ID: 1121179536

View in Genome Browser
Species Human (GRCh38)
Location 14:91918375-91918397
Sequence CCAAGAAACAAGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 414}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121179531_1121179536 -10 Left 1121179531 14:91918362-91918384 CCCAGATTTTCAGCCAAGAAACA 0: 1
1: 0
2: 1
3: 23
4: 335
Right 1121179536 14:91918375-91918397 CCAAGAAACAAGAGGGCAGAAGG 0: 1
1: 0
2: 2
3: 38
4: 414
1121179528_1121179536 30 Left 1121179528 14:91918322-91918344 CCCCAGCTCTGCTGAAACTGCTC 0: 1
1: 0
2: 5
3: 65
4: 357
Right 1121179536 14:91918375-91918397 CCAAGAAACAAGAGGGCAGAAGG 0: 1
1: 0
2: 2
3: 38
4: 414
1121179530_1121179536 28 Left 1121179530 14:91918324-91918346 CCAGCTCTGCTGAAACTGCTCTT 0: 1
1: 0
2: 4
3: 42
4: 281
Right 1121179536 14:91918375-91918397 CCAAGAAACAAGAGGGCAGAAGG 0: 1
1: 0
2: 2
3: 38
4: 414
1121179529_1121179536 29 Left 1121179529 14:91918323-91918345 CCCAGCTCTGCTGAAACTGCTCT 0: 1
1: 0
2: 1
3: 35
4: 304
Right 1121179536 14:91918375-91918397 CCAAGAAACAAGAGGGCAGAAGG 0: 1
1: 0
2: 2
3: 38
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121179536 Original CRISPR CCAAGAAACAAGAGGGCAGA AGG Intronic
900710202 1:4108735-4108757 GGAAGAAAAATGAGGGCAGAAGG - Intergenic
901267430 1:7922411-7922433 CCAAGAAACAACATGGCAATGGG + Intronic
902546973 1:17196138-17196160 CCAAGAAGGATGAGGCCAGAGGG - Intergenic
902937817 1:19777221-19777243 GCAGGAAGGAAGAGGGCAGAGGG - Intronic
903218660 1:21856715-21856737 GCAAGAAACAAGGTGGGAGAAGG - Intronic
903551097 1:24157732-24157754 CCAACAGACAAGATGGAAGAAGG - Exonic
904873266 1:33635015-33635037 TCCGGACACAAGAGGGCAGAAGG - Intronic
905518854 1:38582138-38582160 CCAAGAAAAGTGAGGGCAGATGG + Intergenic
905585813 1:39117211-39117233 CCAAGCAAGTAGAGGGCAAAGGG - Intronic
906110127 1:43317169-43317191 GGATGAGACAAGAGGGCAGACGG - Intronic
906553455 1:46687158-46687180 CTAAGAAACAGTAGGACAGATGG + Intronic
906660194 1:47576444-47576466 CTAAGAGACAAGAAGGTAGAGGG + Intergenic
906790581 1:48655431-48655453 CCAAGAAAAAAGAGGGACCAGGG + Intronic
906838053 1:49105305-49105327 GCAAGAAACAACAGGACACAGGG + Intronic
907281879 1:53353087-53353109 CCAAGAAAAAAATGGGCACAGGG - Intergenic
907976528 1:59436278-59436300 CCATGAAACAGAAGGGCAGAGGG - Intronic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
909293172 1:73910981-73911003 CCAACAAACATGAGAGGAGAAGG + Intergenic
909564529 1:77039842-77039864 CGAAGACACAAGAGGGGAGGTGG - Intronic
911068322 1:93811999-93812021 CTAAGCAGCAAGTGGGCAGATGG - Intronic
912350136 1:109004733-109004755 CAAAAAAACAAAAAGGCAGAGGG + Intronic
912373598 1:109192581-109192603 CAAGGAAACAAGAGGGGAGAGGG - Intronic
912658658 1:111509341-111509363 CCAAGAGACATGAGGGCATTTGG - Intronic
913198108 1:116474770-116474792 CCAAGAAACAGTGAGGCAGATGG + Intergenic
913539532 1:119805512-119805534 CCATGAAAGCAGAGGGCCGAGGG + Intronic
914706450 1:150173793-150173815 CCAAACAGCAAGAGGACAGAAGG + Intergenic
915098453 1:153481047-153481069 CCAAGAAAGAGGAAGGCATAAGG - Intergenic
915835851 1:159173889-159173911 CCAAGAAAGAAGAGTGTAGTTGG - Intronic
918188068 1:182145112-182145134 CCAAGGATCAGGAGGGCAGCTGG + Intergenic
918792488 1:188846988-188847010 CCAAGAAAAATGAGGTCACATGG + Intergenic
919745227 1:201004555-201004577 CCAAGGAGCAAGAGGGCTGCTGG - Intronic
921259485 1:213372908-213372930 TCAAGCAACAAGAGGAGAGAGGG - Intergenic
921420374 1:214940341-214940363 TGAAGACACAAAAGGGCAGATGG - Intergenic
921779726 1:219147881-219147903 CCAAGAAAGATGAGGTAAGAAGG + Intergenic
921794251 1:219324485-219324507 GCAGGAAACACGAGTGCAGAGGG - Intergenic
921890065 1:220344778-220344800 GCAAGACACAAGAGGGAACAGGG - Intergenic
921940568 1:220834529-220834551 CTAAGAAACAGGAGAGCTGATGG - Intergenic
922417577 1:225435696-225435718 CCAAGCAACAAGAGAGGAAAAGG - Intergenic
924557470 1:245130129-245130151 CCAAGGAAGACGAGGGGAGAGGG + Intergenic
1065446192 10:25803697-25803719 CTGAGAAACAGGAGAGCAGAAGG + Intergenic
1065544316 10:26803410-26803432 CCAAGAAATAGGAGAGCAAATGG - Intronic
1065701491 10:28430224-28430246 CCAAGTAACAAAAGGACAGGAGG - Intergenic
1067089282 10:43258426-43258448 CCATGAAAGAGGAGGGCAGGTGG - Intronic
