGAGCATGG - Intergenic
1138005739 16:53335377-53335399 ATGAATAAACAAGCTTAGCAAGG + Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138847429 16:60583579-60583601 ATGAAGAATCAAGATGATGAAGG + Intergenic
1138909520 16:61379535-61379557 AGGAAAAAACAAGTTGAAAAGGG + Intergenic
1139826137 16:69758706-69758728 ATGAAAAAACTAGCTGGGCATGG - Intergenic
1140324640 16:73990049-73990071 ATTAATAAACAAGTTCAACAAGG + Intergenic
1140460992 16:75139534-75139556 ATAAACAAATAAGTTGGGCATGG + Intergenic
1141968951 16:87466913-87466935 GTAAAGAAACAAGGTGAGGAGGG - Intronic
1141990526 16:87606597-87606619 ATGAAGAAACAAGCTCAGAGAGG - Intronic
1142912261 17:3104373-3104395 ATGAAGAAACGGGATGAACAGGG + Intergenic
1143001183 17:3796259-3796281 CTGAGGAAACAAGCTGAGCCAGG - Intronic
1143040650 17:4033637-4033659 ATGAAGGAATAAGCTGGGCACGG - Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143399278 17:6631856-6631878 AAGAAAAGACAAGTTGAGCCTGG + Intronic
1144172583 17:12672939-12672961 AAGGAGATACAAGTTGAGAAGGG - Intronic
1144274181 17:13649189-13649211 ATTAAAAAATAAGCTGAGCATGG - Intergenic
1146610243 17:34298653-34298675 AGGAAGAAAAAGGCTGAGCATGG - Intergenic
1146821701 17:35988091-35988113 ATGAATAAACAAATTGAGCCAGG + Intronic
1147689175 17:42305042-42305064 AAAAAGAAAAAAGTTGGGCATGG + Intronic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1148474117 17:47915975-47915997 ATGGAGAAACCAGTAGAGAAGGG + Intronic
1149341629 17:55692634-55692656 ATGATGAAACACGTTGAGAGAGG - Intergenic
1149403874 17:56327157-56327179 ATGAAGAAACCAAGTGAGTATGG - Intronic
1150118338 17:62575850-62575872 AAGAAGAAAGAAGCTGGGCATGG - Intronic
1150665725 17:67135402-67135424 AAGAAGCAACAACTAGAGCAGGG - Intronic
1150735434 17:67732955-67732977 ATTAATAAACAAATTCAGCAAGG - Intronic
1151209810 17:72536083-72536105 ATGAAGAAACATGTTCAGAGAGG - Intergenic
1152050452 17:77970851-77970873 ATGAAAAAATTAGCTGAGCATGG + Intergenic
1152575590 17:81139421-81139443 AGGAAGACACAAGTTGCACACGG + Intronic
1153383270 18:4462009-4462031 ATGAAGAAAAAGGTTGTGAATGG - Intergenic
1153963833 18:10162405-10162427 ATAAAAAAATTAGTTGAGCATGG + Intergenic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154387625 18:13909780-13909802 AGGAAATAACAAGTTGAGCCTGG - Intronic
1154982689 18:21516695-21516717 ATGAAGAAACATGTTCAGGTTGG + Exonic
1155488757 18:26376542-26376564 ACTAATAAACAAGTTCAGCAAGG - Intronic
1155977751 18:32149845-32149867 ATGAAAATACAAGCTGGGCATGG - Intronic
1156689099 18:39684701-39684723 GTGAAGAATCAACTTTAGCAAGG + Intergenic
1156822705 18:41391961-41391983 ATGAAGAAGAAAGGGGAGCATGG + Intergenic
1156941663 18:42774676-42774698 ATAAATAAACAAATTGAGTAAGG - Intronic
1156996504 18:43474861-43474883 ATGCAGCAACAAGTTCACCACGG - Intergenic
1157164348 18:45344530-45344552 ATGAAGAGACACTTAGAGCAGGG + Intronic
1158488251 18:57887495-57887517 ATGAAGAAACAAGTCCAGAAAGG + Intergenic
1158992552 18:62884662-62884684 AGGAAAAAACAAGTTAAACACGG + Intronic
1160001565 18:75029159-75029181 ATGAACAAACAAGCAGAACATGG - Intronic
1160075556 18:75671921-75671943 ATGAAAAAAAAATGTGAGCAAGG - Intergenic
1161693575 19:5752322-5752344 ATAAATAAATAAGTTGGGCATGG + Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162861666 19:13510158-13510180 ATAAATAAATTAGTTGAGCATGG + Intronic
1163086265 19:14981865-14981887 ATTAAGGAACATGTGGAGCAGGG + Intronic
1163169608 19:15521824-15521846 AAGATTAAACAAGCTGAGCATGG - Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1165277471 19:34767418-34767440 ATGGAGAAACAAATGGAGTATGG + Intronic
1167135330 19:47612257-47612279 ATGAAAAAATTAGTTGGGCATGG + Intronic
