ID: 1121181931

View in Genome Browser
Species Human (GRCh38)
Location 14:91935506-91935528
Sequence GAAAATGCAGAGATAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 0, 2: 0, 3: 57, 4: 535}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121181931_1121181937 13 Left 1121181931 14:91935506-91935528 CCCACCTCTATCTCTGCATTTTC 0: 1
1: 0
2: 0
3: 57
4: 535
Right 1121181937 14:91935542-91935564 TCTTTTCTACCAGATAGGAGAGG 0: 1
1: 1
2: 1
3: 10
4: 176
1121181931_1121181936 8 Left 1121181931 14:91935506-91935528 CCCACCTCTATCTCTGCATTTTC 0: 1
1: 0
2: 0
3: 57
4: 535
Right 1121181936 14:91935537-91935559 TCATTTCTTTTCTACCAGATAGG 0: 1
1: 0
2: 4
3: 41
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121181931 Original CRISPR GAAAATGCAGAGATAGAGGT GGG (reversed) Intronic
902494595 1:16861460-16861482 GAAAATGAAGAAATAAAGGTTGG - Intronic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
903018290 1:20375994-20376016 GAAAAGGCAGAGAAGGAAGTGGG - Intergenic
904099431 1:28011181-28011203 CATAATGCAGGGATAAAGGTTGG + Intronic
905065527 1:35178126-35178148 AAAAATCCAGAGATAAAGATTGG + Intronic
906282697 1:44565280-44565302 GAAAATGCAGGGAGGGAGGGAGG + Intronic
906366275 1:45212694-45212716 GTAAATGCAGGGATAGATTTTGG + Intronic
907755935 1:57310835-57310857 GAAAATACAGATAGAGAGATGGG + Intronic
907884865 1:58583627-58583649 GATAATGCAGAGAGAGAAGTTGG + Intergenic
908413879 1:63893378-63893400 GGAAGTGCAGAGATAGAGACTGG + Intronic
908475096 1:64479534-64479556 GAAAGGGCATAAATAGAGGTGGG + Intronic
908491719 1:64651032-64651054 GAAAATGTAGAAAGAGAGGTGGG - Intronic
908824130 1:68117082-68117104 GGAAAAGCAGGGATAGAGGGAGG - Intronic
909310675 1:74144023-74144045 TAAAATGCATAAATAGATGTTGG + Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
909769437 1:79402073-79402095 GAGAATGCAATGATAGAAGTGGG - Intergenic
909951157 1:81721995-81722017 GAAAATGCAGAGATAGGACCAGG + Intronic
910265088 1:85330140-85330162 GAACATGCAGAGAAAGATGCAGG + Intronic
910684926 1:89906461-89906483 GAAAAGGCAGAGTCAGGGGTGGG - Intronic
910849819 1:91639216-91639238 GAATATGCAGTGAAAGGGGTTGG - Intergenic
911203006 1:95065464-95065486 GATAATGGAGAGATAGGAGTAGG + Intronic
911263269 1:95712561-95712583 GAAAATAGAAAGAAAGAGGTGGG - Intergenic
911666216 1:100556219-100556241 GAAGATGCAGAGAGAGAGATTGG - Intergenic
913533436 1:119749371-119749393 GGAAAGGGAGAGAGAGAGGTTGG - Intronic
915014112 1:152717483-152717505 GAAGATGTAGAAAGAGAGGTGGG - Intergenic
915464748 1:156090388-156090410 CAAAAGGCAGAGAGAGGGGTGGG + Intronic
915640510 1:157220577-157220599 GAAGATGAAGACAGAGAGGTGGG - Intergenic
915872815 1:159579505-159579527 AAAAATGCAGATATTGGGGTAGG - Intergenic
915928895 1:160046082-160046104 GAAAGTGCAGGGGTAGAAGTGGG - Intronic
916059824 1:161090623-161090645 GTAAATACAGAGATAGACGTGGG + Intergenic
916483436 1:165235860-165235882 GAAAATGCAGATAAAGAGCCCGG - Intronic
917433348 1:174994423-174994445 GACAAACCAGAGATGGAGGTAGG - Intronic
918220791 1:182434581-182434603 GAAATGGCAGAGAGAGGGGTGGG + Intergenic
918879304 1:190094927-190094949 GAAAATGCAGAAATAGCTGATGG - Intergenic
919163001 1:193855741-193855763 GAACATACAGAAATAGGGGTGGG + Intergenic
919381719 1:196868877-196868899 GAAGAAGCAGAGATAAAGGCCGG - Intronic
919930827 1:202220573-202220595 GAAAATGGAGACTTAGAGATGGG + Intronic
920516042 1:206585278-206585300 GAAACTGGAGAGGTAGAGGTAGG + Exonic
920778624 1:208966107-208966129 GAAAATGCAGAGAATGCAGTAGG + Intergenic
920979722 1:210821995-210822017 ATAAATGAAGAGATAGAGCTGGG - Intronic
921712843 1:218389978-218390000 GCAAATGAAGATATAGAGATGGG - Intronic
923402839 1:233631843-233631865 TTAAATGCAGAGGTAGAGGGAGG + Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
923448497 1:234094660-234094682 GAAACTGTAGAGATAGAGAGGGG - Intronic
924209649 1:241751412-241751434 GAAGATAGAGAGATAGAGGTTGG - Intronic
924274098 1:242367648-242367670 GAATACGCAAACATAGAGGTGGG + Intronic
924673461 1:246151916-246151938 GAAAATGGAGAAATAGAAGAAGG + Intronic
1063903764 10:10762416-10762438 GAAGAAGTAGAGATATAGGTAGG + Intergenic
1064008448 10:11715940-11715962 GCAAAGGCAGAGAGGGAGGTGGG + Intergenic
1065136038 10:22671280-22671302 AACAATGCAGAGAAAGAAGTGGG + Intronic
1065695553 10:28376558-28376580 TTAAATGCAGGGATGGAGGTGGG - Intergenic
1066530383 10:36331763-36331785 AAAAAGGCAGAGATAAATGTGGG - Intergenic
1067011356 10:42716981-42717003 CAAAATCCAGAGAGAGGGGTAGG - Intergenic
1067184243 10:44013654-44013676 GAAGATGCAGAGATACAGAAAGG - Intergenic
1067306518 10:45069722-45069744 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
1067312235 10:45124859-45124881 CAAAATTCAGAGAGAGGGGTAGG + Intergenic
1068340353 10:55693641-55693663 GAAAATGAAGAAGTAGAAGTGGG + Intergenic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1070168474 10:73914994-73915016 AAGACTGCAGAGTTAGAGGTGGG + Intronic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1070803244 10:79255630-79255652 CAGAATGCAGAGACAGAGATAGG - Intronic
1071056421 10:81515298-81515320 GATAATGCAGAGATAGAAATTGG + Intergenic
1071283949 10:84127031-84127053 GAAAGGGCAGAGATGCAGGTAGG - Intergenic
1073024930 10:100480963-100480985 AAAAATCCAGAGTTAGAGGGAGG - Intronic
1073549486 10:104384664-104384686 GAAAATGCAGAGAAAAGGTTTGG + Intronic