1067177529 10:43960501-43960523 CCTAGAACAGAGAGGGCAGAGGG + Intergenic
1068175071 10:53447383-53447405 CCAAGATACAATGGGGCATAGGG + Intergenic
1068347321 10:55798785-55798807 CTGAGAGACAAGAGGACAGAAGG - Intergenic
1069021280 10:63491136-63491158 CAAAGAATGAAGATGGCAGATGG + Intergenic
1069142185 10:64840253-64840275 CCAAGAAGAAAGAGAGCACATGG - Intergenic
1069924997 10:71843254-71843276 CCAAGAAGGAAGGGGCCAGAAGG + Intronic
1070662380 10:78316573-78316595 CCAGCAGCCAAGAGGGCAGATGG - Intergenic
1071530833 10:86389588-86389610 CCAGGAAACAGGAGGGGACATGG + Intergenic
1072305903 10:94106982-94107004 CCAAGGAAGCAGAGGGGAGAGGG - Intronic
1073060396 10:100730266-100730288 TAAAGAAACAAGAGCGAAGAGGG - Intergenic
1073563038 10:104513106-104513128 GCAAGAAAGAAGATGCCAGAAGG - Intergenic
1074206865 10:111290308-111290330 GTCAGAAAGAAGAGGGCAGAGGG + Intergenic
1075442098 10:122488100-122488122 CGAAGAAACACGAAGGCAAAGGG - Intronic
1075443193 10:122495206-122495228 CACAGAAACAAGAGGGGAGCTGG - Intronic
1075518913 10:123132402-123132424 CAAGGAGCCAAGAGGGCAGAAGG - Intergenic
1076047605 10:127307369-127307391 CCCAGAGAGAAGAGGGCAGGCGG - Intronic
1076082032 10:127591011-127591033 CCAATAAACAATTGGGAAGATGG + Intergenic
1076270040 10:129144357-129144379 CCAGGAAGGAAGGGGGCAGATGG + Intergenic
1076467666 10:130696159-130696181 CCAAGAAACAAAAAAGCAGCTGG - Intergenic
1076570562 10:131429955-131429977 CAAAGGCACAAGAGGGCCGATGG + Intergenic
1076582454 10:131520657-131520679 CCACGAAACACGAGGGAGGAGGG + Intergenic
1077428936 11:2505214-2505236 CAAAGAAAAAGGGGGGCAGAGGG - Intronic
1078086916 11:8239430-8239452 CTAAGTAAAAAGAGGGCACAGGG + Intronic
1078155601 11:8797476-8797498 GGAAGAAAGAAGAGGGAAGAAGG - Intronic
1078986303 11:16603154-16603176 CCTAGAAACAAGGGGGGAGGAGG + Intronic
1079441204 11:20516446-20516468 AAAAGAAAAAAGAAGGCAGAAGG + Intergenic
1079749384 11:24178080-24178102 ACAGGAAACAAGAGGGAAAAAGG - Intergenic
1080783917 11:35457326-35457348 CTAAGAACCAAGAGTGCTGAGGG - Intronic
1080983350 11:37432330-37432352 GAAAGAAAGAAGAGGGGAGAGGG + Intergenic
1081283731 11:41243626-41243648 CCAGGAAACAGAAGGGCAAAAGG - Intronic
1082739233 11:56892037-56892059 CCCAGAAATCAGAGAGCAGAGGG + Intergenic
1082796487 11:57381531-57381553 GGAAGAAACAAGAGGGGAAAGGG + Intergenic
1084760571 11:71268146-71268168 CCAGGGAACAACAGGGCAGTAGG - Intergenic
1085033618 11:73287433-73287455 CCAAGACTCTAGAGGGGAGAAGG + Intronic
1085650946 11:78268065-78268087 CCAAGCAACCAGTGGGGAGAAGG + Intronic
1086740222 11:90358580-90358602 CCAAGAAACAAGAGAGCCAGTGG + Intergenic
1087323722 11:96695973-96695995 TCATGATACATGAGGGCAGAAGG + Intergenic
1088156137 11:106805734-106805756 CAAAGAGAAAAGATGGCAGACGG + Intronic
1088786302 11:113185223-113185245 CCAAGAACCAAGAGAGCAGATGG + Intronic
1089256226 11:117195719-117195741 CCCAGGAGCAAGATGGCAGATGG + Intronic
1089522863 11:119077228-119077250 TCATAAAACAAGAGGGGAGATGG - Intronic
1089786503 11:120911109-120911131 GCATGAAACAAGCGGGCAGGAGG + Intronic
1089966888 11:122660616-122660638 CCCAGAAACCAGAGGTCAGCAGG - Intronic
1090052118 11:123388710-123388732 CAAACAAAGAAGAGGTCAGAGGG + Intergenic
1091198538 11:133752664-133752686 ACTAGAAACTAGGGGGCAGACGG + Intergenic
1091222276 11:133936542-133936564 CCAGAAATCAAGAGGGCAGCTGG + Intronic
1091342007 11:134823311-134823333 CCCAGGGACAAGGGGGCAGAGGG + Intergenic
1092193636 12:6536471-6536493 CTAAGAGACAAGAGGCAAGAAGG - Intronic
1092285784 12:7128638-7128660 CCAAGAAGCAGGAAGGAAGAGGG + Intronic
1093141660 12:15516741-15516763 ACTAGAAAGAAGAGGGCAGGGGG - Exonic
1093388924 12:18593389-18593411 CCAAGAAAATAAAAGGCAGATGG - Intronic
1096117328 12:49062510-49062532 CCAAGAAACAAGTTGGAAAATGG + Intergenic
1096444473 12:51676760-51676782 CTAATCAACAAGAGGGCAGCTGG - Intronic
1096812581 12:54181051-54181073 CCAACAATGAAGAGGGAAGAGGG + Intronic
1097593285 12:61597788-61597810 CCAAAAAACAAAAGGGAAGATGG - Intergenic
1097894624 12:64812245-64812267 CCAAGAAACAAGAAGTAAAAGGG - Intronic
1098323024 12:69268581-69268603 TTAAGAGTCAAGAGGGCAGAAGG - Intronic
1098880095 12:75908275-75908297 CCAAGAAAGAAGAGCTCAAAAGG + Intergenic
