ID: 1121183232

View in Genome Browser
Species Human (GRCh38)
Location 14:91945322-91945344
Sequence TTGTGGGTGTGGATGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121183230_1121183232 -8 Left 1121183230 14:91945307-91945329 CCAAGCAACTACTGCTTGTGGGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG 0: 1
1: 0
2: 5
3: 29
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121183232 Original CRISPR TTGTGGGTGTGGATGCCAGA TGG Intronic
900734762 1:4291612-4291634 CTGTGCGTGTGTATGCCAGTGGG + Intergenic
902278684 1:15358776-15358798 TTGAACGTGTGGATGACAGAGGG - Intronic
902446055 1:16465280-16465302 TGGAGGGTGTGGATACCAGGAGG + Intergenic
903502173 1:23806864-23806886 TGGTGGGTGGGGAAGACAGATGG - Intronic
904334133 1:29786015-29786037 TTGTGGGTCAGGATCCAAGAAGG + Intergenic
905240162 1:36576180-36576202 TTGGGGGTGGGGATCCTAGAGGG + Intergenic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
909887917 1:80965570-80965592 TTATTGGTCTGGTTGCCAGAGGG - Intergenic
910803677 1:91169992-91170014 TTGAGGGTACGGAAGCCAGAAGG - Intergenic
913294618 1:117306988-117307010 GTGTGGGTGTGCATGCAAGAGGG - Intergenic
916086158 1:161271156-161271178 TTGTTGGTGGGAATGCAAGATGG - Intronic
916549733 1:165838706-165838728 TTGTAAGTGTGCATGCTAGATGG + Intronic
916972751 1:170042002-170042024 TTGTGTGTGGGGAACCCAGAAGG + Intronic
918026603 1:180755600-180755622 TTGTGGAAGTGGGTGTCAGAAGG - Intronic
918123924 1:181565779-181565801 TTGGGGGTGTGGCTCCCACATGG + Intronic
920252235 1:204629369-204629391 TTGTGGATGTGGATCCTTGAGGG - Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922290503 1:224205533-224205555 GTGTGAGTGTGGATGTCAGGTGG + Intergenic
923470441 1:234285754-234285776 TTGTGGGTGAGGATTCCTGAGGG + Intronic
923673532 1:236061967-236061989 TTGTTGGTGGGAATGTCAGATGG + Intronic
924517563 1:244779427-244779449 TTGTGGGTGGGGAGCCAAGAGGG - Intergenic
1063747792 10:8905287-8905309 TTGTGGGTGTGTATGTCTGTAGG - Intergenic
1065505214 10:26423553-26423575 TTGTTGGTGGGGATGCAAAATGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066350936 10:34636316-34636338 GTGTGGGTTTGGATGACAGAGGG - Intronic
1066725314 10:38385931-38385953 TTGTGGGGATGGAAGACAGAGGG - Intergenic
1067220632 10:44341620-44341642 TTGTGGGAGTGGATTCCTTAAGG - Intergenic
1067320035 10:45209484-45209506 TTGTAGCTGTGGGTGTCAGAGGG - Intergenic
1067698422 10:48551907-48551929 GTGTGGCTTTGGAAGCCAGATGG + Intronic
1068395631 10:56457348-56457370 CTGGGGATGAGGATGCCAGATGG - Intergenic
1069900406 10:71703635-71703657 TTGTTTGTCAGGATGCCAGAGGG + Intronic
1070900337 10:80022806-80022828 CTGTCAGTGTGGATGCCAGAGGG + Intergenic
1072491528 10:95910558-95910580 TTGTGGGGGTGGATACCTCATGG - Intronic
1074177080 10:111018517-111018539 TTGGGGTGGAGGATGCCAGATGG + Intergenic
1075699064 10:124456852-124456874 GTGTGGGAGTGGATGACACAGGG - Intergenic
1075813324 10:125244830-125244852 CTGTGGGTGTGGGTGACAGTTGG + Intergenic
1075952199 10:126489616-126489638 TTGCTGGTGGGGATGCCAAATGG + Intronic
1076266827 10:129115191-129115213 AACTGGATGTGGATGCCAGATGG + Intergenic