1073964242 10:108970159-108970181 GAAAGTGCAGAGACAGAACTGGG + Intergenic
1076094796 10:127722422-127722444 GAAGATGTAGAGAAAGAGATAGG + Intergenic
1076567132 10:131406599-131406621 GAAGATACAGAGAAAGAGCTTGG - Intergenic
1077398728 11:2341519-2341541 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
1078286002 11:9956759-9956781 GGAAATGTAGAGATAAAGGTGGG + Intronic
1078287205 11:9969073-9969095 AAGAAAGCAGGGATAGAGGTGGG - Intronic
1078579777 11:12529383-12529405 AAACATACAGAGATAGAGGTGGG + Exonic
1079566053 11:21884444-21884466 GAAAATGGAGAGAGAGAAGGAGG + Intergenic
1079859860 11:25655356-25655378 TAAAATGCAAAGAAAGACGTTGG - Intergenic
1080751901 11:35158359-35158381 TGAATTGCAGAGATAGAGTTGGG + Intronic
1081119923 11:39254421-39254443 GGAAAGGCAGAGAGAGAGGGTGG + Intergenic
1081501849 11:43674796-43674818 GAAAATGCAGAAATTGAGTGAGG - Intronic
1082650327 11:55783207-55783229 GAAAAGGGAGAGAGAGAGGGAGG - Intergenic
1083556087 11:63629528-63629550 GAAAATGCAGGGATACAGAGAGG + Intronic
1083788412 11:64968110-64968132 GAGAATGAAGAGAGAGAGGAGGG + Intronic
1084194765 11:67518207-67518229 GAAGATGCTGAGATGGAGTTAGG + Intergenic
1086108277 11:83170231-83170253 GAAAAAACAGAGCTGGAGGTGGG - Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1087915271 11:103802899-103802921 GAATTTGAAGAGATAGAGTTGGG - Intergenic
1089445278 11:118547302-118547324 GAAAAAGCAGGGACAGAGGGCGG + Intronic
1089633350 11:119796939-119796961 GGAAAGGCAGCGACAGAGGTGGG - Intergenic
1089740391 11:120578253-120578275 GAACATGGAGGGATAGATGTGGG + Intronic
1089827694 11:121293252-121293274 GAAAATGCAGTGTTTGATGTTGG + Intronic
1089914713 11:122142424-122142446 GACAGTGCAGAGATAGAATTGGG + Intergenic
1091962841 12:4713193-4713215 GAGAACTGAGAGATAGAGGTAGG - Intronic
1092206400 12:6616822-6616844 GAAAATCCAAAGATAGAGAAGGG - Intergenic
1093377026 12:18441926-18441948 AAAAATACACAGATAGACGTAGG - Intronic
1094051234 12:26222962-26222984 GCAAATTCAGAGAAAGAGATGGG - Intronic
1094439373 12:30457606-30457628 GAAAATCAAGAGAGGGAGGTAGG - Intergenic
1097521212 12:60672913-60672935 CAAATTGCAGAGATAGATGGTGG + Intergenic
1097673433 12:62569374-62569396 GAAAATTCAAAGATAGAGGAAGG + Intronic
1097853578 12:64438002-64438024 GAAAAAGCAGAACCAGAGGTAGG + Intronic
1098071051 12:66675182-66675204 GAAAAGACAGAGAGAGAGGGTGG + Intronic
1098342265 12:69464531-69464553 TATAGTGAAGAGATAGAGGTTGG + Intergenic
1099818091 12:87674231-87674253 GACATTGGAGATATAGAGGTAGG - Intergenic
1099855166 12:88155566-88155588 GGAAATGCAGGTATAAAGGTGGG - Intronic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1102164211 12:110793546-110793568 GCACTTTCAGAGATAGAGGTCGG - Intergenic
1102341797 12:112127177-112127199 GAAAAGACAAAGATAGAGGATGG - Intronic
1103835631 12:123818241-123818263 AAAAATAAAGAGATAGAGGCTGG - Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1106353946 13:28961174-28961196 GAAAATGAGGAGAAAGAGGATGG + Intronic
1106981338 13:35285852-35285874 GGAAATGAAGACAGAGAGGTAGG - Intronic
1107267984 13:38580097-38580119 GAAAAAGAAGAGATACATGTTGG + Intergenic
1107318539 13:39160805-39160827 GAAAAGGGAGAAAGAGAGGTAGG + Intergenic
1107321758 13:39196705-39196727 GAACATTCTGAGATACAGGTGGG + Intergenic
1108632094 13:52294800-52294822 AAAAATAAAGAGATAGAGGCCGG + Intergenic
1108654606 13:52517794-52517816 AAAAATAAAGAGATAGAGGCCGG - Intergenic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109460592 13:62652175-62652197 GTAGTTGCAGAGAAAGAGGTGGG - Intergenic
1110195320 13:72781959-72781981 GAAAATGCCGAGATAAACATTGG + Intronic
1110505481 13:76280936-76280958 GGAAATGAAGAGAAAGAGGCAGG - Intergenic
1111985783 13:95065778-95065800 GAATTTGCAGGGATACAGGTGGG - Intronic
1112002126 13:95220668-95220690 AAAAATGCACAGAGAGAGGAGGG + Intronic
1112587428 13:100731627-100731649 GAAAAGGCAGAGTTAGGGGCTGG - Intergenic
1113187176 13:107701586-107701608 GGAAATGGGGAGATAGATGTGGG + Intronic
1113214909 13:108028858-108028880 GACAATGCAGAGGTAGAAGTGGG + Intergenic
1113536192 13:111067816-111067838 GAAAATGTAAAAAAAGAGGTTGG - Intergenic
1114563776 14:23612924-23612946 GGAGATGTAGAGAGAGAGGTGGG + Intergenic
1115548631 14:34485852-34485874 GAAATTCCAGACATAAAGGTAGG - Intergenic
1115813321 14:37134113-37134135 CAAAATGGAGAGAGGGAGGTGGG + Intronic
1115824629 14:37254558-37254580 GAATAGGCAGAGACAGAGGTTGG - Intronic
1115902288 14:38165483-38165505 GAAACTGCAGGGATAGTGATTGG - Intergenic
1116544269 14:46143549-46143571 GAAATTGCTGAGATAGAGCAGGG + Intergenic
1116751964 14:48897808-48897830 GAAAATGAAGAATTGGAGGTTGG + Intergenic
1117669475 14:58092124-58092146 AAAAATGAACAGATTGAGGTGGG - Intronic
1117815390 14:59592744-59592766 CAAAATGCAGAGATAGGTTTGGG + Intergenic
1118063147 14:62162568-62162590 GAAAAAGAAGAGAAAGAGGAGGG - Intergenic
1119145883 14:72313643-72313665 GGAAATACAGACATAGAGATGGG - Intronic
1119159082 14:72438287-72438309 GAAAATGCAGAGAGAGAAGAGGG - Intronic
1119181629 14:72609298-72609320 GAAAAGGCAGCAAGAGAGGTGGG + Intergenic
1119184762 14:72632574-72632596 GAAAAAGGAGAGAGAGAGGAAGG + Intronic
1120679030 14:87457191-87457213 GATAACGCAAAGATAAAGGTTGG - Intergenic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1121918921 14:97862193-97862215 GAAAATGCAGAGGCCAAGGTGGG - Intergenic