1099781110 12:87196555-87196577 CCAAGAAGCATGAGAACAGATGG - Intergenic
1100508387 12:95243464-95243486 CCAAGAAAAAAGATGGGGGAGGG - Intronic
1100554001 12:95673810-95673832 CCATGAAACAAGGCAGCAGAGGG - Intronic
1100857145 12:98767380-98767402 CCAAGAAAGCACAGGGAAGAGGG + Intronic
1101594615 12:106153121-106153143 CCAAGGACCCTGAGGGCAGATGG - Intergenic
1101862520 12:108494642-108494664 CTAAGAACCAAGAGAGCTGATGG + Intergenic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1103625532 12:122215977-122215999 TGAAGAAACTAGAGGGCAGATGG - Intronic
1104048558 12:125181334-125181356 CCAAGAAGGAAGAGGGAAGAGGG + Intergenic
1104074676 12:125378558-125378580 CCAAGAAGCAAGATGGCAGCAGG + Intronic
1104996591 12:132661685-132661707 CTGAGAAACAAGAGTGAAGAGGG + Intronic
1106748252 13:32727881-32727903 CCAGAAAACAACAAGGCAGATGG - Intronic
1107055948 13:36103585-36103607 CTTAGAAACAAAAGGACAGATGG - Intronic
1109558677 13:64017546-64017568 AAAAGAAAGAAAAGGGCAGAGGG - Intergenic
1109671585 13:65615163-65615185 GCTAGAAACAAGAGCCCAGATGG + Intergenic
1110179025 13:72593214-72593236 TGAAGAAACAAGAGGCCACAGGG + Intergenic
1110613875 13:77519906-77519928 CAAAGAAACAAGAAGGCTGGAGG + Intergenic
1110643587 13:77854940-77854962 GCAAGGGACAAGAGGGCAGGAGG + Intergenic
1110863304 13:80367478-80367500 GCAAGAGACAGGAGGGCAGAAGG + Intergenic
1110984997 13:81956316-81956338 CCCTGAATCATGAGGGCAGAGGG - Intergenic
1112722676 13:102262472-102262494 CCAAGAAACACAAGGTTAGAAGG - Intronic
1113813637 13:113157320-113157342 CCAAGCTCCAGGAGGGCAGAGGG - Intergenic
1114230256 14:20775013-20775035 CCAAGAACCAAAGGGGTAGAAGG - Intergenic
1115599095 14:34938508-34938530 CAAAGAAAAAAAAGGGCAGGGGG - Intergenic
1116030517 14:39565575-39565597 CCTAGAAAACAGAAGGCAGATGG - Intergenic
1116116802 14:40663064-40663086 CCAACGAAGAAGGGGGCAGATGG - Intergenic
1116501963 14:45634522-45634544 CGAAGAAAGAAGAGGGGAGAGGG - Intergenic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1116631733 14:47344107-47344129 CCAAGAATAAAGAAGGCAGAAGG - Intronic
1116759955 14:48999739-48999761 CCAGGAAACAGGAAGGAAGAGGG - Intergenic
1118391892 14:65302904-65302926 ACAAGAATAAAGAGGGCAGAAGG + Intergenic
1118436869 14:65779573-65779595 CAAGGAAAAAAGAAGGCAGAAGG + Intergenic
1118719728 14:68585542-68585564 GCAACAAACTAGAAGGCAGAAGG + Intronic
1119085093 14:71731991-71732013 CCCAGAGATAAAAGGGCAGAAGG + Intronic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1121015012 14:90543860-90543882 CCAACAGGCAAGAGGGCAGCAGG + Intronic
1121179536 14:91918375-91918397 CCAAGAAACAAGAGGGCAGAAGG + Intronic
1123792328 15:23734265-23734287 AGAAGAAAGAAGAGGGAAGATGG + Intergenic
1124432691 15:29620706-29620728 CAAAGAAATAAGTGGGAAGAAGG + Intergenic
1124457803 15:29860273-29860295 CCAGGGAACAGGAGTGCAGAAGG - Intronic
1125637728 15:41203503-41203525 CCAAGAGACAGCAGGGCTGAAGG - Intronic
1125845586 15:42850012-42850034 CCAAGCAACAGAACGGCAGAGGG + Intronic
1126882733 15:53116803-53116825 CGAAAAAACAAAAGGGGAGATGG - Intergenic
1126941830 15:53776030-53776052 CCGAGAAGCAAGAGGGAAGCCGG - Intergenic
1127455427 15:59152244-59152266 CCAACAAACAAAAAGGTAGATGG + Intronic
1129170512 15:73804614-73804636 CCAAGCAATTAGAAGGCAGAGGG - Intergenic
1129348518 15:74939727-74939749 GCAAGAGACAAGAGGGCAGAAGG - Intergenic
1130314533 15:82783876-82783898 AGAAGATGCAAGAGGGCAGAGGG + Intronic
1131008411 15:88997447-88997469 GCCAGAGACAAAAGGGCAGAAGG - Intergenic
1131034224 15:89210654-89210676 CAATGAGACAAGAGGGCTGAGGG - Intronic
1132925111 16:2425251-2425273 CCATGAAATAAGTGGGCAGGAGG - Intergenic
1134566438 16:15255878-15255900 CCCAGAAACAACAGAGAAGATGG + Intergenic
1134736058 16:16500821-16500843 CCCAGAAACAACAGAGAAGATGG - Intergenic
1134931466 16:18211349-18211371 CCCAGAAACAACAGAGAAGATGG + Intergenic
1135489927 16:22900325-22900347 CCAGGAAACAAAATGGCACATGG - Intronic
1136088436 16:27902057-27902079 CCAATAACCAGGAGGGCAGAGGG - Intronic
1136098405 16:27975241-27975263 CAGGGAATCAAGAGGGCAGAAGG - Intronic
1136300339 16:29329956-29329978 CTAAGAAACATGTGGTCAGATGG + Intergenic