1076645126 10:131948483-131948505 TTCTAGGTGTTTATGCCAGAGGG - Intronic
1077217081 11:1399402-1399424 TTGTGGGCCAGGATGCCCGAGGG + Intronic
1077916683 11:6616123-6616145 ATGTGGGTTCGGATGTCAGAGGG + Intronic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1078706010 11:13745031-13745053 TTGAGGGTTAGGATACCAGACGG - Intergenic
1078911295 11:15734806-15734828 TTCTGGGCATGGGTGCCAGATGG - Intergenic
1078966547 11:16351202-16351224 TTCTGGGTGTGGATGAATGAGGG - Intronic
1080101520 11:28465454-28465476 TTATAGGTGTGGAAGTCAGAAGG - Intergenic
1080857911 11:36128425-36128447 TCGTGGGTAGAGATGCCAGAGGG + Intronic
1081836565 11:46160300-46160322 TTGTGGCTGCAGATGCCAGCAGG + Intergenic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1085902093 11:80713203-80713225 TGGTGGGCGTAGATGGCAGAGGG - Intergenic
1086314170 11:85572634-85572656 TTGTGGGTGGGCTTCCCAGAAGG - Intronic
1086487734 11:87326537-87326559 TTATGGGATTGGATGCCAAAAGG + Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1089066551 11:115666331-115666353 TTGTTGATCTGGATCCCAGATGG - Intergenic
1089292980 11:117449697-117449719 TAGTGGAGGTGGATGGCAGAGGG - Intronic
1090403122 11:126461465-126461487 TTGTGAATGAGGATGCCAGAAGG + Intronic
1090639415 11:128717550-128717572 TTGTTTGTGTGCATGCCAGGCGG + Intronic
1090725367 11:129520943-129520965 TTGCTGGTGTGGATGCAGGATGG + Intergenic
1091786817 12:3247934-3247956 TTCTGTGTGTGCATGCCAGTGGG + Intronic
1092238669 12:6824629-6824651 TTGTGGTGGAGGATGCCCGAGGG + Exonic
1094603485 12:31931020-31931042 TGGTGGGTGGGGAAGCCAGTGGG - Intergenic
1095370202 12:41458159-41458181 TTGTGTGTGTGTATGTGAGATGG + Intronic
1097256451 12:57679231-57679253 TTGTTGGTGGGAATGCCAAATGG + Intergenic
1098293800 12:68983870-68983892 TTGTGCGTGTATAAGCCAGAAGG - Intergenic
1099518590 12:83630266-83630288 TGGGGGGTGTGCATGCCTGAGGG - Intergenic
1101205317 12:102481377-102481399 GTGTGTGTGTGTATGACAGAGGG + Intergenic
1101753587 12:107603541-107603563 TTGTGTATATGGATGCCATAAGG - Intronic
1102740971 12:115207295-115207317 AAGTGGGGGTGGGTGCCAGAGGG - Intergenic
1102929012 12:116848556-116848578 TTGTTGGGGTGGATGGGAGAGGG - Intronic
1103860656 12:124010575-124010597 ATATGTGTGTGGGTGCCAGAGGG + Intronic
1104339172 12:127931114-127931136 TCATGGGTGTGGATCCCACATGG + Intergenic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1106671985 13:31915729-31915751 TTGTTGTTGTTGTTGCCAGAAGG - Intergenic
1107119827 13:36784439-36784461 TTTTTGGTGAGGATGGCAGAAGG + Intergenic
1107707628 13:43123080-43123102 TTGTGGGGATGGAAGCCAAATGG + Intergenic
1109989955 13:70041603-70041625 CTGTGTCAGTGGATGCCAGATGG - Intronic
1112135246 13:96570942-96570964 TTCTGTGTGTGGATGAGAGAAGG + Intronic
1113434042 13:110275446-110275468 TTGCGGGTGGGGATACAAGATGG + Intronic
1114908081 14:27155275-27155297 TTGTGGGTGGGAATGCATGATGG - Intergenic
1115875250 14:37854023-37854045 TTGTGGGTGTGGTTTCCCCATGG + Intronic
1116061767 14:39932850-39932872 TTGTGGATGTGGATACTTGAGGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117322397 14:54636407-54636429 TTCTGAGTGTGGAAGCCAAAGGG - Intronic