1122005557 14:98700590-98700612 TGAAATGCAGAGATGGAGGAAGG + Intergenic
1202936108 14_KI270725v1_random:89046-89068 GAAACTGGAGTGATGGAGGTAGG + Intergenic
1123889129 15:24757752-24757774 GAACATGCAGAGATGGTGGAGGG + Intergenic
1123901689 15:24883504-24883526 GAGGATGCAGGGACAGAGGTTGG - Intronic
1125438578 15:39675458-39675480 GAAAATGCAGAAATAAATTTAGG + Intronic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1126222465 15:46230246-46230268 GAAGAAGCAGAGTCAGAGGTTGG + Intergenic
1128869802 15:71145805-71145827 GGAAATGGGGAGAAAGAGGTTGG + Intronic
1129283195 15:74502188-74502210 GGAGATGCTGAGATAGAGTTTGG + Intergenic
1129665626 15:77577983-77578005 GGACAGGCAGAGATAGAGGGAGG + Intergenic
1129938333 15:79470409-79470431 GCAAATCCAGAGCAAGAGGTTGG - Exonic
1129972249 15:79789049-79789071 GAAAGTGCATAGATTGAGGAGGG + Intergenic
1129972469 15:79790926-79790948 GAGGATGCAGAGACAGTGGTTGG - Intergenic
1130450840 15:84050213-84050235 GAAAATTCAGAGAGAAAAGTCGG - Intergenic
1130740816 15:86597827-86597849 GAAACTGGATAGATAGAAGTGGG + Intronic
1131305115 15:91235885-91235907 GGAGATGCAGAGATAGAGAGGGG + Intronic
1131527594 15:93164983-93165005 GAAAGTACAGAGGTAGAGGAGGG + Intergenic
1131589624 15:93734556-93734578 AAAAATGCAGCGATAGAAATGGG - Intergenic
1132389076 15:101425705-101425727 GAAAATGTAGGGATAGAATTTGG - Intronic
1133749739 16:8715096-8715118 GCAAATGTGGAGAAAGAGGTCGG - Intronic
1133922076 16:10162368-10162390 GAAAATGAATACAGAGAGGTTGG - Intronic
1135535601 16:23291875-23291897 ATAAATGCAGAGACACAGGTTGG - Intronic
1136605230 16:31329362-31329384 GAAAATGCAGAAACAGGGATGGG + Intronic
1137219786 16:46437289-46437311 GAAAATGGAGAGAGAAAGGAAGG - Intergenic
1137383897 16:48023814-48023836 GAGAGAGCAGAGAGAGAGGTGGG + Intergenic
1137413927 16:48254620-48254642 TAAAATTCAGAGATGGAGGCCGG - Intronic
1137433550 16:48437310-48437332 GAAGATGCAGAGCAAGAGGGGGG + Intronic
1138739859 16:59295498-59295520 GAAAAGGCAGAGCTGGTGGTGGG + Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1138870075 16:60872127-60872149 GAAGATGTAGAGTAAGAGGTAGG - Intergenic
1138884554 16:61060353-61060375 GAAAATTCAGATTTTGAGGTTGG + Intergenic
1139200908 16:64976125-64976147 ATAAATGCAGAGTTAGAGTTGGG + Intronic
1139540479 16:67611550-67611572 GTTAATGCAGAGAAAGTGGTTGG + Exonic
1139743450 16:69055283-69055305 GGAAAAGCAGAGATAGAGCTGGG + Intronic
1140468815 16:75203611-75203633 GAAAATGCAGAGAGGGAGGCGGG + Intergenic
1140545010 16:75799316-75799338 TAAAATGCAGTCATTGAGGTGGG - Intergenic
1140910149 16:79443638-79443660 GCAAATGCAGAGATTGGTGTGGG + Intergenic
1141472504 16:84248744-84248766 GGAAAGGCAGAGATCAAGGTTGG + Intergenic
1141933455 16:87220109-87220131 GAAAAGGCAGAGTTAGGAGTGGG - Intronic
1143171204 17:4931670-4931692 GAGAAGGCAGAGAGAAAGGTGGG + Intergenic
1143563460 17:7708404-7708426 GAAAAGCCAGAGGAAGAGGTTGG - Intronic
1143975208 17:10824414-10824436 CTAGATGCAGAGATAGAGGCAGG + Exonic
1144158211 17:12529024-12529046 TAAAATACAGAGATTGAGGCTGG - Intergenic
1144183251 17:12772043-12772065 GGAAATGGAGAGACAAAGGTAGG + Intergenic
1146106289 17:30040186-30040208 GAAATAGCAGAGAAAGAGCTTGG - Intronic
1146890546 17:36503831-36503853 GGAAATGAAGAGAAAGAGGCTGG - Intronic
1146949015 17:36892838-36892860 GAAAATGAAGAGTTGGAGTTTGG - Intergenic
1147221674 17:38936856-38936878 AAAAATGCATACATACAGGTTGG + Exonic
1148210201 17:45804033-45804055 GAAAATGCAGAAGTAGAGAGAGG - Intronic
1148758705 17:49988091-49988113 GAAAGGGCAGAGAGAGAGGAAGG - Intergenic
1148947981 17:51282458-51282480 GAAAATGAAGAGAAAGAGGAAGG + Intronic
1150197596 17:63317129-63317151 GATGATGCAGAGAAAGAAGTTGG - Intronic
1150432681 17:65131027-65131049 GGAAGTGCAGAGATAAAGGTTGG + Intergenic
1150543623 17:66130010-66130032 GAAAAAGAAGAGAAAGAAGTGGG + Intronic
1151257452 17:72889929-72889951 GAAAATGCATAGAGTTAGGTGGG + Intronic
1152507163 17:80757471-80757493 AAACAAGCAGAAATAGAGGTAGG - Intronic
1153266363 18:3273827-3273849 AAAAAGGCAAAGAAAGAGGTGGG + Intronic
1153449219 18:5208127-5208149 TAATGTGCAGAGATAGAGGATGG + Intergenic
1153683026 18:7518466-7518488 GAAAATGAAAAGAGAGAAGTGGG - Intergenic
1153822593 18:8844997-8845019 TTAAATGCAGAGGCAGAGGTAGG - Intergenic
1153888410 18:9489227-9489249 GAAAATGCAAAAATTGAAGTAGG + Intronic
1155440187 18:25854285-25854307 GAAATTGCAAATATGGAGGTAGG - Intergenic
1156375808 18:36514458-36514480 GAAGGTGCAGAGATAAGGGTGGG + Intronic
1156717276 18:40026424-40026446 GAAAAGGAAGAGACAGAGGAGGG - Intergenic
1157315018 18:46579705-46579727 AAAAAGGCAGAGATAGACGTTGG + Intronic
1159080771 18:63732948-63732970 GAAAAGGTAGAGAAAGAGATAGG + Intergenic
1159263790 18:66052078-66052100 GGAGATGAAGAGATAGAGTTGGG - Intergenic
1162616716 19:11807392-11807414 TAAAATGTAGAGATGGAGTTAGG + Exonic
1164828845 19:31304424-31304446 GAAGATGCAGAGGGAGAGGCAGG - Intronic
1164946479 19:32297590-32297612 AAAAAGGCAGAGATAGGTGTTGG - Intergenic
1165389101 19:35528139-35528161 AGCAATGCAGAGAGAGAGGTGGG - Exonic
1166501319 19:43343636-43343658 GACACAGCAGAGATAGATGTAGG + Intergenic
1166929517 19:46293542-46293564 AAAAATTAAGAGATAGAGGCCGG + Intergenic
1167389506 19:49185012-49185034 AAGAATACAGAGATAGAGGCAGG - Intronic
1167579123 19:50331667-50331689 GAAAGAGCAGAGACAGAGGAGGG - Intronic
1167609057 19:50497499-50497521 GAAGAGACAGAGATAGAAGTGGG + Intergenic