1137264607 16:46858517-46858539 CTAAAAGACAGGAGGGCAGAAGG + Intergenic
1137348474 16:47687751-47687773 ACAACAAACAATAGGGGAGAAGG + Intronic
1137357649 16:47782059-47782081 ATTAGAAACAAGAAGGCAGAGGG + Intergenic
1137762293 16:50950459-50950481 CCCAGAAACCACAGGACAGAAGG + Intergenic
1137895744 16:52210323-52210345 TGAAGAAACAAAATGGCAGATGG + Intergenic
1138384786 16:56628769-56628791 ACAAGAAACAAGAGAGAAAAAGG - Intergenic
1138421087 16:56899678-56899700 CCAAGGAAAAAGGGGGCAGCCGG - Intronic
1138542330 16:57695960-57695982 GCCAGGAGCAAGAGGGCAGAAGG - Intronic
1140196389 16:72859045-72859067 CACAGAAGCCAGAGGGCAGAGGG - Intronic
1140279477 16:73541759-73541781 CCACCAAACAGGAGGGCAGGAGG - Intergenic
1141351451 16:83301720-83301742 GGAAAAAATAAGAGGGCAGAAGG - Intronic
1141413819 16:83854740-83854762 TCAAGAAAGAAAAGGGAAGATGG + Intergenic
1141431441 16:83972211-83972233 CCATGAAGCACGAGGACAGAAGG - Intronic
1141598610 16:85112246-85112268 CCAACAAAGATGAGGGCAGCAGG - Intronic
1143359265 17:6354650-6354672 AAAAGAAACAAGAAGGAAGAGGG + Intergenic
1143411215 17:6710354-6710376 ACATGAAACAAGAGGGGACAGGG - Intronic
1143857222 17:9860935-9860957 CCAAGAAACCAGGGCCCAGAGGG - Intronic
1146017711 17:29247123-29247145 CCAAGAAACGAGCAGGGAGAAGG + Intronic
1148444277 17:47728078-47728100 CCCAGGAGCAAGAGGGCTGAGGG + Intergenic
1148748041 17:49929319-49929341 CTCAGAAAGGAGAGGGCAGAAGG + Intergenic
1148876300 17:50689462-50689484 CCTAGAAACTAGAGGGGAGGAGG + Intronic
1149190863 17:54059777-54059799 CCAAGAAACGAGGTGCCAGAAGG + Intergenic
1149354115 17:55822130-55822152 CCAAGAAACAAAACGTGAGAAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151501997 17:74496150-74496172 CCAGGAAACAAAAGGGATGATGG + Intergenic
1151657152 17:75501461-75501483 CCAAGGAGCAAGAGGGGTGAGGG - Exonic
1152458236 17:80428097-80428119 CCAAGATAAAAGAGGGCGGTGGG - Intronic
1152673638 17:81624882-81624904 CCAATAAACAATAAGGAAGATGG + Intronic
1153530336 18:6039638-6039660 CCAGGAAACAGGATGGAAGAGGG - Intronic
1153640832 18:7155553-7155575 CAAAGAAAAGAGAGGCCAGAAGG - Intergenic
1155340852 18:24812688-24812710 CACAGAGAGAAGAGGGCAGAAGG - Intergenic
1158380102 18:56920142-56920164 CCAGGAAATAAGAGGGAACATGG - Intronic
1158735101 18:60070553-60070575 CTAAGAAACACCAGGGGAGAAGG - Intergenic
1159039253 18:63307810-63307832 TGAAGAAACAAGAGGGAGGAAGG + Intronic
1160368671 18:78351910-78351932 CCAAGAATCATGAGGGTAAATGG + Intergenic
1160402899 18:78623891-78623913 TCAAGAAGCAATAGGGCGGAGGG + Intergenic
1160663257 19:311294-311316 TCAAGAAGCCACAGGGCAGAGGG + Intronic
1162567445 19:11451956-11451978 CCAAGAGACAGCAGGGGAGAGGG + Exonic
1163259935 19:16182932-16182954 ACAAGAAAAAGGAGGGCACAGGG - Intergenic
1163325351 19:16599991-16600013 TCAGGCACCAAGAGGGCAGAGGG - Intronic
1164462080 19:28457531-28457553 ACCAGAAGCCAGAGGGCAGAGGG + Intergenic
1164620025 19:29689860-29689882 CCAAGAGAGAAGAGGTTAGAGGG + Intergenic
1164787544 19:30945521-30945543 GCAAAAAAGAAGAGGGAAGAGGG - Intergenic
1165245116 19:34494175-34494197 ACAGGAAACATGGGGGCAGATGG + Intronic
1166206862 19:41275778-41275800 CTAAGAAAGAAGCAGGCAGAGGG - Intronic
1167195025 19:48022605-48022627 CCCAGAAGCAGGAGAGCAGAGGG + Intronic
1167478298 19:49713343-49713365 CTGAGAAACAAGAGGGCTAAGGG - Intronic
1168113127 19:54206222-54206244 CCAAGAAGCCTGAGGTCAGAAGG + Intronic
1168231936 19:55038202-55038224 CCAAGACAGAAGAGGGCGGTCGG + Exonic
925159043 2:1669872-1669894 TGAAGAAACAACAGGGCAAAAGG - Intronic
925305771 2:2847124-2847146 CCATGAAAAATGAGGCCAGAGGG - Intergenic
925620634 2:5789220-5789242 AGAAGAAACATGAGTGCAGAAGG + Intergenic
927972219 2:27312875-27312897 CTAAGAAAAAAGAGGGCGGCAGG + Intronic
929670979 2:43876265-43876287 CCAAGAGGCAAAAGGGCAGAGGG - Intronic
929867593 2:45731395-45731417 CCAAAAAAGAAGTGGGGAGATGG + Intronic
930207642 2:48603940-48603962 CCAAAAAAAAAGGGGGCTGAAGG - Intronic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
932578738 2:72979249-72979271 ACCAGAATCAAGAAGGCAGAGGG + Intronic
932653745 2:73588537-73588559 CCAAGAAACAGAACTGCAGAAGG - Intronic
933741232 2:85536047-85536069 TCAAAAAAAAAGATGGCAGAAGG - Intergenic
935084518 2:99831829-99831851 ACACAAAACAAGAGGGTAGAAGG - Intronic