1167208435 19:48118007-48118029 TTGAAGTAAAAAGTTGAGAAAGG + Intronic
1167932383 19:52876814-52876836 ATTAAGAAACACGTTGGTCATGG + Exonic
1167934623 19:52896416-52896438 ATTAAGAAACAAGGCGGGCATGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168443042 19:56388337-56388359 ATGAAGAAACAAATGGTGAAAGG + Intronic
1168455686 19:56506638-56506660 ATGAAGAGACATGTAGGGCAAGG - Intergenic
927802483 2:26113872-26113894 ACTAATAAACAAGTTCAGCAAGG + Intronic
928349296 2:30533923-30533945 ATTAAGTAGCAAGTTGAGAAAGG - Intronic
928369077 2:30726509-30726531 ACTAATAAACAAGTTTAGCAAGG + Intronic
928656307 2:33455274-33455296 ATCAAGCAACAAGATGAGAATGG - Intronic
928916323 2:36475440-36475462 ATGTATAAACAAGTTCAACAAGG - Intronic
929039826 2:37733624-37733646 ATGAAGATGGAAGTTGAGGAAGG + Intronic
929472785 2:42212571-42212593 ATTAAGAAAGAATTTTAGCAGGG - Intronic
930591950 2:53338301-53338323 ACTAATAAACAAGTTTAGCAAGG - Intergenic
930671234 2:54152951-54152973 TGGAAGAAACCAGCTGAGCATGG - Intronic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931370358 2:61656805-61656827 ATTTAGAAATTAGTTGAGCATGG - Intergenic
932600386 2:73120270-73120292 GTGAATAAACGAGTTCAGCAAGG + Intronic
932862958 2:75313517-75313539 ATGTAGAACCAAGTTCTGCAAGG + Intergenic
934914195 2:98286136-98286158 ATTAATTAACAAGTTCAGCAAGG - Intronic
935283550 2:101542244-101542266 ACAAATAAACAAGTTTAGCAAGG - Intergenic
935519301 2:104084405-104084427 AAGAATAAACAAGTAGACCAAGG - Intergenic
936008190 2:108908395-108908417 ATGAAGACACCAGTTGAACTTGG - Intronic
936059503 2:109285170-109285192 AAGAAGGAACAAATTGAGCCTGG + Intronic
936253788 2:110891131-110891153 ATTAAAAAACAAGTTCAGCAAGG - Intronic
937178708 2:119969301-119969323 ATTAAAAACCAAGCTGAGCATGG - Intronic
937530359 2:122820188-122820210 ATGGAGGAACAATTTAAGCAAGG - Intergenic
937598701 2:123703036-123703058 AGGAATAAACAAGATGAGCCTGG + Intergenic
937896476 2:126980085-126980107 ATGAAGCCACATGTTGAGGATGG - Intergenic
939061030 2:137421504-137421526 ATGAAGAGACAAGAGGGGCATGG + Intronic
939173774 2:138726196-138726218 ATGAAAAAATTAGTTGGGCACGG - Intronic
939798311 2:146676338-146676360 ATGAAAAATCAAGTTGAGAATGG + Intergenic
940331274 2:152477469-152477491 AAGAAGAAACAAGTTTGGGATGG - Intronic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941297097 2:163752854-163752876 ATGATGAAACAAGTTCAGAGAGG - Intergenic
941430382 2:165407687-165407709 ATGAAGGAACAACTTGTTCATGG - Intergenic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941891094 2:170582635-170582657 AGGAAGAAAGAAGTAGAGGAAGG - Intronic
941907683 2:170732687-170732709 ACAAACAAACAAGTTTAGCAGGG + Intergenic
943137730 2:183936904-183936926 AATAATAAACAAGTTGATCAGGG - Intergenic
943147814 2:184067252-184067274 CTGAAGAAACTATTTGAGTATGG + Intergenic
944059077 2:195553173-195553195 ATAAAAAAACTAGTTGGGCATGG - Intergenic
944254742 2:197614453-197614475 AGGAAGAACCAAGTTGCACAGGG - Intronic
945036330 2:205707052-205707074 ATGAAGAAAGATGTTTAGAAAGG - Intronic
945085399 2:206126982-206127004 ATGAAGGAAGCAGTTAAGCAGGG + Intronic
945103977 2:206290709-206290731 ATTAATAAACAAGGTCAGCAAGG - Intronic
945433330 2:209791494-209791516 TAGAGGAAACAATTTGAGCAAGG - Intronic
945847342 2:214962112-214962134 ATGGAAAAACAATTTGCGCAAGG + Intronic
945879427 2:215311272-215311294 AACAAAAAACAAGTTGGGCATGG + Intergenic
947857005 2:233330896-233330918 ATAAAGAAACAATTTGTGCAAGG - Intronic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1169371425 20:5031107-5031129 ATGTAGAAATTAGTTGGGCATGG - Intergenic
1169393455 20:5209321-5209343 ACTAATAAACAAGTTCAGCAAGG + Intergenic
