ID: 1121177266

View in Genome Browser
Species Human (GRCh38)
Location 14:91899907-91899929
Sequence TTTGTTGTCCCCGAGATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121177266_1121177270 17 Left 1121177266 14:91899907-91899929 CCAACAATCTCGGGGACAACAAA 0: 1
1: 0
2: 1
3: 5
4: 59
Right 1121177270 14:91899947-91899969 TTGTGACTCACGGACAGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 82
1121177266_1121177267 7 Left 1121177266 14:91899907-91899929 CCAACAATCTCGGGGACAACAAA 0: 1
1: 0
2: 1
3: 5
4: 59
Right 1121177267 14:91899937-91899959 GAACCTTCCATTGTGACTCACGG 0: 1
1: 0
2: 0
3: 11
4: 472
1121177266_1121177272 23 Left 1121177266 14:91899907-91899929 CCAACAATCTCGGGGACAACAAA 0: 1
1: 0
2: 1
3: 5
4: 59
Right 1121177272 14:91899953-91899975 CTCACGGACAGCACAGGAAAGGG 0: 1
1: 0
2: 1
3: 13
4: 185
1121177266_1121177271 22 Left 1121177266 14:91899907-91899929 CCAACAATCTCGGGGACAACAAA 0: 1
1: 0
2: 1
3: 5
4: 59
Right 1121177271 14:91899952-91899974 ACTCACGGACAGCACAGGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121177266 Original CRISPR TTTGTTGTCCCCGAGATTGT TGG (reversed) Intronic
903907526 1:26696913-26696935 TTTGTTGTCCGCCATGTTGTTGG - Exonic
907054047 1:51348617-51348639 TTTGTTCTCCTCCAGATTGTGGG - Intergenic
908072121 1:60472636-60472658 TTTGTTAAACCAGAGATTGTTGG - Intergenic
910393669 1:86770150-86770172 TTTGTTGTCTATGAGACTGTAGG - Intergenic
913977709 1:143476936-143476958 GTTGTCGTCACCGAGAATGTAGG - Intergenic
914072113 1:144302565-144302587 GTTGTCGTCACCGAGAATGTAGG - Intergenic
914107042 1:144663791-144663813 GTTGTCGTCACCGAGAATGTAGG + Intergenic
920930779 1:210386097-210386119 TTTGGTGTACCTAAGATTGTGGG - Intronic
1067188588 10:44051037-44051059 TTCGCTGTCCCAGATATTGTTGG - Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1074701911 10:116099742-116099764 TTTCTTGGCACCTAGATTGTGGG - Intronic
1083513189 11:63230906-63230928 TTTTTTGTCCTTGAGATAGTTGG + Intronic
1093226857 12:16495117-16495139 TTTGTTATCCTGGACATTGTAGG - Intronic
1105849889 13:24323833-24323855 TTTGATGTCCCCGTGAGGGTTGG - Intergenic
1107759465 13:43661476-43661498 TTTGTTGTCTACAAAATTGTGGG - Intronic
1108071486 13:46633747-46633769 TATGTTGACCACCAGATTGTGGG - Intronic
1111745252 13:92259971-92259993 TTTGTTTTCCCAGAGTTTGTTGG - Intronic
1119156620 14:72417482-72417504 TTTTTTTTCCCCCAGATAGTGGG + Intronic
1121177266 14:91899907-91899929 TTTGTTGTCCCCGAGATTGTTGG - Intronic
1202869584 14_GL000225v1_random:148179-148201 TCGATTGTCCCCGTGATTGTGGG - Intergenic
1125087433 15:35746840-35746862 TTTTTTTTGCCCGAGATGGTGGG - Intergenic
1131931105 15:97442770-97442792 TTTGATGGTCCCAAGATTGTGGG + Intergenic
1140237280 16:73170945-73170967 TCTGTAGTCCCAGACATTGTCGG - Intergenic
1142737954 17:1913500-1913522 TTTGTTGTTCCTGGGTTTGTAGG - Intergenic
1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG + Intronic