936260976 2:110959390-110959412 CCAAGAAAAACAAAGGCAGACGG - Intronic
936713924 2:115162504-115162526 AAAAGAAACAAGAAAGCAGAGGG - Intronic
940287717 2:152048874-152048896 AAAAGAAAGAAGAGAGCAGATGG + Intronic
940724572 2:157321732-157321754 CCAGGAAATAAGAAGACAGAAGG - Exonic
941677833 2:168362967-168362989 GAAAGAAACAGGAGAGCAGAGGG + Intergenic
941947617 2:171117100-171117122 CCATGAAAAAAGAGGGAAGGTGG + Intronic
942166695 2:173247716-173247738 CTAATAAATAAGAGGGCAGGAGG + Intronic
942370518 2:175279468-175279490 CTAAGATCTAAGAGGGCAGAAGG - Intergenic
942936311 2:181561071-181561093 CCAAAAGACAAGAGGGTATAAGG - Intronic
944895996 2:204165444-204165466 TCATGAAACAAGAGGACAGATGG - Intergenic
944937578 2:204585136-204585158 CAAGAAAACAAGAGGGAAGAGGG - Intronic
945507577 2:210660127-210660149 CAATGAAGCAAGAGGACAGAAGG + Intronic
946546195 2:220746766-220746788 CCAAGAAATACGATGGCTGATGG - Intergenic
946826983 2:223689306-223689328 CCAAGAAACAAGGGGGCCAATGG - Intergenic
948548805 2:238753651-238753673 AGAAAAAACAAGAAGGCAGAAGG - Intergenic
949053515 2:241910937-241910959 CCCAAAAACAAGATGGCAAAGGG + Intergenic
1170277970 20:14614194-14614216 CCAAGAAATGAAAGGGCAGAAGG - Intronic
1172029338 20:31970458-31970480 CCAAGAAACCATAGAGCTGAGGG - Intronic
1172242054 20:33419659-33419681 CAAAGGAAAAAGAGGGGAGATGG - Intronic
1172577681 20:36021860-36021882 CCAAGGAACAGGAGGGCAGCTGG + Intronic
1173475574 20:43356772-43356794 CCCAGAAGCTGGAGGGCAGAGGG - Intergenic
1173896712 20:46556673-46556695 CCAAGAAAAAAGTGGACAAAAGG - Intergenic
1174960668 20:55153709-55153731 GCAAGAAAGAAGAAGGAAGAAGG - Intergenic
1175610495 20:60347376-60347398 CAAGGAAACAAGAGGGCCCAGGG + Intergenic
1176177971 20:63737574-63737596 CCTAGAACCCAGAGGGCAGGAGG - Exonic
1177036006 21:16043717-16043739 CCAAGAACCAGGGGAGCAGATGG + Intergenic
1177089058 21:16743398-16743420 CTATGAGAAAAGAGGGCAGATGG - Intergenic
1177116098 21:17088641-17088663 AAAAGAAACAAGATGGCAAAAGG - Intergenic
1177166012 21:17604444-17604466 CCAAAAAAAAAGAGGAGAGAGGG + Intronic
1178622571 21:34189400-34189422 CCAAGAACCAAGAGAGCTGATGG - Intergenic
1178683026 21:34689142-34689164 GGAAGAAACAAGAGGGCTGTTGG - Intronic
1178814124 21:35911944-35911966 CCAAGAAGCAAGAAGGCAAATGG + Intronic
1179055261 21:37925929-37925951 CCAATAACCAATAGGGCAAAGGG - Intergenic
1179228410 21:39476932-39476954 CCAATAAACAGAAGGGGAGACGG + Intronic
1179814751 21:43898116-43898138 AAAAGAAAGAAGAGGGGAGAGGG + Intronic
1180671240 22:17555111-17555133 TCAAGGACCACGAGGGCAGAAGG - Intronic
1183232163 22:36589745-36589767 CCAAGATGCAGGAGGGCAGAGGG - Intronic
1184154398 22:42657742-42657764 CCAGGGAACAGGGGGGCAGAGGG - Intergenic
1184238684 22:43200230-43200252 CCAAGAAGCAAGCGGGCTGCTGG - Exonic
1185261377 22:49866274-49866296 CCCAGAAACAGGAGGGGACAGGG - Intronic
949587280 3:5454294-5454316 CCAAGGGAGAAGAGAGCAGAGGG + Intergenic
949820139 3:8107089-8107111 CTGAGAACCAAGAGAGCAGATGG - Intergenic
949981159 3:9502398-9502420 CCAGGGCACAAGTGGGCAGAGGG + Intronic
950393658 3:12716856-12716878 AGAAGAAACAAGAAGGAAGAAGG + Intergenic
952650913 3:35725638-35725660 CCAGGAAAGGACAGGGCAGAAGG - Intronic
953016673 3:39083436-39083458 CCAAGAAGCAAGAGGTGAGGGGG + Intronic
953033021 3:39190364-39190386 CCAAGAAATAAGAGGGTAGCAGG + Intronic
953377606 3:42441856-42441878 CCAAGCAGCAAGAGGGAGGAAGG + Intergenic
955037312 3:55281716-55281738 CCAAGAAAGAGGTGGGGAGAAGG + Intergenic
958526652 3:95269445-95269467 CCCAGATAGAAGAGGGCAGCAGG - Intergenic
958797640 3:98723197-98723219 CAAAAAAAAAAGAGGGGAGAGGG - Intergenic
959402562 3:105921304-105921326 CCAACAAACATCAGAGCAGAAGG - Intergenic
959502909 3:107127133-107127155 CCAAGAACCAGGAGTCCAGATGG + Intergenic
959519336 3:107307455-107307477 CTGAGAAACAGGAGGGCAGAAGG + Intergenic
959693526 3:109224646-109224668 CCAAGAAGCATGAGGTCACATGG + Intergenic
959742966 3:109742274-109742296 GCAAGAAACCAGACGGCAGCTGG - Intergenic
960556613 3:119036954-119036976 CTGAGAAGCATGAGGGCAGATGG + Intronic
960670761 3:120153650-120153672 CCAAGAAAACTCAGGGCAGAGGG - Intergenic
960931943 3:122861072-122861094 GGAAGAAAGAAGAAGGCAGAAGG - Intronic