1169556884 20:6760702-6760724 AAGAAGAATGAAGTGGAGCAAGG - Intergenic
1173542387 20:43863860-43863882 ATGAGGAAACAAGCTCAGAAAGG - Intergenic
1173811873 20:45960758-45960780 ATGGAGAAAGAAGTGGAGGAGGG + Intronic
1174307280 20:49622649-49622671 ATGAGGAAACATGCTCAGCAAGG - Intergenic
1174462686 20:50694010-50694032 AGAAAGAAACAGGCTGAGCATGG + Intergenic
1174572579 20:51512596-51512618 ATGAAGAGAACAGCTGAGCATGG + Intronic
1174833894 20:53838322-53838344 AAAAAGAAACAAATTGAGCCGGG - Intergenic
1175689798 20:61057125-61057147 ATGAAGAAACAAGTGCCCCAGGG + Intergenic
1177554131 21:22668192-22668214 AAGAAGAAATCAGCTGAGCACGG + Intergenic
1178385755 21:32148938-32148960 AAGAAGAAACAACTTGGGCTTGG + Intergenic
1178598568 21:33976518-33976540 ATGAAGCAGGAAGTGGAGCAGGG - Intergenic
1178965784 21:37115961-37115983 AAGAAGAAAAAAGTAAAGCAAGG - Intronic
1179045397 21:37839952-37839974 ATGCAAAAATAAGCTGAGCATGG - Intronic
1181600115 22:23946444-23946466 ATGAAGAAACAAGTTCTTCAAGG + Intergenic
1181608390 22:23994869-23994891 ATGAAGAAACAAGTTCTTCAAGG - Intergenic
1181715502 22:24724415-24724437 ATGAAAAAATTAGCTGAGCATGG - Intronic
1181998314 22:26900882-26900904 ATGAAGGAACAAGATGATGATGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182708384 22:32304430-32304452 AAGAAAAAACAAGCTGGGCATGG - Intergenic
1182990433 22:34762546-34762568 ATGAGGAATCAAGCGGAGCAAGG - Intergenic
1183207661 22:36430848-36430870 TTGAAGAAACTGGCTGAGCACGG - Intergenic
1183431929 22:37771235-37771257 AGGAGGAAACAAGTTCAGCCAGG - Intronic
1183660719 22:39219417-39219439 ATGAAGAAACAAGGGAAACAAGG - Intergenic
1184707799 22:46226880-46226902 AAGAAAAAAAAAGTTGAGCAAGG + Intronic
1184998258 22:48226271-48226293 AGAAAGAGTCAAGTTGAGCATGG - Intergenic
1185308929 22:50142093-50142115 ATGACGGACCAAGCTGAGCATGG + Exonic
949820065 3:8106535-8106557 ATGCAGAAATTAGCTGAGCATGG + Intergenic
950759923 3:15213279-15213301 ATGAAAAAACAAGGAGATCATGG - Intronic
951094926 3:18617636-18617658 ATACAGAAACAAATTAAGCATGG - Intergenic
951376920 3:21929584-21929606 AATAATAAACAAGTTCAGCAAGG + Intronic
951929154 3:27944160-27944182 ATGGAGAATCCAGTTGAGTAGGG + Intergenic
952066154 3:29573405-29573427 ATGAAAAAGGAAGCTGAGCATGG - Intronic
952310868 3:32188832-32188854 ACTAATAAACAAGTTCAGCAAGG - Intergenic
952474552 3:33694122-33694144 ATGCACAAACAAGTTCAGCTAGG + Intronic
952551229 3:34480091-34480113 ATTAATAAACAAGCTGAGCAAGG - Intergenic
954061764 3:48073625-48073647 AAGAAAAAAAAAGTTCAGCAAGG + Intronic
954881899 3:53842239-53842261 AGGAAGAAACAAGATGAGTGAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956319333 3:67978940-67978962 ATGGAGAAACAAGAAGAGAATGG - Intergenic
956337104 3:68176324-68176346 TTGAAAAAACTAGGTGAGCATGG + Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956881584 3:73516525-73516547 ATGTAGAAACACGTTAAGAAAGG + Intronic
957392000 3:79587226-79587248 ATGAAAAAAAAAATTGAGCTGGG + Intronic
958577267 3:95967147-95967169 AAAAAAAAAAAAGTTGAGCATGG + Intergenic
958780089 3:98530486-98530508 ATGAAAAAACAACTTAAGAAAGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959032143 3:101311349-101311371 ACTAATAAACAAGTTCAGCAGGG + Intronic
959053688 3:101548781-101548803 ATGAAAAAACTAGCTGAGCATGG - Intergenic
959794528 3:110408913-110408935 ATGAATAAACAAATTCAGCAAGG - Intergenic
959966711 3:112363914-112363936 ATGAAGATAGATGTTTAGCAAGG - Intergenic
960056641 3:113280523-113280545 GAGAAGAAACAAGTTGACAATGG - Intronic
960163795 3:114379068-114379090 ATGATGAAGCAAGTAGAGAATGG + Intronic
960323090 3:116261953-116261975 AGTAAGAGACCAGTTGAGCAAGG + Intronic