1167749428 19:51370935-51370957 GAAAATGAAGAGGGAGAGGCAGG - Intergenic
1168382545 19:55936318-55936340 GAAAATCCAGAAATAGGGCTGGG + Intergenic
925072609 2:983064-983086 GAAGTTGCAGAGGTGGAGGTTGG + Intronic
925072628 2:983216-983238 GAAGCTGCAGAGGTGGAGGTTGG + Intronic
925072633 2:983245-983267 GAAGTTGCAGAGGTGGAGGTTGG + Intronic
925072649 2:983351-983373 GAAGTTGCAGAGGTGGAGGTCGG + Intronic
925074061 2:997393-997415 GAAAATGAAGTGAGAGATGTAGG + Intronic
925178417 2:1800676-1800698 GTAAATGCAGAGGTTGAGGCTGG - Intronic
926357057 2:12050336-12050358 CAGAATCCAGAGATAAAGGTGGG + Intergenic
926465303 2:13179560-13179582 GAAGATGTAGAGCAAGAGGTGGG - Intergenic
926503367 2:13681477-13681499 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
926951683 2:18249945-18249967 GTAGATGCAGAAATAGAAGTAGG - Intronic
930409419 2:51005131-51005153 GAATATCCAGAGAAAGATGTAGG - Intronic
931051111 2:58415736-58415758 TCAAAGGCAGAGTTAGAGGTGGG + Intergenic
931344126 2:61430468-61430490 GACAATGCAGAGTTGGTGGTGGG + Intronic
931926279 2:67076001-67076023 TAAAATGCAGAGAGAGATTTTGG + Intergenic
931962539 2:67498282-67498304 GTAAGTGCTAAGATAGAGGTAGG - Intergenic
932259362 2:70314066-70314088 CAAAATGCTGAGATTGAGGCAGG + Intergenic
932781834 2:74563634-74563656 GAAAGAGCAGAGGGAGAGGTGGG + Intronic
935058583 2:99589112-99589134 AAATATGCAGAGATAGACATTGG - Intronic
935418368 2:102842243-102842265 AATAATGCAGAGAGGGAGGTAGG - Intronic
936754801 2:115694962-115694984 GAAATTGCAGATATAGAGGAAGG + Intronic
937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG + Intergenic
938237883 2:129721415-129721437 GCAACTGCAAAGAGAGAGGTGGG + Intergenic
938290692 2:130148377-130148399 GAAAATGCAGACAAAGAGGCAGG - Intergenic
938465852 2:131524576-131524598 GAAAATGCAGACAAAGAGGCAGG + Intergenic
938622854 2:133074887-133074909 GAAAATGAAAAGAAAGAGATTGG + Intronic
939104447 2:137932922-137932944 GAAAATGGAGACATAAAAGTTGG - Intergenic
939152298 2:138487318-138487340 ACAGATGCAGAGATACAGGTAGG - Intergenic
939534483 2:143410417-143410439 GAAAATGCTGACATAAAAGTGGG - Intronic
939685096 2:145189279-145189301 GAAAATGCCTAGATAGGGCTGGG + Intergenic
940166592 2:150780427-150780449 GAAAAGGCACAGACAGAGGAAGG - Intergenic
940457456 2:153918656-153918678 GAACATGCACAGATAGCTGTAGG - Intronic
940549633 2:155137428-155137450 GAAAATGCCTAGATAGAGATAGG - Intergenic
942372558 2:175300817-175300839 AAAAAAGCAGAGGAAGAGGTTGG + Intergenic
942394536 2:175533421-175533443 GAAAAGGAAGAGATAGACATGGG - Intergenic
942436141 2:175979118-175979140 GAAAATGGAGAGATACATTTGGG + Intronic
943438428 2:187896310-187896332 GAATAAGCAGAGATAGAGAGGGG + Intergenic
943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG + Intergenic
944413046 2:199460186-199460208 GAAAATGCACAGTTCGAAGTCGG + Intronic
944500561 2:200355080-200355102 GAAAAGGGAGAGATAGAGGAAGG - Intronic
945168617 2:206972460-206972482 GAAAAAGCACTGATAGAGTTTGG - Intergenic
945271425 2:207944184-207944206 GAAAAAGAAGAGTTAGAGGGAGG + Intronic
945295244 2:208163896-208163918 GAAACTGCTGAGATGGAGGTTGG + Intergenic
945594695 2:211777049-211777071 GTAAAGGCAGAGATGGAGGGAGG + Intronic
946201173 2:218071629-218071651 GAAAATGCTGAGATGGGGGATGG - Intronic
946547223 2:220757500-220757522 GGAAATGTAGAGATTGAAGTAGG - Intergenic
947184396 2:227442045-227442067 CAAAATTCACAGATACAGGTCGG - Intergenic
947788282 2:232844507-232844529 GATGATGCAGTGAAAGAGGTGGG + Exonic
948127734 2:235577014-235577036 GAAGATGCAGAGGTAGAGTTTGG - Intronic
1169939234 20:10919151-10919173 AAAAATGCAGGGAGAGAGATTGG + Intergenic
1170180763 20:13527335-13527357 GAAATTGGAGAGAGAAAGGTAGG + Intronic
1170363679 20:15576397-15576419 GGAGATGCAGAGATAGAGGAAGG - Intronic
1171779569 20:29407166-29407188 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1171820728 20:29835737-29835759 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1171823024 20:29872968-29872990 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1171897091 20:30817422-30817444 GAAGATGTAGAGAAAGAGGCAGG - Intergenic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1172359171 20:34300419-34300441 GAAAGTGGAGAGATGGAGGAGGG - Intronic
1172752687 20:37261833-37261855 GAAAATGAAGAGATAAATGATGG - Exonic
1173046428 20:39517170-39517192 GTAAGTGCAGAGACAGATGTGGG - Intergenic
1173262781 20:41451478-41451500 GAAAAGGCACAGACAGAGGTGGG + Intronic
1173917348 20:46717805-46717827 GAAAATGCAGACACTGAGGAGGG + Intronic
1177107732 21:16980643-16980665 GAAAATGCAGAGTCAGACCTTGG - Intergenic
1177256192 21:18665639-18665661 GAAAATGATGAGATTGAGTTTGG + Intergenic
1177882954 21:26715973-26715995 GAAATTGCAGAGATGAAGGAGGG + Intergenic
1177889992 21:26793562-26793584 GAGAATGCGGAAATGGAGGTAGG + Intergenic
1178250948 21:31002962-31002984 GAAGTTCAAGAGATAGAGGTGGG - Intergenic
1178446556 21:32648869-32648891 AGAAATGCAGAGAGAGAAGTAGG - Intronic
1178810943 21:35880819-35880841 GAAAAAGCAGAGACAGAGTCTGG - Intronic
1179247923 21:39649473-39649495 GAAAAGCCAGAGCTGGAGGTAGG + Intronic
1179965220 21:44800909-44800931 GAAACTGCAGAGACAGAGAGAGG + Intronic
1180116203 21:45706914-45706936 GAAACTGCTTAGAAAGAGGTTGG + Intronic
1180280457 22:10688726-10688748 GAAACTGGAGTGATGGAGGTAGG + Intergenic