961222899 3:125213510-125213532 CTGAGAAACAGGAGGGCAGCTGG + Intergenic
961581603 3:127887857-127887879 CTGAGAACCAGGAGGGCAGATGG + Intergenic
961945595 3:130683639-130683661 CCTAGAGGCAAGAGGGCTGAGGG + Intronic
962047049 3:131771519-131771541 AGAAGAAGCAAGAGGGGAGAGGG - Intronic
962479270 3:135784764-135784786 ACATGAGACAAGAGGGCAAAAGG - Intergenic
963056187 3:141188209-141188231 GCAAGTAATAAGAGGGCAGAAGG + Intergenic
963555331 3:146780134-146780156 CCAAGAAGAAAAAGGGCAGAAGG - Intergenic
963570456 3:146988456-146988478 CCAAGGAACAAGAAGGAATAGGG + Intergenic
964086970 3:152830738-152830760 GCAAGAAACAGGAGGCCAGCGGG - Intergenic
964150109 3:153514014-153514036 CAGAAAAACAAGAGGGCAAAAGG + Intergenic
964336370 3:155659139-155659161 CCAAGAAGCAATGGGGCTGAAGG + Intronic
964634339 3:158843730-158843752 CTGAGAACCCAGAGGGCAGATGG - Intergenic
965597525 3:170423141-170423163 CCTGGGAACAAGAGAGCAGATGG - Exonic
966645738 3:182244721-182244743 CTAAGAAACAAGAGGAAAGAAGG + Intergenic
968062795 3:195738989-195739011 CCAAGAAAGGAGAGGGCACCTGG - Intronic
968453050 4:684069-684091 CCCAGAAGGCAGAGGGCAGAGGG + Intronic
968698504 4:2043835-2043857 CAAAGCAACAAGAGGGGTGAGGG - Intronic
969090764 4:4692385-4692407 CCAAGAACCAGGAGGGCTGATGG + Intergenic
969284437 4:6194097-6194119 CCAAGGAGACAGAGGGCAGATGG + Intronic
970104696 4:12568413-12568435 ACAAGAGACAAGAGGAGAGAAGG - Intergenic
971412085 4:26384885-26384907 GCAAGAGGCAAGAGGGGAGAGGG - Intronic
971423413 4:26493819-26493841 CCAAGAACCAGAAGAGCAGAGGG + Intergenic
972252871 4:37323072-37323094 CAAAGAAACCAAAGGGCAGAGGG - Intronic
972785831 4:42326165-42326187 CCAAGAATCAAGTGGAGAGAAGG + Intergenic
974954178 4:68617952-68617974 ACAAGAGACAAAAGAGCAGAAGG + Intronic
975572057 4:75827902-75827924 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
976873696 4:89828581-89828603 CCATGAAACAAAAGGGAAGAAGG + Intronic
977550132 4:98433116-98433138 CCATGAGAAATGAGGGCAGATGG + Intronic
978841893 4:113224060-113224082 AAAAGAGACAAGAAGGCAGAAGG + Intronic
984583698 4:181538802-181538824 TCAAGAATCAAGAAGGCAAATGG - Intergenic
987365324 5:17143426-17143448 CCAAGAAACCAGAGGCCAGTAGG - Intronic
988944186 5:36178671-36178693 CAAAGAAGCAGGAGGCCAGATGG - Intronic
990561728 5:56990354-56990376 GCAAGAACCAAGTGGTCAGAGGG - Intergenic
991428747 5:66520451-66520473 CCAAAAAACACGTGGGAAGATGG + Intergenic
991544703 5:67768693-67768715 CAGAGAAACAAGTAGGCAGATGG + Intergenic
991997226 5:72400115-72400137 CCAAGAAAGAAGAGGAGAGAAGG - Intergenic
992282554 5:75196682-75196704 CCAAAGGACAAGAGGTCAGAGGG + Intronic
993116448 5:83725106-83725128 CCAGGAAACAAGTGCTCAGAGGG - Intergenic
993229180 5:85210124-85210146 CCAGGAAACCACAGGCCAGAAGG - Intergenic
994985357 5:106926526-106926548 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
995934017 5:117486444-117486466 GCAAGAAATCAGAGGGCAGGAGG + Intergenic
997455152 5:134011299-134011321 CCCATTAAAAAGAGGGCAGAGGG - Intergenic
997954206 5:138265647-138265669 GGAAGAAAGAAGAGGGAAGAAGG - Intronic
998506948 5:142679708-142679730 CCAAGGCCCAAGAGGGAAGAAGG - Intronic
998791655 5:145772186-145772208 CCAAAAAAAAAAAGGGGAGATGG - Intronic
999252704 5:150192020-150192042 CCTAGAGCCAACAGGGCAGAGGG + Intronic
1000473908 5:161680820-161680842 CCAAGAAAGAAGATGTCAGTAGG + Intronic
1000722833 5:164729829-164729851 TCAAGAGACAAGAGAGCTGAGGG + Intergenic
1001308560 5:170594208-170594230 CCAACAAAAATGAGGGAAGATGG - Intronic
1002859314 6:1066041-1066063 CCAAGAATGAAGAGATCAGACGG + Intergenic
1002987746 6:2207261-2207283 CCAAGAAACAGAAAAGCAGAAGG + Intronic
1005067063 6:21828766-21828788 CCAAAAAACAACAGAGCAAAGGG - Intergenic
1005248425 6:23915591-23915613 CAAAGAAGTAAAAGGGCAGAAGG - Intergenic
1005727489 6:28664107-28664129 CCACATAACAAGAGGTCAGAAGG - Intergenic
1006075346 6:31529062-31529084 CCAAGGACCAGGAGGGCAGAAGG - Exonic
1006854474 6:37123625-37123647 GCGAGAAACAGGAGGGCAGGAGG - Intergenic
1007158599 6:39770634-39770656 CCAAGACGCTAGATGGCAGATGG + Intergenic
1007267132 6:40605062-40605084 CCAAGTCCCAAGAGGGTAGAAGG - Intergenic