960579556 3:119264582-119264604 AAGAAGAAATAGGCTGAGCACGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961152745 3:124653294-124653316 GAGAAGAAAAAAGTTGAGAATGG + Intronic
961385106 3:126518738-126518760 ATGAAGAAACAGGTGGAGAGAGG + Intergenic
961947135 3:130703283-130703305 AGGAAGAAACATGTTTGGCATGG - Intronic
962477572 3:135769751-135769773 AGGAAGAGAGAAGTTGACCAGGG + Intergenic
962736865 3:138333205-138333227 ATGAGGAAACAAGCCGGGCATGG - Intergenic
963339092 3:144012616-144012638 ATGAAGAAACATGATGTTCATGG + Intronic
963770613 3:149382659-149382681 ATGAAGTAACAAGTTCAGTCAGG - Intergenic
964450548 3:156808625-156808647 ATGAAGAAACAAATTCAGACAGG - Intergenic
965516238 3:169624468-169624490 ATGGAAAGACAAGTTGAGGATGG + Intronic
965613161 3:170565814-170565836 ATGAAGAAACAAGTGGAAGAGGG + Intronic
966103236 3:176302025-176302047 ATGATGAAACAAGGTGGCCATGG - Intergenic
966369537 3:179233654-179233676 ATGAATAAACAAGGTGATTATGG - Intronic
966798058 3:183734758-183734780 ATGAATAAATTAGTCGAGCAGGG + Intronic
968329721 3:197856675-197856697 AAGAATAAACAAGCTGGGCACGG - Intronic
968351015 3:198051924-198051946 ATGCAGAAGCAAGTTCAGAAGGG - Intergenic
968531541 4:1094455-1094477 AGGAAGAAACAGGTAGAGAATGG + Intronic
968580370 4:1388344-1388366 ATGAATAAACAAGTTCAGCAAGG - Intergenic
968876672 4:3271806-3271828 ATGAATAAGTGAGTTGAGCAGGG - Intergenic
969106013 4:4807611-4807633 CTGAAGGAACAAGTGAAGCAGGG + Intergenic
969349915 4:6592461-6592483 ATTCAAAAACAAGTCGAGCATGG + Intronic
969477653 4:7430672-7430694 ATCAAGACAGATGTTGAGCATGG - Intronic
969986150 4:11213124-11213146 ATGAAAAAACTAGCTGGGCATGG - Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
971182440 4:24342032-24342054 AAGAGGAAACAAGTTGGGCATGG - Intergenic
971810790 4:31424097-31424119 AAGAAGAAACAAGGTGTGGAAGG - Intergenic
972028812 4:34425128-34425150 AAGAGGAAAAAAGTGGAGCAGGG + Intergenic
972193258 4:36620750-36620772 ATGAAAAAACAAGTAAAGAATGG + Intergenic
972610721 4:40653116-40653138 AGAAAGAAAAAAGTTGGGCATGG - Intergenic
972631240 4:40843805-40843827 ATGAGGAAACAAGTTCAGAGAGG + Intronic
972807776 4:42547477-42547499 ATGAAGAAAAAAATAAAGCAGGG - Intronic
973547651 4:51997944-51997966 GAGAAGAAACAAGTTTAGGATGG + Intronic
973570967 4:52239310-52239332 ATGAAGAAACCAGCACAGCAAGG + Intergenic
973980631 4:56305636-56305658 ATGAAAAGCCAAGTTCAGCAAGG - Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974034619 4:56807033-56807055 AAGAAGAAACAGGCTGGGCACGG + Intergenic
974583753 4:63841894-63841916 ATTAAGAAACAAGTGGAGGATGG - Intergenic
975181031 4:71345316-71345338 ATGAATAAAGAATTTGGGCAGGG - Intronic
975765387 4:77662227-77662249 ATGAAGAAACAGGATTCGCAAGG - Intergenic
975969998 4:80022029-80022051 ATGAAGAAACAAGCTTATAAAGG + Intronic
976333897 4:83863525-83863547 GTGAAGAAACAAGTAGAGACTGG - Intergenic
976860125 4:89655051-89655073 ATAAAAAAATAAGTTGGGCATGG + Intergenic
976954190 4:90874707-90874729 ATTACTAAACAAGATGAGCAAGG - Intronic
977239040 4:94544135-94544157 AGGAAGAGACAAGCTGACCAAGG - Intronic
977573872 4:98657650-98657672 AAGAAGATACACGCTGAGCATGG + Intronic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
977915077 4:102583131-102583153 CTGAAGAAACTAGCTGGGCATGG - Intronic
978421823 4:108541604-108541626 AAAAAGAAATTAGTTGAGCATGG + Intergenic
978760675 4:112353891-112353913 ATAAATAAATAAGTTGTGCAGGG + Intronic
978860403 4:113442199-113442221 AGGAAGAATCAAGGTGAGCCCGG - Intergenic
979101039 4:116614917-116614939 ATTAAGGAACAAGTTGAGTATGG + Intergenic
979121088 4:116902670-116902692 ATAAAGAAACAGGTTCAACAAGG + Intergenic