1117561445 14:56943578-56943600 CTTTGAATGTGGATGCCAGAGGG - Intergenic
1117935172 14:60895940-60895962 TTTTGGGAGTGGATGACATAAGG + Intronic
1118303211 14:64633448-64633470 TTGTGGGGGTGGAGGCCCGGAGG + Intergenic
1118815560 14:69311228-69311250 TTGTTGCTGTGTATTCCAGAGGG + Intronic
1119115982 14:72021922-72021944 TTGAGGGTGGGGGTGGCAGAAGG - Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119801681 14:77450874-77450896 TTGTTGGTGGGAATGCCAAATGG - Intronic
1120253178 14:82085227-82085249 TTGTGAGTAGGGATGCCTGAGGG + Intergenic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1124005976 15:25795819-25795841 TCGTGGGGGTGGATCCCACATGG + Intronic
1124235015 15:27982659-27982681 TTGTGTGTGTGTGTGCCTGAAGG - Intronic
1124376991 15:29134671-29134693 TTGTGGGTGTGATTGTCGGAAGG + Intronic
1126360643 15:47842392-47842414 TTGAGGGGGTGCATGCCAGGGGG + Intergenic
1126723383 15:51606208-51606230 GTGGGGGTGTGGATGTGAGATGG + Intronic
1127586596 15:60383634-60383656 TTGTGGTTGTGGTTGGCTGATGG + Intronic
1128642375 15:69349147-69349169 TTGTGGGTGGGGATGCTAATTGG - Intronic
1129583621 15:76838840-76838862 TTGTGGGTGTGGCTGCCGGAAGG - Intronic
1131771972 15:95747606-95747628 TCTTGGGTGTGGGTGGCAGAGGG + Intergenic
1132809944 16:1792698-1792720 TTGGGGGTGCGGCTGCCACATGG - Intronic
1133389543 16:5398490-5398512 TTGTGGGTGTGCATGTGAGCAGG + Intergenic
1133788297 16:8989762-8989784 ATCTGGGTGTGGCAGCCAGAGGG - Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136349421 16:29697242-29697264 GTGTGGCTGTGGAAGCCAGTGGG + Exonic
1138166008 16:54802346-54802368 TGGAGGGTGTGGATGGCAGATGG + Intergenic
1138354758 16:56368245-56368267 TTGTGGGTGGGGATGTGAGCTGG - Intronic
1138552757 16:57756442-57756464 CTGTGGGTGTGGATATCAGCAGG + Exonic
1140127133 16:72127050-72127072 TTCTGAGTCTGGAAGCCAGAGGG + Intronic
1142234372 16:88914984-88915006 GTGGGGGTGTGGCTGCCAGCCGG + Intronic
1143089599 17:4441515-4441537 TTGTGGGTGTTGAACCAAGATGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143374572 17:6459673-6459695 TTGGGGGTGATGATGCCACATGG - Intronic
1146537562 17:33666348-33666370 TTGAGTGTGTGGGTGGCAGAAGG + Intronic
1147853074 17:43457507-43457529 TTGAGAGTGTGGATGGCAGACGG + Intergenic
1150993017 17:70282684-70282706 TTGGGGGTGAGAATGGCAGAGGG + Intergenic
1151194023 17:72419207-72419229 TTGTGGGTCTGAATGGGAGATGG + Intergenic
1152130145 17:78471693-78471715 GTGTGGCTGTGAAAGCCAGACGG - Intronic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152615271 17:81334924-81334946 GTGAGGGCGTGGATGGCAGAGGG - Intergenic
1153576257 18:6524661-6524683 TAGTGGGTGAGGATGCAAGTAGG + Intronic
1153951965 18:10065075-10065097 TTGTGGGAGTGGATCCCCCAAGG + Intergenic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1160159224 18:76458836-76458858 TTGTGTGTGTGCATGCCTGTAGG + Intronic
1160275746 18:77433285-77433307 TTTTGGGTTTGCAGGCCAGATGG - Intergenic
1160290766 18:77591014-77591036 TTGTGGGTGTAGCTGCCCCAAGG + Intergenic
1160610465 18:80080790-80080812 TTTTGGGTGTGTATGCCAAGAGG + Intronic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1161943214 19:7418767-7418789 TTGTCGGTGTGGATTCAAGGGGG + Intronic