1007839746 6:44706088-44706110 CCAAGAAACACGAAGTGAGAAGG + Intergenic
1008371608 6:50738540-50738562 CCATGAAACAAAAGTCCAGATGG - Intronic
1009023384 6:57969255-57969277 CCAAGAAGCAAGAGAGCTGATGG - Intergenic
1009198956 6:60720789-60720811 CCAAGAAGCAAGAGAGCTGATGG - Intergenic
1009920218 6:70049557-70049579 ACTATAAACAAAAGGGCAGAAGG - Intronic
1010077902 6:71822297-71822319 CCAGGAGAAAACAGGGCAGAGGG + Intergenic
1011940483 6:92836489-92836511 CAAAGAAATAAAAGAGCAGAAGG + Intergenic
1012945484 6:105461285-105461307 TCGAGTACCAAGAGGGCAGAGGG + Intergenic
1015835656 6:137417492-137417514 CTAAGAAACTGAAGGGCAGAGGG + Intergenic
1015861871 6:137689787-137689809 CCAAGAAATATGAAGGCAAAGGG + Intergenic
1015885745 6:137916238-137916260 CCAACAAGCATGAGGACAGAAGG + Intergenic
1016016681 6:139193591-139193613 AGCAGAAACAAGAGGGCAGGTGG + Intergenic
1016128935 6:140441752-140441774 CCCAGAAACAAGAGAGAAGCAGG - Intergenic
1016760044 6:147726784-147726806 CCAAGAAAGAGGTGGGCGGAGGG + Intronic
1016792691 6:148082255-148082277 TGAAGAAACAAAAGTGCAGAGGG + Intergenic
1018242933 6:161795823-161795845 CCAAGAAACTATAGGGAAGTGGG + Intronic
1018361553 6:163075957-163075979 ACAGGAAACAAGAGCTCAGAAGG + Intronic
1018471201 6:164099935-164099957 CCAAGAGACAATAGAGCACATGG - Intergenic
1018858433 6:167692366-167692388 CAAAGAAACAAGTGGAAAGAGGG + Intergenic
1019053276 6:169200975-169200997 CCAAGAAAGAGACGGGCAGATGG + Intergenic
1020076474 7:5262094-5262116 GAAAGAAAGAAAAGGGCAGAGGG + Intergenic
1020341845 7:7119883-7119905 CCAGGAAAAAATTGGGCAGATGG - Intergenic
1020952622 7:14699662-14699684 CCAAGACACATGATGTCAGAAGG + Intronic
1021444847 7:20721540-20721562 ACAGGAAACAGTAGGGCAGAAGG - Intronic
1022417366 7:30189777-30189799 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
1023802454 7:43846633-43846655 ACTGGAAACAAGAGGCCAGATGG + Intergenic
1024532879 7:50407649-50407671 ACTAGAAACAGAAGGGCAGAAGG + Intergenic
1025021912 7:55486911-55486933 TGAAGAAACAGCAGGGCAGATGG - Intronic
1026123985 7:67563324-67563346 CAAAGACACAAGAGGGCACATGG + Intergenic
1027713858 7:81644228-81644250 ACAAGAAAGAAGAAAGCAGAAGG + Intergenic
1027775909 7:82463866-82463888 CCAAGGAACAAAAGAACAGAGGG - Intergenic
1028046973 7:86132537-86132559 ATAAGAAACAAGAGAGCATAGGG - Intergenic
1028246189 7:88480487-88480509 CCGAGAACCAGGAGAGCAGATGG - Intergenic
1028465489 7:91146850-91146872 CAAAGAAAAAAGGAGGCAGATGG - Intronic
1029364995 7:100111051-100111073 ACTGGAAACAAGGGGGCAGAGGG - Intronic
1029818534 7:103122429-103122451 CACAGACAAAAGAGGGCAGATGG + Intronic
1029885262 7:103863023-103863045 CCAAACACCAAGAGGGCAAAAGG + Intronic
1030094454 7:105885603-105885625 CCAAGTACCAAGTGAGCAGAGGG + Intronic
1030146210 7:106358780-106358802 CCAGGAACCAAGAGGGGTGATGG - Intergenic
1030905441 7:115175415-115175437 CCAAGAAACACAAGAGCAGTGGG + Intergenic
1032527698 7:132592207-132592229 CAAAGGAAGATGAGGGCAGATGG - Intronic
1032954485 7:136954816-136954838 TCAAGAGACAAGAGGACAGTTGG + Intronic
1033126884 7:138714318-138714340 ACAAGAAACAAGACTGGAGAAGG + Intronic
1033267174 7:139896338-139896360 CAAACTAACAAGAGGGCAGCCGG + Intronic
1033873715 7:145788590-145788612 CCAAGAAAGATGAAGGCACAAGG - Intergenic
1034016602 7:147594285-147594307 CCAAGATACCAGAGGGTAGCTGG - Intronic
1034244383 7:149633608-149633630 GCAAGGAAGAAGAGAGCAGATGG - Intergenic
1035339586 7:158151658-158151680 AAAGGAAACAAGAGGGAAGAAGG - Intronic
1035878834 8:3221572-3221594 CAAAAAAAAAAGAGAGCAGATGG - Intronic
1036688789 8:10928398-10928420 CCAAGAAACAACGAGGCAGATGG + Intronic
1037887663 8:22603366-22603388 AGAAGCAGCAAGAGGGCAGAGGG - Exonic
1038863726 8:31415742-31415764 CCAGGAAACAATGGAGCAGAAGG - Intergenic
1039764182 8:40610752-40610774 CAAAGAATCAAGAGGGCATGAGG - Intronic
1039828087 8:41191802-41191824 TCAGGAAACAGAAGGGCAGAAGG + Intergenic
1040300088 8:46183480-46183502 CAAAGAGACAACAGGGCAGCAGG - Intergenic
1040549097 8:48424670-48424692 CCATAAAACAGGAGGTCAGAGGG - Intergenic
1041847923 8:62352982-62353004 TCAAGTAACAAGAAGGCAGATGG - Intronic
1042011434 8:64249714-64249736 CGAAGAAACAAGTGGTCTGAAGG + Intergenic
1042077379 8:65011157-65011179 CCAAGAAAGAAAAAGGAAGAAGG - Intergenic