979163322 4:117492226-117492248 ATGAAGAATGAATTGGAGCAGGG - Intergenic
979417144 4:120456384-120456406 ATTAGGAAACCAGTGGAGCAGGG + Intergenic
979613665 4:122717683-122717705 ATTAAGAAACTAGCTGGGCACGG - Intergenic
980393687 4:132179654-132179676 ATTAAGAAAATACTTGAGCACGG - Intergenic
980640887 4:135577520-135577542 AAAAAGAAACCAGTTGGGCATGG + Intergenic
981394339 4:144229525-144229547 ATGAAGCAACAAGCTGGGGAGGG - Intergenic
981598046 4:146449434-146449456 CTGAAGGAACAAGAGGAGCAGGG + Intronic
981922499 4:150100403-150100425 GTGTAGAAACAGGTTGACCAAGG + Intronic
982280527 4:153679862-153679884 ATGAAGACACAACTTGAAGAGGG - Intergenic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
982593547 4:157348392-157348414 ATTTAGAAACTAGCTGAGCATGG - Intronic
983702679 4:170616840-170616862 AATATGAAACAAGTTGAACAGGG - Intergenic
984328517 4:178285109-178285131 ATGAAGAAACATTTGGACCACGG + Intergenic
984380182 4:178982892-178982914 ATGAAGAAAGAAGATAAGGATGG - Intergenic
985008990 4:185563019-185563041 ATGAAGAAAAATATTTAGCAAGG + Intergenic
985340091 4:188941622-188941644 ATGAAGAAACAAATTTAGAGAGG - Intergenic
986492142 5:8304215-8304237 AAGGAGAAACAAGGTTAGCAAGG - Intergenic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987357145 5:17073854-17073876 ATTAAGAAACTAGCTGCGCATGG + Intronic
987587079 5:19868868-19868890 AAGAAGAAACCAGAGGAGCAAGG + Intronic
988129944 5:27091372-27091394 ATGAAAAAGCAACTTGGGCAAGG + Intronic
988603303 5:32658849-32658871 AAAAAAAAACAGGTTGAGCATGG - Intergenic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
988931184 5:36037112-36037134 ATGAAAACACAAGCTGCGCATGG + Intronic
988958401 5:36343296-36343318 ATGAATAAATGAGTTTAGCAAGG + Intergenic
989013180 5:36897394-36897416 ATTAATAAACAAGTTCAGCAAGG - Intronic
989064420 5:37445068-37445090 ATAAAGAAACAAGTTAAGTCAGG - Intronic
989313141 5:40044396-40044418 AAAAAAAAACTAGTTGAGCATGG + Intergenic
989633855 5:43513837-43513859 ATGAAGAAAAAACTTGAAGAGGG - Intronic
989986492 5:50705279-50705301 ATGAAGAAAAGAGGTGAGCCAGG + Intronic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990355500 5:54962430-54962452 ATGAAGACACATGTAGGGCAAGG + Intergenic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
991573231 5:68077171-68077193 ATAAAGAAAGAAGGAGAGCAAGG - Intergenic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
993097890 5:83502145-83502167 ACGAAGAGGCAAGTTCAGCAAGG - Intronic
993198017 5:84775364-84775386 ATGAAGAAACAAGTTTAGAATGG + Intergenic
993489040 5:88523806-88523828 ATGAAGAAATTAGCTGGGCATGG - Intergenic
993579542 5:89642683-89642705 ATCAAGAAACTAGTAAAGCAAGG + Intergenic
994373888 5:98996523-98996545 ATGAAGAAGAAAGTTGATCTTGG + Intergenic
994437193 5:99752072-99752094 ATGAAGAAAGAAATTGAAGAGGG - Intergenic
994461736 5:100074243-100074265 ATAAAGAAACAAGTTAAGTCAGG + Intergenic
995572346 5:113493647-113493669 TTGAAGAAAAAAGCTGAGTAAGG - Intergenic
996092305 5:119363126-119363148 AGGAAGAAACAAGGAGAGCATGG + Intronic
996496615 5:124164504-124164526 ATGAAAACACAAGATGAGCCTGG + Intergenic
996546665 5:124686307-124686329 ACGAAGAGACAAGTTCAACATGG + Intronic
997394598 5:133548093-133548115 ATGAAGAAATACATAGAGCAAGG - Intronic
997514081 5:134473590-134473612 ATTAATAAACAAGTTTAGCAAGG - Intergenic
997532503 5:134590860-134590882 AAGAAAAAATTAGTTGAGCATGG + Intergenic
997827789 5:137123162-137123184 GTGAAGAAACTTCTTGAGCAGGG - Intronic
999407412 5:151319042-151319064 CTGAGGAAACAAGCTGAGGAAGG - Intronic
1000959763 5:167585967-167585989 ATAAAGAAATAAGCTGGGCATGG + Intronic
1003337585 6:5188645-5188667 ATGAGGAAACAAGTTTAGAGAGG - Intronic