1162777623 19:12989569-12989591 TTGTGTGTGTGGATGAAGGATGG + Intergenic
1163005524 19:14394727-14394749 TGGTAGGTGTGGGTGTCAGAGGG - Intronic
1164799220 19:31062222-31062244 GTGGTGGTGTGGATGGCAGAGGG + Intergenic
1165725142 19:38107399-38107421 GGGTGGGTGTGGCTGCCAGCAGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166111716 19:40626920-40626942 TGGTGGGTGTGGGGGCCAGCAGG + Intronic
1166120341 19:40682696-40682718 CTGTGGGGGTGGACGCCAGGGGG - Intronic
1166336354 19:42110431-42110453 TTGTTGGTGTTGTTGCCAGGTGG - Intronic
1166406682 19:42526679-42526701 TTGTCTGTGAGGATCCCAGAAGG + Intronic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167968946 19:53173936-53173958 TTGTGGGTGTGGGTGACAAGGGG - Intronic
1168267330 19:55230019-55230041 GCGTGGGTGGGGGTGCCAGAGGG - Exonic
925523997 2:4779601-4779623 TTGTGTGTGTGTATGAAAGATGG - Intergenic
926393338 2:12416742-12416764 TTGTGGAAGTGGGTGCCAGCAGG + Intergenic
926830109 2:16952528-16952550 TAGTCAGTGTGGCTGCCAGAGGG + Intergenic
928341984 2:30451312-30451334 TTGTTGGTGGGGATGTCAAATGG + Intronic
928460749 2:31470204-31470226 TTGTGGAGGTGGAAGACAGACGG - Intergenic
928933790 2:36652934-36652956 TTGTTGGTGTGGATGTGAGACGG + Intergenic
928949614 2:36803110-36803132 TTGTGGGTGTGAATGGCACAGGG - Intronic
931122146 2:59231739-59231761 CTGAGGGTGGAGATGCCAGAGGG + Intergenic
932107805 2:68963192-68963214 TTGCTGGTGGGGATGCAAGATGG + Intergenic
934717629 2:96552695-96552717 TTGTGGGTGGGGCTGCCATTAGG + Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936818183 2:116485214-116485236 CTGTGGATGGGGATGCCAGGTGG - Intergenic
936863938 2:117055951-117055973 TGGTGGCTGGGGAGGCCAGAAGG + Intergenic
937214692 2:120304396-120304418 TTGTGGGTGTCTAATCCAGAGGG + Intergenic
937662063 2:124442267-124442289 TGGTGGCAGTGGATGCAAGAAGG + Intronic
938343165 2:130548844-130548866 CTGTGGGAGTGCATGCAAGAGGG - Intronic
938346668 2:130571878-130571900 CTGTGGGAGTGCATGCAAGAGGG + Intronic
938584276 2:132673843-132673865 TTTTGGGTGTAGATCCCAGAAGG + Intronic
941254807 2:163215080-163215102 TTGTGGGTACTGATGACAGAAGG + Intergenic
941584165 2:167336103-167336125 TTGGTGGTGGGGATTCCAGAGGG + Intergenic
944566384 2:200995776-200995798 TTGTGGGTCAGGAATCCAGATGG - Intronic
945587185 2:211680169-211680191 TTGTTGTTGTTGATGGCAGAAGG + Intronic
946195490 2:218030353-218030375 TGATGGGTGAGGATTCCAGAGGG - Intergenic
947043505 2:225950231-225950253 CTGTGGATGGGGATGCCAGGTGG - Intergenic
947871005 2:233438006-233438028 TTGTGAATGTGGAGGTCAGATGG + Intronic
948534117 2:238633316-238633338 TTGTGGGTGTGCATGCATGAAGG + Intergenic
1169075817 20:2759304-2759326 GTGTGGCTGTGAATCCCAGAGGG - Exonic
1169499799 20:6148335-6148357 TTGAGGGTGTGGTTCCCAGCTGG - Intergenic
1170454160 20:16517033-16517055 GTGTGGGTGTTGTGGCCAGAGGG - Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1172190976 20:33061727-33061749 ATGTGGGTGCGGCTGCCAGGTGG - Intronic
1173147097 20:40534440-40534462 TTGGGGGGGTGCATGACAGAAGG - Intergenic
1173384080 20:42572381-42572403 TGGTGGGTGGTGAGGCCAGAGGG - Intronic