1180324767 22:11360682-11360704 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1180673663 22:17572322-17572344 AAAAATACAGAAATATAGGTGGG + Intronic
1181673858 22:24439396-24439418 GGCAATGCAGAGATGGATGTAGG + Intronic
1182593913 22:31403370-31403392 GAAAATGCAGAGAAAGGGCCGGG + Intronic
1182680302 22:32074257-32074279 GAGAAGGCAGGGAGAGAGGTTGG - Intronic
1182809208 22:33102023-33102045 GGAAATGGAGAGAAAGAGGCAGG - Intergenic
1183649837 22:39147535-39147557 GAAAAAGCTGAGAAAGAGGGTGG - Intronic
1183703529 22:39463188-39463210 GAGAATGCATAGAAAGTGGTTGG - Intronic
1184404397 22:44291947-44291969 GAGACTGCAGAGAGAGGGGTGGG - Intronic
1184608221 22:45586429-45586451 GACAATGCAGCCAGAGAGGTTGG + Intronic
1184671438 22:46013995-46014017 GAAGATGCGGAGATAGAGGGAGG - Intergenic
949610902 3:5702463-5702485 GATATAGCAGAGAGAGAGGTTGG + Intergenic
949653083 3:6183729-6183751 GAACTTCCAGAAATAGAGGTTGG - Intergenic
950310531 3:11953990-11954012 GAACTTGCAGAGATGGATGTAGG + Intergenic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
950896453 3:16455976-16455998 GATAATGCAGAGACGGGGGTGGG - Intronic
951584446 3:24201144-24201166 GAAAATGAAGAGAAGCAGGTAGG + Intronic
951688850 3:25374371-25374393 GAAAATCTAAAGATATAGGTAGG + Intronic
952025220 3:29072411-29072433 AAAAAGGGAGAGAAAGAGGTAGG - Intergenic
952025808 3:29080506-29080528 GAAGATGCACAGCTAGAGGCTGG + Intergenic
952347124 3:32498559-32498581 TGAAATGGAGAGATAGAGGCAGG - Intronic
952501922 3:33971015-33971037 GAAATTGGAGAGTCAGAGGTAGG + Intergenic
952533996 3:34291162-34291184 AAAAATTCAGAGAAAGAGATTGG + Intergenic
953083694 3:39646083-39646105 GATAAGGAAGAGATGGAGGTTGG - Intergenic
953817294 3:46169948-46169970 AGAAATGCAGACACAGAGGTAGG - Intronic
955362007 3:58283697-58283719 GTTAATGCAGAGATGGAGGTTGG + Intronic
955540748 3:59973451-59973473 GTGAAGGCAGAGACAGAGGTTGG - Intronic
955629397 3:60956461-60956483 GAAAAAGCACAGCTAAAGGTAGG - Intronic
957006894 3:74959198-74959220 AAAAATGGAGAGAGAGAGGAAGG + Intergenic
957085566 3:75673443-75673465 GAAGATGTAGAGACAGAGGCAGG - Intergenic
957467945 3:80620332-80620354 GCAAATGCAGAAATTGAGGCTGG + Intergenic
957916047 3:86689044-86689066 GAAAATGCAGGGATTGAGAAAGG + Intergenic
957977019 3:87459646-87459668 GAACATGCAGAAATGGAAGTTGG + Intergenic
958513589 3:95081954-95081976 GAAGTTGGAGAGATAGGGGTTGG - Intergenic
958623750 3:96598415-96598437 GAAAATGGAGAGGTAGGGCTTGG - Intergenic
959356212 3:105332426-105332448 GAAAATATAGAGAAAGAGCTTGG + Intergenic
959479254 3:106851443-106851465 GAAAATGGAGATATACATGTAGG + Intergenic
961338765 3:126203280-126203302 GAAAATGCAGAGAAGGGGGCTGG + Intergenic
963444709 3:145389370-145389392 GAAAAGGCAGAGAAAGAGATAGG + Intergenic
963520184 3:146354101-146354123 GAAAAGGGAGATATAGGGGTGGG - Intergenic
964009964 3:151880854-151880876 GAGAATGCTGGTATAGAGGTTGG - Exonic
964650161 3:159002712-159002734 GTAAATGAAGACATAGAGGCAGG + Intronic
964696997 3:159520170-159520192 GAGAATGCAAAGACGGAGGTAGG + Intronic
965449868 3:168824540-168824562 GAAAACACAGATACAGAGGTTGG - Intergenic
966947339 3:184786233-184786255 CAAAATGCTGAGAAAGTGGTGGG + Intergenic
967499474 3:190181149-190181171 TAAAATTCAGAGCTATAGGTTGG + Intergenic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
969000400 4:3976172-3976194 GAAAATGCAGGGAAGGTGGTTGG - Intergenic
969559405 4:7937970-7937992 AAAAATGCTCTGATAGAGGTGGG - Intronic
969667986 4:8573197-8573219 GAAAATGTGAAGAAAGAGGTTGG - Intronic
969716446 4:8870466-8870488 GAAAAAGAAGAGAGAGGGGTTGG + Intronic
970118272 4:12723625-12723647 GAAAATGCAGAGAATGAGATGGG - Intergenic
970284469 4:14494662-14494684 GAAAATGCAGGGAAAGGAGTAGG + Intergenic
970327685 4:14944477-14944499 GAAAATACAGAGACAGAGATTGG + Intergenic
970727008 4:19059212-19059234 GAAAAAGCAGGGATTGGGGTTGG + Intergenic
970937231 4:21587502-21587524 GTAAATGAAGAGTTAGAGCTTGG + Intronic
971227540 4:24768942-24768964 AAAAATGCAGGGATAGACCTGGG + Intergenic
971665019 4:29472272-29472294 GAGGAAGCAGAGAGAGAGGTGGG + Intergenic
971693317 4:29866042-29866064 GGAAATGGAGAGTTGGAGGTGGG + Intergenic
971891613 4:32530641-32530663 GAGAAGGCAGAGAAAGAGATAGG + Intergenic
972037113 4:34539027-34539049 GACAATACAGGGATAGAGCTAGG - Intergenic
972211507 4:36843370-36843392 GCAGATGCTGAGATAGAGTTAGG - Intergenic
973263720 4:48189507-48189529 GAAAATGCAGAAATAGACAATGG + Intronic
973887989 4:55342100-55342122 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
974015663 4:56646651-56646673 CAAAATGAAGAGAAAGAGGGAGG - Intergenic
975567277 4:75771557-75771579 AAAATTGCAGAGGTAGAGTTTGG - Intronic
976858080 4:89628478-89628500 GAAGATGAAGAGGGAGAGGTAGG - Intergenic
978382272 4:108141858-108141880 GAACATGCAAAGATGGGGGTGGG + Intronic
978860383 4:113442093-113442115 CAAGTTGAAGAGATAGAGGTGGG - Intergenic
978919227 4:114162267-114162289 GAGAATGGAGAGAGAAAGGTTGG + Intergenic
979299390 4:119069277-119069299 GAACATATAGAGATAGAGATAGG + Intergenic
979571718 4:122234906-122234928 GAAAATGCAGAGCTACTGGAAGG - Exonic
979910743 4:126362882-126362904 GAAAAGGCAGAGCTAGATGAAGG + Intergenic
980267541 4:130537532-130537554 GAAGATGGAGAGACAGAGGTAGG + Intergenic
980919704 4:139070914-139070936 TAAAATGCAAAAATAAAGGTGGG - Intronic
981538836 4:145827291-145827313 GAAAAGGAAGAGATAGAGAAGGG + Intronic