1004245990 6:13976125-13976147 ATGAAGAAATCACTTGTGCATGG - Intronic
1004768986 6:18760001-18760023 CTGAAGAACAAAGTTGACCATGG + Intergenic
1005334618 6:24781923-24781945 ATGAAAAAATTAGCTGAGCATGG + Intronic
1006439043 6:34041959-34041981 ATGAAGAAACTAACTGGGCATGG + Intronic
1007308691 6:40927583-40927605 AAGCAGAAACAAGTAAAGCAAGG + Intergenic
1007512511 6:42384958-42384980 TAGAAAAAACTAGTTGAGCATGG - Intronic
1008000501 6:46355297-46355319 ATGCAGAAACAAGTGGCTCATGG + Intronic
1008112691 6:47510430-47510452 ATGAAGATACAAGATAAGCCTGG + Intronic
1008702280 6:54115484-54115506 ATGAAGAAACAAATTACGGAAGG + Intronic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1008941771 6:57054421-57054443 ATGAAGAAATAACTTCACCATGG + Exonic
1008967702 6:57330335-57330357 AAAAAAAAACAAGTTCAGCAAGG - Intronic
1009638789 6:66303043-66303065 ATTAAAAAACTAGTTGGGCATGG - Intergenic
1010093785 6:72015389-72015411 ATTAATAAACAAGCTCAGCAAGG - Intronic
1012577295 6:100818828-100818850 TAGAAGTGACAAGTTGAGCAAGG + Intronic
1012977996 6:105800526-105800548 ATGAAAAGACAAGTAGATCAAGG + Intergenic
1013438951 6:110141621-110141643 TTGGAGATACAAGTTGAGTAAGG - Intronic
1013533876 6:111045919-111045941 ACTAATAAACAAGTTCAGCAAGG - Intergenic
1013648281 6:112167760-112167782 AGGAAGATACAATTTGTGCAAGG + Intronic
1013996187 6:116310939-116310961 ATTAGGAAACAAGTTGAGGCTGG - Intronic
1015017753 6:128434866-128434888 AGAAAAAAAAAAGTTGAGCATGG + Intronic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1015916134 6:138219141-138219163 AGGAAGAAGCATGTTTAGCAGGG + Intronic
1016422133 6:143896562-143896584 ATAAGGAAACAGGTTCAGCAAGG - Intronic
1016716000 6:147229722-147229744 ATGAATAAAAAAGTTCAGCAAGG - Intronic
1017867207 6:158454344-158454366 TTGAAGAAAAAAGTTAAGCATGG - Intronic
1017897129 6:158690237-158690259 GTGAATAAATAAATTGAGCAGGG + Intronic
1018455325 6:163946590-163946612 ATTAAGCAACAAGTCCAGCAGGG - Intergenic
1018576275 6:165263314-165263336 ATGAAAAAATTAGTTGGGCATGG + Intergenic
1019043369 6:169124466-169124488 AAGAAGAAACAAGTTCTACAAGG - Intergenic
1019853919 7:3585582-3585604 ATGAAGAAGGAAATTGATCAGGG + Intronic
1020064624 7:5177823-5177845 AGGAAGAAAAAATCTGAGCAGGG + Intergenic
1020131173 7:5559300-5559322 ATGAGGAAACTGGTTGGGCACGG + Intronic
1020585721 7:10063913-10063935 ATAAAGAAATTAGTTGGGCATGG - Intergenic
1021724640 7:23537162-23537184 ATAAAAAAAAAAGTTGGGCATGG - Intergenic
1021731425 7:23598651-23598673 ATGTAGAAAAAAGTTGACCCAGG - Intronic
1021832926 7:24635413-24635435 ATAAAAAAATAAGTTCAGCAAGG - Intronic
1022078225 7:26994344-26994366 ATGAAGAAACATGCTGTGCTTGG - Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1023224099 7:37951038-37951060 CTAAAGAAACATTTTGAGCAAGG + Exonic
1023722185 7:43108069-43108091 ATGAATAAATGAGTTCAGCAAGG + Intergenic
1024361748 7:48475752-48475774 ATGAGGAAACAGGTTGGGCGTGG - Intronic
1024421794 7:49176110-49176132 ATCAAGTAAGTAGTTGAGCAGGG + Intergenic
1024772932 7:52745595-52745617 ATGAAAAAACTAGTTGGGCGTGG + Intergenic
1024786174 7:52910787-52910809 ATTAAAAAATAAGCTGAGCATGG + Intergenic
1025196255 7:56936595-56936617 GTGAAGGAACAAGTGAAGCAGGG + Intergenic
1025675692 7:63640337-63640359 GTGAAGGAACAAGTGAAGCAGGG - Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1026112913 7:67472676-67472698 ATGAAGGAACAAGAGGACCAGGG + Intergenic
1026544413 7:71309345-71309367 AGGAAGAAGCAAATTTAGCAGGG - Intronic
1026684151 7:72494033-72494055 ATGAAAAAATAAGCTGGGCATGG + Intergenic
1027654886 7:80918651-80918673 CTAAAGAAACAACTCGAGCAGGG + Intronic
1027706861 7:81546011-81546033 ATGAGGAATCAAGTTAAGAAAGG + Intergenic