1152448323 17:80359787-80359809 TTGGTTCTGCCCGAGATTTTGGG + Intronic
1153048195 18:876148-876170 CTTGTTTTCCCCAAGAATGTTGG - Intergenic
1160089351 18:75811695-75811717 TTATTTGGCCCCAAGATTGTTGG - Intergenic
1167579693 19:50334179-50334201 TTTCTTGTCCCCGGGGTTGGGGG - Intronic
927406582 2:22777250-22777272 TTTATTGTCCCCCACATTATTGG + Intergenic
931002897 2:57808926-57808948 ATTGTTTTCCCTGAGATGGTTGG - Intergenic
931445174 2:62321120-62321142 TTTAGTGTCCCTGAGATGGTGGG - Intergenic
934182416 2:89637931-89637953 GTTGTCGTCACCGAGAATGTAGG - Intergenic
937593487 2:123644484-123644506 TTTGTAATCCCCTAGAGTGTGGG + Intergenic
938549724 2:132368961-132368983 TTTTTTGTCCTTGAGATAGTTGG + Intergenic
938740173 2:134224137-134224159 TTTATTGTTCCCAAGGTTGTGGG + Intronic
940465070 2:154017077-154017099 TCTGTTCTTCCCAAGATTGTGGG - Intronic
941876793 2:170441719-170441741 TTTGTTGTCATGGAGATGGTGGG + Intronic
1176730054 21:10485322-10485344 GTTGTCGTCACCGAGAATGTAGG + Intergenic
1180902676 22:19386005-19386027 TTTGTTCTCCACCAGACTGTGGG - Intronic
959546798 3:107605874-107605896 TTTCTTGTCCCCAAGCTTTTTGG + Intronic
965520477 3:169664465-169664487 TCTTTTGACCCCGAGGTTGTAGG - Intergenic
976559616 4:86486430-86486452 TCTTTTGTTCCCTAGATTGTGGG - Intronic
1001308447 5:170593479-170593501 TTTGTTGTCACTGAGATGGAAGG - Intronic
1006872053 6:37260386-37260408 TTTGTTGTCACTAAGATTGTTGG - Intronic
1008401699 6:51070691-51070713 TTTGGTGTCACACAGATTGTAGG - Intergenic
1008620658 6:53268363-53268385 TTCTTTGTCCTCGAGATTTTAGG - Exonic
1009339806 6:62540708-62540730 TCTATTTTCCCCTAGATTGTGGG - Intergenic
1011896088 6:92227780-92227802 TTTGTTGTACAGGAGATTTTTGG + Intergenic
1016128555 6:140436612-140436634 TTTGTTTCCCCAGAGAGTGTAGG + Intergenic
1016991837 6:149935470-149935492 TGTGTTGTCCTCGAGATGGTTGG - Intergenic
1020357414 7:7292647-7292669 TTTGCTCTCCCCCGGATTGTAGG + Intergenic
1022879610 7:34572842-34572864 TTTTTTGTCCTCGCGATAGTTGG + Intergenic
1025142348 7:56476653-56476675 ATTGTTTTCCCAGAGAATGTTGG - Intergenic
1027228919 7:76261124-76261146 ATTGTTGTCCCCACAATTGTGGG + Intronic
1027228922 7:76261133-76261155 TATGTTGTCCCCACAATTGTGGG - Intronic
1031006468 7:116478592-116478614 TTTGATGACCTCCAGATTGTAGG + Intronic
1045032550 8:98151499-98151521 TTTGTTGCCCCCTAAATTGTAGG + Intronic
1046693478 8:117312122-117312144 TTTGTTGTACCAGAGATTGTTGG + Intergenic
1058329990 9:103748696-103748718 TTTGTTGACCCCGTGTATGTGGG - Intergenic
1203735290 Un_GL000216v2:132962-132984 TCAATTGTCCCCGTGATTGTGGG + Intergenic
1187844254 X:23520380-23520402 TTTTTTGTCCTCGCGATAGTTGG + Intergenic
1192776398 X:74250170-74250192 TTTATGGTACCGGAGATTGTAGG - Intergenic
1197153681 X:123247371-123247393 TTTATAGTCCCCGAGTCTGTAGG - Intronic
1198431493 X:136571126-136571148 TTTTTTGTCCCTGAGGTGGTGGG + Intergenic
1202625727 Y:56855445-56855467 TCGATTGTCCCCGTGATTGTGGG - Intergenic