982767344 4:159364265-159364287 GAAGATGCAGAGAAATTGGTTGG + Intergenic
982974183 4:162032458-162032480 GAAAATGCACAGAAATAGTTTGG + Intronic
983001219 4:162417383-162417405 GAGAATGGGGAGATAGAGGTAGG - Intergenic
985232118 4:187830324-187830346 GAGAATGAGGAGATAGATGTTGG - Intergenic
985444440 4:190014052-190014074 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
987116697 5:14731478-14731500 GAGAAGGCAGAGAGAGAGCTGGG - Intronic
987865622 5:23532522-23532544 GAAAATGTAGAGATAAATGAAGG - Intergenic
988085945 5:26475968-26475990 GAAAATGCAGTAACAGGGGTTGG + Intergenic
988533922 5:32049413-32049435 GATGAAGCAGAGATAGAGGACGG + Intronic
989380837 5:40808145-40808167 GGAAAGGCAGAGAAAGAGGACGG + Intergenic
990755223 5:59061498-59061520 GACAATGTACACATAGAGGTGGG - Intronic
990790302 5:59470218-59470240 GAAACTGCAGGGACAGAGATAGG + Intronic
991327988 5:65459172-65459194 GAAAATGTAGAGAAACAGGCCGG - Intronic
991544917 5:67770976-67770998 GAAAATGGTGAGTTAGAGGAAGG - Intergenic
992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG + Intergenic
993188533 5:84651429-84651451 GAAAATGCAGGTAGAGAGGAAGG - Intergenic
993622371 5:90183828-90183850 GAAAATGTAGAGATGTAGATTGG - Intergenic
993799437 5:92313713-92313735 GAACATGGAGAGAGAGAGCTTGG - Intergenic
993913822 5:93717282-93717304 GAAAATGCTGAGAATGAGGTAGG + Intronic
994926527 5:106122918-106122940 GAAGATGCAGAGAAAAGGGTTGG - Intergenic
995614761 5:113949377-113949399 GAAAATGTTGAGACAGAGCTAGG + Intergenic
996038836 5:118788083-118788105 GGAAATGAAGAGGTAGAGGAAGG + Intergenic
996101220 5:119447738-119447760 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
996943444 5:129037914-129037936 GAAAATGGAGAGTTAGGGCTAGG + Intergenic
997110066 5:131065249-131065271 GTAGATGCTGAGATAGAGTTTGG + Intergenic
997342859 5:133159406-133159428 TAAAAGGCACAGATAGAGGGAGG + Intergenic
998186315 5:139982440-139982462 GAAAAGGCAGAGATTGGTGTGGG - Intronic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
999105775 5:149069706-149069728 GAACATGGTGAGAAAGAGGTAGG + Intergenic
999132550 5:149295600-149295622 GAGAATGGAGAGAAAGAGGAAGG + Intronic
999529732 5:152449616-152449638 GGAAATTCAGAGAGAGAAGTCGG + Intergenic
999551556 5:152692938-152692960 GAGAAGGGAGAGAGAGAGGTTGG + Intergenic
1000253481 5:159516653-159516675 GAAAAAGAAGAGATAGAGAGAGG - Intergenic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000758245 5:165187346-165187368 GAAAAAACAGAGAGAGATGTGGG - Intergenic
1001284386 5:170411917-170411939 GTAGATGGAGAGAGAGAGGTTGG + Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001583553 5:172817290-172817312 TAAAATGCAGAGAAAAAAGTTGG + Intergenic
1002859878 6:1071216-1071238 GCTACTGCAGAGATTGAGGTGGG - Intergenic
1003219448 6:4145652-4145674 GGAAATCAAGAGAGAGAGGTAGG + Intergenic
1003329003 6:5113965-5113987 GAAAATGGAGAGATGGATGCTGG - Intronic
1003553034 6:7115717-7115739 GTAAATGGAGATATAGAGTTGGG - Intronic
1003834189 6:10050311-10050333 GGAAATGCAGACACAGAGGTGGG + Intronic
1004048703 6:12051439-12051461 GAGAAGGCAGAGATAGAAGATGG - Intronic
1004576304 6:16898768-16898790 CAAAATAGAGAGAGAGAGGTGGG - Intergenic
1004638983 6:17495818-17495840 GAAAATACAGAGAAAGAGACAGG + Intronic
1004771495 6:18787743-18787765 GAAAATGCAGAGGAAGAAATTGG - Intergenic
1004862120 6:19815158-19815180 GAAAATACACAAATAGAGATTGG + Intergenic
1005000504 6:21235504-21235526 AAAAATGAAGAGAGAGAGGGAGG + Intergenic
1005420881 6:25649597-25649619 AAAAATGGAGTGATGGAGGTGGG - Intergenic
1005423576 6:25678205-25678227 GGAAAAGCAGTGGTAGAGGTGGG + Intronic
1005565028 6:27082894-27082916 GAAAATGGAGACATTCAGGTTGG + Intergenic
1005852913 6:29835515-29835537 GAAAGGGCAGAGATTGAGGGAGG + Intergenic
1005887642 6:30108900-30108922 ATGAATGCAGAGTTAGAGGTGGG + Intronic
1006121355 6:31808102-31808124 AGAAATGCGGAGATTGAGGTTGG - Intergenic
1006945772 6:37783640-37783662 GGAAATGCAGAGACAGAAGAAGG - Intergenic
1008140197 6:47823194-47823216 GAAAAGGCAGAGTCAGGGGTTGG + Intronic
1008252129 6:49253143-49253165 CAAATTGCAGAGACAGAGTTGGG + Intergenic
1009569732 6:65369013-65369035 GAAAACGGGGAGAAAGAGGTAGG - Intronic
1010256663 6:73765677-73765699 GAGGATGCAGAAAGAGAGGTAGG + Intronic
1010629536 6:78181561-78181583 AAAAATGTAGAGATAGAAGATGG + Intergenic
1010725510 6:79328213-79328235 GAAATTGCAGAGAAATAGGCAGG - Intergenic
1011064907 6:83314867-83314889 GGAAAAGCAGAAAAAGAGGTGGG - Intronic
1011097211 6:83679537-83679559 GAAAAAGAAGAGATAGGGATGGG - Intronic
1012108169 6:95192873-95192895 TCAAATGCAGATGTAGAGGTTGG + Intergenic
1012703772 6:102495958-102495980 CAAATGGCAGAGATAGAGCTTGG - Intergenic
1013029085 6:106313072-106313094 GAGAAGGCAGAGGTGGAGGTGGG + Intronic
1013032042 6:106343084-106343106 GAAAATGTAGGGAGAGAGGAGGG + Intergenic
1013346511 6:109265689-109265711 GAATCTCCAGGGATAGAGGTGGG - Intergenic
1014618333 6:123632748-123632770 GTAAATGCAGAAACATAGGTTGG + Intronic
1015778870 6:136842790-136842812 GTAAATGCTGAGTTAGAAGTAGG + Intronic
1016003555 6:139066911-139066933 GAAAATGGAGAGAAGGAGGAAGG - Intergenic
1016068640 6:139710610-139710632 GAAGCTGCAAAGACAGAGGTAGG - Intergenic
1016603380 6:145889348-145889370 AAAAAAGTAGAGATGGAGGTAGG + Intronic
1016637030 6:146304585-146304607 AAAAATGCAGGGATTGGGGTAGG - Intronic