1028023768 7:85809828-85809850 ATTAAAAAAAAAGTTGGGCATGG - Intergenic
1028539515 7:91926689-91926711 ATTAAGAATCAAGCTGGGCATGG + Intergenic
1028829138 7:95307398-95307420 ATGATGACACAAGATGAGAAAGG + Intronic
1029260355 7:99298109-99298131 ATGAGGAAACATGTTCAGCAAGG - Intergenic
1029447083 7:100619756-100619778 AAGCAGAAACAAGCTGGGCACGG - Intergenic
1029534886 7:101151347-101151369 AAGAAGAAAGAAGTTGGGCCCGG + Intergenic
1030488194 7:110198325-110198347 ATGAAGAAAATATTTGAGCAAGG - Intergenic
1030669431 7:112318981-112319003 ATGAAGAGACAAATTGGGCAGGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032729668 7:134626993-134627015 ATGAACACACAAGTTGAGGAAGG - Intergenic
1032815574 7:135470284-135470306 ATTAAGAAACTAGTGGGGCATGG - Intronic
1033379669 7:140802586-140802608 ATGAAGACACAAGCTGCACACGG - Intronic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034069197 7:148166131-148166153 ATGGAGAAAAAAGTCAAGCAGGG - Intronic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034912452 7:155008416-155008438 ATACAAAAACTAGTTGAGCATGG + Intergenic
1035742791 8:1941240-1941262 ACTAATAAACAGGTTGAGCAAGG + Intronic
1035943527 8:3931745-3931767 CAGAGGAAACAAGGTGAGCAAGG + Intronic
1038675571 8:29619857-29619879 ATGAAGAAATAGCTTGGGCAAGG + Intergenic
1038774190 8:30513245-30513267 ATAAAGAAACAAATTCAGCTGGG - Intronic
1039168157 8:34710092-34710114 ATAAAGAGACAAGTAGAACAAGG - Intergenic
1039480248 8:37867771-37867793 AGGAAGAAAAAAGTGGGGCAAGG + Intronic
1039543899 8:38393863-38393885 TTTAAGAACCAAGCTGAGCATGG + Intronic
1040419202 8:47223400-47223422 ATGAAGATTCTAGTAGAGCATGG + Intergenic
1040729660 8:50428152-50428174 ATTAAAAAATTAGTTGAGCATGG + Intronic
1040799381 8:51324148-51324170 ATGAATACATGAGTTGAGCAAGG - Intronic
1041093252 8:54324522-54324544 ATAAACAAACATGTTGAGAATGG + Intergenic
1041644812 8:60240337-60240359 AGGATAAAACAAGTGGAGCAAGG + Intronic
1042603081 8:70518720-70518742 ATGAATAAATGAGTTCAGCAAGG - Intergenic
1043698873 8:83258014-83258036 ATAAGGAAGCAAGATGAGCAAGG + Intergenic
1043909404 8:85843323-85843345 TTGAAGAAATAAGTAGAGGAAGG - Intergenic
1044077850 8:87845715-87845737 AAGAAGAAAAAGGTTGGGCAAGG + Intergenic
1044106269 8:88210978-88211000 ATGAGGAAACAAGTTGAGAAGGG + Intronic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044888499 8:96806229-96806251 ATAAATAAATAAGTTGAGGAAGG - Intronic
1045378011 8:101594386-101594408 TTGAGGAAATAAGTTGAGGAAGG + Intronic
1045565298 8:103308564-103308586 ATGAAGAAACAATTACAGCCTGG - Intronic
1045663165 8:104459100-104459122 GTCAAGTAACAAGTTGAGAAAGG - Intronic
1045861692 8:106820724-106820746 ATAAATAAATAAGCTGAGCATGG - Intergenic
1047540026 8:125755727-125755749 AAGAAGAAAGGAGATGAGCAAGG - Intergenic
1048258194 8:132922272-132922294 AAGAAGAAACAGCTTGAACATGG + Intronic
1048343176 8:133556184-133556206 AAGAAAAAACAAGCTGGGCATGG - Intronic
1048641127 8:136363099-136363121 CTCAAGAAAGAACTTGAGCATGG - Intergenic
1048707241 8:137167502-137167524 ATGAAGAAAAGAGTTAAGAATGG - Intergenic
1048970053 8:139640368-139640390 AGGATGAACCAAGTTGAGTAAGG + Intronic
1049048222 8:140169891-140169913 ATGCAGAAACTAGCTGAGCATGG - Intronic
1049672546 8:143876380-143876402 GTGCAGAAACAAGTTTTGCAGGG - Intronic
1050253824 9:3773409-3773431 CTGCAGCAACAAATTGAGCAAGG - Intergenic
1050512535 9:6411531-6411553 ATTAAAAAACTAGCTGAGCATGG - Intergenic
1050747419 9:8892383-8892405 ATGAATAAATAAATTGGGCAAGG - Intronic
1051367864 9:16333983-16334005 ATGAAGGAACGAGATGACCATGG - Intergenic
1051562913 9:18462781-18462803 ATGAAAAAATTAGTTGGGCATGG + Intergenic