1042166494 8:65950862-65950884 TAAAAAAACAGGAGGGCAGAAGG + Intergenic
1043585713 8:81767706-81767728 CCAAGAAATAAGAAAGCATATGG - Intergenic
1045023476 8:98064376-98064398 CCAGGAGACAGGAGGGGAGACGG - Exonic
1045225050 8:100235835-100235857 CCAAAAAAAAAGAGGGCCGGCGG - Intronic
1045628667 8:104088339-104088361 AGAGGAAAGAAGAGGGCAGAGGG - Intronic
1046106270 8:109670848-109670870 TAAAGAAACAAGAGGGAAGGAGG + Intronic
1048511059 8:135063184-135063206 CCAAGAAAGAAGGGAGTAGAAGG - Intergenic
1048744481 8:137599044-137599066 CCATGGAACAAGGGAGCAGAGGG - Intergenic
1049041422 8:140114804-140114826 CCAAGAGACAAGAGGAGGGAGGG + Intronic
1049076537 8:140400798-140400820 CCAAAAAAGAAGAGTTCAGATGG + Intronic
1049617097 8:143580407-143580429 CCCAGAACCCAGAGGGCAGGGGG + Intronic
1049679661 8:143912369-143912391 CCAGGAAAGAAGCTGGCAGATGG + Intergenic
1049733909 8:144193124-144193146 CCCAGAAACAAAGGGGAAGAGGG + Intronic
1049924158 9:392787-392809 TCAAGAAACAAGAGGGGAATGGG - Intronic
1049956337 9:696402-696424 TTAGGAAACAAGAGGGAAGAAGG + Intronic
1050066316 9:1763520-1763542 TCAAGAACCAAGAGGGCATGGGG - Intergenic
1050452809 9:5801578-5801600 CCAAAAACCAAGAGGGAAAAAGG + Intronic
1051361504 9:16285457-16285479 CCAAGCACCAGGAGGGCTGATGG - Intergenic
1052184239 9:25571547-25571569 CCAAAATACAAGAGAGCAGGGGG - Intergenic
1054976973 9:71158925-71158947 CTGAGAATCAAGAGGGCTGAGGG - Intronic
1055875045 9:80932085-80932107 TCAAGAAAAAACAAGGCAGAAGG - Intergenic
1056341817 9:85642326-85642348 CAAAAAAAAAAGAGGGGAGATGG - Intronic
1056926629 9:90840007-90840029 TCAGGAAGCAGGAGGGCAGAAGG + Intronic
1058470106 9:105268964-105268986 ACAAGAAACAAGAGCACAAAAGG - Intronic
1058499965 9:105603324-105603346 CCAAGAAAGAAAAGGGAAGAAGG + Intronic
1060067215 9:120513234-120513256 CCAGGAAACAAGATGGGAAAAGG - Intronic
1060235866 9:121862319-121862341 CCAAGAAATAAAAGCACAGAAGG - Intronic
1060507495 9:124209068-124209090 CCAAAAAACAAAAGGCGAGAAGG - Intergenic
1060919540 9:127410161-127410183 CCCCAAAACAAGAGGTCAGAAGG - Intergenic
1185664060 X:1750381-1750403 TCAGGAAACAACAGGGCTGATGG - Intergenic
1186102378 X:6170820-6170842 CGAAAAAACAAAAAGGCAGAAGG - Intronic
1187049429 X:15680986-15681008 CCAATAACCTAGAGGGAAGAGGG - Intergenic
1187311397 X:18147065-18147087 TCAAGAAGCCAGAGGCCAGAGGG + Intergenic
1187395777 X:18917834-18917856 CCAAGCCAGAAGGGGGCAGAGGG + Intronic
1187487931 X:19722212-19722234 CCAAGTAATAAGAGGGCACTTGG - Intronic
1187650381 X:21396726-21396748 ACAAGTAACATGAGGGCATAGGG - Intronic
1187916578 X:24158452-24158474 ACAAGAAACAGGAGGCAAGAAGG - Intronic
1188064985 X:25648081-25648103 ACAAGAAACAAGAGTAAAGAGGG - Intergenic
1188261350 X:28028401-28028423 CAAAGAAAAAAGAGAGAAGATGG - Intergenic
1188310310 X:28609285-28609307 GAAAGAAACAAGAGGGTAAAGGG - Intronic
1188681356 X:33011406-33011428 TCAAGAAAGATGAAGGCAGAAGG - Intronic
1189107151 X:38248862-38248884 CCTAGACACAAGAAGGCTGATGG - Intronic
1189174755 X:38944880-38944902 CAAAGAAACAAGAGTGGAGGAGG - Intergenic
1189197461 X:39164366-39164388 CCAGGAAGCAGAAGGGCAGATGG + Intergenic
1189797106 X:44655680-44655702 CAAGGAAACAAGAGTTCAGATGG - Intergenic
1190947539 X:55110402-55110424 AGAAGAAACAAGAGGGATGATGG + Intronic
1191128664 X:56984983-56985005 CCAAAAAACAACTGGGAAGATGG - Intronic
1191883319 X:65863788-65863810 ACAAGATACAAGGGGGCAAAGGG - Intergenic
1192050587 X:67720642-67720664 GAAAGAGAGAAGAGGGCAGATGG - Intronic
1194423896 X:93712892-93712914 ACAAGAAAGAAGATGGGAGATGG + Intergenic
1195709449 X:107762295-107762317 CCAGGAGACAAGAGAGCTGAAGG + Intronic
1197835791 X:130692505-130692527 CCAAGAGTCAAGAAGGCAGTGGG - Intronic
1198209404 X:134502735-134502757 CAATGAACTAAGAGGGCAGATGG - Intronic
1198983120 X:142422117-142422139 GCCAGAAACAGGAAGGCAGAAGG - Intergenic
1199369422 X:147029118-147029140 CGAAGCAATAAGAGGGAAGAGGG - Intergenic
1200204099 X:154303551-154303573 CCAAGGAAGACGAGGGAAGAGGG - Intronic
1200690527 Y:6304033-6304055 GCTAGAAACAACAGGGAAGAAGG + Intergenic
1201044747 Y:9870683-9870705 GCTAGAAACAACAGGGAAGAAGG - Intergenic
1201060108 Y:10037336-10037358 GCACAAAAGAAGAGGGCAGAGGG - Intergenic