1016871666 6:148824010-148824032 GAAAAAGCTGAAATAGAGGAAGG + Intronic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1018593803 6:165456143-165456165 GAAAATACAGAACTAGTGGTTGG - Intronic
1018795978 6:167185999-167186021 GGAAATGCAGACAAAGAGCTTGG + Intronic
1019168283 6:170113635-170113657 GCAGATGCAGAGACAGATGTAGG + Intergenic
1019848381 7:3528814-3528836 GAAGACTCAGAGAGAGAGGTAGG + Intronic
1020019871 7:4858255-4858277 AAAAGTGCAGAGTTAGAGGAGGG + Exonic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1021264424 7:18502122-18502144 CAAATTGCAGAGACAAAGGTTGG + Intronic
1021401917 7:20219350-20219372 CAAAAATCATAGATAGAGGTAGG - Intergenic
1021528268 7:21613558-21613580 GGAAATGAAGAGACAGAGTTGGG + Intronic
1021545903 7:21812663-21812685 GAAAAGAGAGAGAGAGAGGTGGG + Intronic
1021792537 7:24219980-24220002 GAGAATGCATGGATAGAGGGAGG + Intergenic
1021867781 7:24976361-24976383 GAAAAAACAGAGACAGAGGTAGG + Intronic
1021868103 7:24979106-24979128 GAATAAACAGAGACAGAGGTAGG + Intronic
1022214997 7:28250406-28250428 AAAAATGAAGAGATGGGGGTCGG - Intergenic
1023115099 7:36855000-36855022 GCAAAAGCAGGGAGAGAGGTGGG + Exonic
1023497909 7:40817386-40817408 GAATAAGCAGTGATAGAGGCCGG + Intronic
1023656165 7:42423045-42423067 GAGAATGCAGAGAAAGAGACAGG - Intergenic
1023673527 7:42605274-42605296 GAAAATGCAGTGCTTCAGGTGGG + Intergenic
1023901083 7:44479387-44479409 AAAAATGCATATATAGAGGCAGG + Intronic
1024178020 7:46861011-46861033 GAAAAGGAAGACATAGAGGGAGG - Intergenic
1024181828 7:46903050-46903072 GAAAAGAGAGAGAGAGAGGTAGG + Intergenic
1024493986 7:50021755-50021777 GAACATGCAGAGATACTGGGTGG + Intronic
1024634081 7:51272908-51272930 GAAAACGCAGACATAGAGAGGGG - Intronic
1026553638 7:71388195-71388217 GGAAATGCAGAGTCAGAGGAAGG - Intronic
1026857221 7:73762685-73762707 GAAGAGGAAGAGATAGAGGGAGG - Intergenic
1027914119 7:84292619-84292641 GAAAATGCACAAATTGGGGTTGG + Intronic
1028372083 7:90103799-90103821 GAAAATGCTGAGAAAGATGGTGG - Intergenic
1029501679 7:100934573-100934595 GAAAATGCAGAGAGAGAGAGGGG - Intergenic
1030569855 7:111209789-111209811 GAAACTGCCCAGAAAGAGGTGGG + Intronic
1030688686 7:112511020-112511042 GAAGGTGCAGAGAGAGAGGCTGG + Intergenic
1031894610 7:127334817-127334839 GAAGATGCAGAGAAAGAGGAAGG + Intergenic
1032761263 7:134945304-134945326 GAAACTCTAGAGACAGAGGTAGG + Intronic
1033079535 7:138281999-138282021 CAAAATGCTGAGTTACAGGTGGG + Intergenic
1033097444 7:138443230-138443252 GATATAGCAGAGAGAGAGGTTGG + Intergenic
1033205635 7:139419377-139419399 GCAAATGCAGAGAATGAGGAGGG + Intronic
1033507753 7:142022603-142022625 GAAACTGAAGACAGAGAGGTAGG - Intronic
1033720622 7:144055783-144055805 AAAACTGAAGAGATTGAGGTGGG + Intergenic
1034236250 7:149572274-149572296 GAAATAGCAGAGAGAGAGTTTGG - Intergenic
1034701484 7:153099896-153099918 GCACATGCTGAGATGGAGGTAGG - Intergenic
1034889768 7:154829512-154829534 GAAAATGGAGAGAGGGAGGAAGG + Intronic
1035063549 7:156088850-156088872 GAAAATGAAGAGACAGAGGAGGG + Intergenic
1035520378 8:271344-271366 GAAAATGTGGGGACAGAGGTGGG - Intergenic
1035535845 8:390908-390930 GAGAATGAAGTGATAGAGGAGGG - Intergenic
1035733410 8:1869500-1869522 GAAAATGCCGGCAAAGAGGTAGG + Intronic
1036190255 8:6663580-6663602 GAAAATGCAGAGTGAATGGTAGG + Intergenic
1037009920 8:13828845-13828867 GAAAATGCAAAGATAGCCTTTGG - Intergenic
1037396642 8:18450591-18450613 GAACAAGCAGGGATAGAGGTGGG + Intergenic
1037619200 8:20548598-20548620 GAAAAAGAAGAGATAGCAGTAGG - Intergenic
1037807888 8:22068616-22068638 GAAAGTGGAGAGAGAGAGGAAGG + Intronic
1038481034 8:27901942-27901964 GAAAATGGGGAGATGGAGGCTGG + Intronic
1038671997 8:29590077-29590099 GAAAAGGCAGAGTCAGAGGGCGG + Intergenic
1039003773 8:33011021-33011043 GTAAATTCAGAGATGGGGGTGGG - Intergenic
1040601007 8:48883803-48883825 GAAAATACAGAGTTGGGGGTGGG + Intergenic
1042040557 8:64584565-64584587 GTAAATGCTGAGAGACAGGTCGG - Intergenic
1042408294 8:68431904-68431926 TAAAATCCAGAGATAAAGGTAGG - Intronic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1042788902 8:72581561-72581583 TAAATAGCATAGATAGAGGTTGG + Intronic
1043475039 8:80597813-80597835 GAAAAGGGAGAGAAAGAGGAAGG - Intergenic
1043841954 8:85116668-85116690 GAAAATTTAGTTATAGAGGTTGG - Intronic
1043991766 8:86764368-86764390 GAAAATTCACATATAGAGTTAGG - Intergenic
1044163603 8:88952028-88952050 GAAAATGCTGATATATAGATGGG + Intergenic
1044321955 8:90812132-90812154 GAGAATGCAGGTATAGAGGAGGG + Intronic
1044485536 8:92748700-92748722 CAAAATGGAGAGAGACAGGTAGG + Intergenic
1044571001 8:93718771-93718793 GAAGATGAAGATTTAGAGGTAGG + Exonic
1044590226 8:93907176-93907198 TAAAATGCAGAGCTAGACGATGG - Intronic
1045096740 8:98805797-98805819 GAAAATGGTGATATAGAGGTAGG - Intronic
1045114710 8:98970526-98970548 GAAAATACAGCTAAAGAGGTAGG - Intergenic
1045482598 8:102604086-102604108 GAAAATGCAGGAGGAGAGGTTGG - Intergenic
1046545933 8:115649973-115649995 CTAAATGCAGAAATAGAGGAAGG - Intronic
1047121909 8:121914076-121914098 GAAAGGCCAGAGGTAGAGGTAGG + Intergenic
1047444889 8:124910826-124910848 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
1047759458 8:127943439-127943461 GAAATTGCAAAGACATAGGTAGG + Intergenic
1048446505 8:134497121-134497143 GAAAGTGGAGGGAAAGAGGTGGG + Intronic