1051622211 9:19062819-19062841 ATTAAAAAAACAGTTGAGCATGG - Intronic
1051714878 9:19972052-19972074 AACAACAAACAAGTTGAGTAAGG + Intergenic
1052415626 9:28173235-28173257 ATGAAGCAAAAATTTAAGCAGGG - Intronic
1052515902 9:29479219-29479241 ACAAATAAACAAGTTCAGCACGG - Intergenic
1052692971 9:31838593-31838615 AACATGAAAAAAGTTGAGCAGGG + Intergenic
1053290628 9:36877564-36877586 TTGGAGAAACAAGTGAAGCAAGG - Intronic
1054975609 9:71140622-71140644 ATGAAGAAACATGTTGATTTAGG - Intronic
1054985070 9:71252510-71252532 ATGAAGAAATAAGTTGGTCCTGG - Intronic
1055433958 9:76273435-76273457 AAGAAGAAACACCTTGAGAAGGG - Intronic
1055559372 9:77507435-77507457 AAGAACAAACATGTAGAGCATGG + Intronic
1056588005 9:87940769-87940791 ATGAAGAAACAACCAGAGAATGG - Intergenic
1056608862 9:88112176-88112198 ATGAAGAAACAACCAGAGAATGG + Intergenic
1057726092 9:97569195-97569217 ATGAAGAAGGAAGGTGAGCGTGG - Intronic
1057904852 9:98975531-98975553 ATGAAGAAACAAACAGAGCAGGG - Intronic
1058006199 9:99917992-99918014 AGGTAGAACCAAGTTGAGGATGG - Intronic
1058299291 9:103350050-103350072 ATTAATAAACTAGTTAAGCAAGG + Intergenic
1058570225 9:106333870-106333892 ATGAAGAAACAAATGTAGCAAGG - Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058725844 9:107803240-107803262 ATGAAGAAACAAGTTGATTGAGG - Intergenic
1058866985 9:109169732-109169754 ATTAAAAAAAAAGTTGAACATGG - Intergenic
1058992046 9:110263628-110263650 ACTAATAAACAAGTTCAGCAAGG + Intergenic
1059257292 9:112942827-112942849 ATGAAGGAAAAAGTCTAGCATGG - Intergenic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059800356 9:117744188-117744210 AAAAAGAAAAAAGTTGACCAAGG - Intergenic
1059912128 9:119056237-119056259 GGGAAGAAAGAATTTGAGCAGGG + Intergenic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1062485214 9:136771061-136771083 GTAAAGAAATAAGCTGAGCACGG - Intergenic
1185685409 X:1924508-1924530 AAGAAGAAATAAGCTGGGCATGG - Intergenic
1186554344 X:10541802-10541824 ATTAAGAAACAAATAGAGGAAGG + Intronic
1187768447 X:22668926-22668948 ATGGAGAAATAAACTGAGCAAGG - Intergenic
1189136876 X:38559675-38559697 AAGAAGGGACAGGTTGAGCAAGG - Intronic
1189342756 X:40217001-40217023 ATGAAAAAATTAGTTGGGCATGG + Intergenic
1189849205 X:45162266-45162288 ATGAATATGCAACTTGAGCAGGG - Intronic
1189985547 X:46550388-46550410 ATGAAAAAATAAGTTGAGAGGGG + Intergenic
1192296191 X:69851285-69851307 ATGAAGGAAGAAATTGAGCAGGG - Intronic
1192468751 X:71378206-71378228 CAGAAGAAAGAAGTAGAGCAGGG - Intronic
1192493299 X:71595384-71595406 AAGAAGAAACAAGCTGGGCACGG - Intronic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1193775255 X:85633903-85633925 ATGATGAAATAAGGTGAGTATGG - Intergenic
1194524345 X:94959309-94959331 ATGAAAAAAAAAGTAGACCAAGG - Intergenic
1194747640 X:97646360-97646382 ATTAAAAAATTAGTTGAGCATGG - Intergenic
1194987409 X:100505853-100505875 ATGAATATACAAGATGAGCCTGG + Intergenic
1195386611 X:104319458-104319480 ATGAAGAAATTAGCTGGGCATGG + Intergenic
1195503372 X:105628945-105628967 AAAAAAAAAAAAGTTGAGCAGGG + Intronic
1195620327 X:106946930-106946952 TTGAAGAAAGAAGCTGGGCATGG - Intronic
1195897327 X:109759845-109759867 AAGAAGAAACAATATGAGCAAGG + Intergenic
1196392443 X:115222524-115222546 TAGAAGAAACAAGTTCAGCAAGG + Intronic
1196850340 X:119931746-119931768 ATGAAGAAATAAGCTGAACATGG + Intronic
1196915412 X:120529388-120529410 AAGAGGAAACAAGATCAGCATGG + Intronic
1199819211 X:151428027-151428049 ATAAGGAGAAAAGTTGAGCAGGG - Intergenic
1199855158 X:151753687-151753709 GCGAAGAAAGAATTTGAGCAGGG + Intergenic
1202127596 Y:21582101-21582123 ATGAAGCAACAAGTCAGGCAGGG + Intergenic