1048508263 8:135040339-135040361 GCAAATGCTGAGATAGAGATTGG - Intergenic
1048756621 8:137746745-137746767 GAAAATCCAGAGATATAGGCTGG - Intergenic
1050369467 9:4905802-4905824 GAAAATGGAGAGAAATATGTTGG + Intergenic
1050532743 9:6605049-6605071 GAAAAGACAGAGAGAGAGATAGG + Intronic
1051035459 9:12739394-12739416 ATAAATGCAGAGAGAGAGGGTGG + Intergenic
1051718327 9:20008838-20008860 GAACATGCAGAGAGTGATGTTGG + Intergenic
1052224047 9:26062544-26062566 AAAAATGGAGAGAGAGAGGGGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053452382 9:38203825-38203847 GAAAAAACAGAGAGAGAGGGAGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054255158 9:62803505-62803527 GAAGATGTAGAGAAAGAGGCAGG - Intergenic
1054336152 9:63812101-63812123 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1054702831 9:68431297-68431319 GAGAATGCGAAGAAAGAGGTAGG - Intronic
1055370747 9:75596092-75596114 GTAAATGCAGATATATAGTTAGG + Intergenic
1055537076 9:77259498-77259520 GAAAATGCAGGGATAAAAATGGG + Intronic
1055896466 9:81182187-81182209 GACAATAAAAAGATAGAGGTAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056608301 9:88106002-88106024 TAAAATGCAGAGATACTGATGGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057341679 9:94207655-94207677 GCAAATGCTAAGATAGAGTTAGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058117002 9:101095741-101095763 CAATATGCAGAGAAAGAGCTTGG - Intronic
1058232668 9:102448389-102448411 GAACAGGTAGAGAAAGAGGTAGG + Intergenic
1058975088 9:110118630-110118652 AAAAATACAGAGAGACAGGTGGG - Intronic
1059040279 9:110807249-110807271 GCAAATACAGAGACAGGGGTGGG - Intergenic
1059573945 9:115470023-115470045 GAAAATGCAGAGAAAGACAAAGG - Intergenic
1059619343 9:115986430-115986452 GAAAATGGAGAGAGAGAAGCAGG + Intergenic
1060395935 9:123316579-123316601 GAAGGTGCAGAGAAAGAGGAAGG + Intergenic
1060928221 9:127470471-127470493 TACAATTCAGAGATTGAGGTGGG + Intronic
1061883270 9:133578515-133578537 AAAAATGGAGAGAAAGAGGCTGG + Exonic
1061939064 9:133874394-133874416 GAAAAAGCGGGGATAAAGGTGGG + Intronic
1062605482 9:137346615-137346637 GAAGGTTCAGAAATAGAGGTGGG - Intronic
1062670318 9:137704966-137704988 GAAAAGGAAGAGAGAGAGGGAGG - Intronic
1203372418 Un_KI270442v1:321245-321267 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1203376078 Un_KI270442v1:379441-379463 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1203376084 Un_KI270442v1:379519-379541 GAAGATGTAGAGAAAGAGGCAGG + Intergenic
1186159859 X:6765784-6765806 GAAAAAGAAGAGAAAGAGGTTGG + Intergenic
1186646228 X:11509992-11510014 GAAAATTCAGAGATAGCAGTTGG + Intronic
1186650096 X:11550122-11550144 CAATATGCAGAGAAAAAGGTTGG + Intronic
1187631613 X:21179087-21179109 AAAAAGGCAGAGAAAGAGCTAGG + Intergenic
1189023189 X:37363984-37364006 GAAAAAGCAGACATATAGGTGGG - Intronic
1189552405 X:42106843-42106865 GAAAATGGAGAGTAAGAAGTAGG + Intergenic
1189677580 X:43477542-43477564 GATATGGCAGAGATAGAGGATGG + Intergenic
1189857538 X:45238389-45238411 GCAGATGCTGAGACAGAGGTAGG + Intergenic
1190104989 X:47553534-47553556 AAAAATGAAGAGGAAGAGGTGGG - Intergenic
1190110274 X:47585028-47585050 GAAAATGCTGGGAAAGAGGCGGG - Intronic
1190131793 X:47754707-47754729 GAAACTTGAGAGATTGAGGTGGG - Intergenic
1191026776 X:55922412-55922434 GAAAATGCATGGATACAGGGAGG + Intergenic
1192278791 X:69662106-69662128 GAAAATGGAGAGATGTATGTAGG - Intronic
1192339839 X:70254912-70254934 GAAGATGTAGAGGTGGAGGTTGG + Intergenic
1192360666 X:70436792-70436814 AAAAATGAAGAGAGAGAGGGTGG + Intergenic
1192495078 X:71611023-71611045 GGAAATGCAGAGAGAAAGGCAGG - Intronic
1192855806 X:75010636-75010658 GAGAATGTAGAGAAAGAGGTAGG - Intergenic
1192887689 X:75353334-75353356 CAAAAGGCAGAGATAGGGCTGGG - Intergenic
1193601659 X:83513921-83513943 GAAAATGCAGAGGTTGTGGAGGG + Intergenic
1194418231 X:93638920-93638942 CAAAATGAAGAGAGAGAGGAGGG - Intergenic
1194876312 X:99192786-99192808 GACAATGCTGAGGCAGAGGTAGG + Intergenic
1195156532 X:102128600-102128622 CCAAATTCAGAGATAGAGGCTGG + Intergenic
1195619497 X:106938856-106938878 GAAATTGCAAAGATGGAGATGGG + Intronic
1195849273 X:109265218-109265240 GGCAATGAAGAGATAGAGATAGG - Intergenic
1195907263 X:109856761-109856783 GAGAAGGCAGAGAGAGAGGATGG + Intergenic
1196216311 X:113056080-113056102 AAAAATGCAGAGATGAATGTAGG + Intergenic
1196609736 X:117697282-117697304 GAGGATGCAGAGAAAGAGATGGG + Intergenic
1196976694 X:121165892-121165914 GACAATGCTGAGACAGAGTTGGG + Intergenic
1196980937 X:121213041-121213063 GGAGAGGCAGAGATAAAGGTGGG - Intergenic
1197823394 X:130563983-130564005 AAAAATGCAGAGATATTGGGAGG + Intergenic
1197849274 X:130840032-130840054 AGAAATGGAGAGACAGAGGTAGG - Intronic
1198400416 X:136263196-136263218 GAATTGGCAGAGATGGAGGTGGG - Intergenic
1198753376 X:139957750-139957772 GAAAATGAAGAGAAAGAGAGAGG - Intronic
1199121397 X:144058585-144058607 TTAAATGCAGATATAGAGGAAGG - Intergenic
1199783497 X:151083722-151083744 GAAAGGGCACAGCTAGAGGTAGG - Intergenic
1200170102 X:154066409-154066431 GAAAATGAAAAGACAGAGCTGGG - Intronic
1200875272 Y:8147972-8147994 GAACATTCAGAGGCAGAGGTGGG - Intergenic
1201053945 Y:9969536-9969558 GCATATTCAGAGACAGAGGTGGG - Intergenic
1201065947 Y:10094060-10094082 GAAGATGTAGAGAAAGAGGCAGG - Intergenic
1202102283 Y:21322717-21322739 GCAAATTCAGAGGCAGAGGTGGG - Intergenic