1173429012 20:42968957-42968979 CTGTGTGTGTGGATTCCACATGG - Intronic
1173682806 20:44898199-44898221 TTGTGAGTGAAGATGTCAGATGG + Intronic
1174390078 20:50213633-50213655 TTGTGTGTGTGCATGCAAGAGGG + Intergenic
1174772718 20:53316185-53316207 TTGTGAGTGGGGATGACTGAGGG - Intronic
1175547479 20:59787926-59787948 CTGTGGGTGTGTATTTCAGATGG - Intronic
1176149925 20:63585440-63585462 TTGCGGGTGGGAATGCGAGATGG + Intergenic
1176819186 21:13640552-13640574 TTGTGTGTGTGTATTCTAGATGG + Intronic
1177204383 21:17994736-17994758 GTGTGGGTGCCGATGGCAGAAGG + Intronic
1179477150 21:41654363-41654385 TGGTGGGTATTGAAGCCAGATGG + Intergenic
1181636692 22:24177914-24177936 GTGTGGGTGAGGATGGCATAGGG + Intronic
1182166309 22:28177847-28177869 TTGGGGGAGTGGAGGACAGATGG + Intronic
1183954098 22:41368902-41368924 TTGTGGGTGTGGACTCCAAATGG - Intronic
1184468636 22:44683416-44683438 TTCTGGGTGTGGGTGGCAGATGG - Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
949978751 3:9485504-9485526 TTGTTGGTGGGAATGCAAGATGG + Intergenic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
952866054 3:37855828-37855850 TTATGGGTGTTGAAGGCAGAAGG + Intergenic
953691573 3:45124359-45124381 TTCTGGGTGTGGTTGCCTGTGGG + Intronic
954137866 3:48590397-48590419 ATGAGGGTATGGGTGCCAGAGGG - Intronic
954297742 3:49683579-49683601 TTCTGGGTGTGGCAGCCACAAGG + Exonic
954317195 3:49807529-49807551 TTGGGGGTGGGGATGGCTGACGG + Intronic
954581550 3:51705941-51705963 ATGTGGGTGTGTGTGCCTGAGGG + Intergenic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
955115934 3:56001764-56001786 TTGGGTGTGTGCATGACAGATGG - Intronic
957209223 3:77239020-77239042 TTGTGTCTGTGGATTCCACAGGG - Intronic
957606985 3:82413092-82413114 TTGTGAGTGTGGGTGAGAGAGGG - Intergenic
957736208 3:84206686-84206708 TTGTTGGTGAGGATGCAAAATGG + Intergenic
959628151 3:108476862-108476884 TTGTGGGTGGGAATGCAAAATGG + Intronic
960811920 3:121634172-121634194 TCCTGGATGTGGATCCCAGAGGG + Intronic
961833254 3:129635777-129635799 TCGTGTGTGTGGACGACAGAAGG + Intergenic
963138199 3:141927060-141927082 TTGTGGTGGTGCAAGCCAGAAGG + Intergenic
963758491 3:149259978-149260000 CTGGGGATGGGGATGCCAGATGG - Intergenic
966234219 3:177682823-177682845 TTGGGGGTGGGGAAGGCAGAAGG - Intergenic
966749840 3:183311471-183311493 CTCTGTATGTGGATGCCAGACGG + Intronic
967182412 3:186917913-186917935 TTATGGGGGTGGAAGGCAGAAGG - Intergenic
968035739 3:195545962-195545984 TTGAGGGTTTGGCTGCCAGGAGG + Intergenic
969263672 4:6050168-6050190 TGGTGGCTGTGGTTGCTAGAAGG - Intronic
969915411 4:10485972-10485994 TTGTTGGTGGGAATGCCAAATGG - Intergenic
973341630 4:49011363-49011385 ATGTGTGTGTGCATGCAAGATGG + Intronic
973747943 4:53982899-53982921 TTGTGGGTGTGCTTGCATGAAGG + Intronic
974253415 4:59419683-59419705 TTGTGGGGGTGGTGCCCAGATGG + Intergenic
974626311 4:64431955-64431977 TTGGGGATGTTGATGCCAGCAGG - Intergenic
975211332 4:71703623-71703645 TGGTGGGGGTGGAAACCAGATGG + Intergenic
975211370 4:71703981-71704003 TGGTGGGGGTGGAAACCAGATGG - Intergenic
975243799 4:72094535-72094557 ATGAGGGTGTGGTTCCCAGAGGG + Intronic
978050083 4:104188063-104188085 TTGTGGGTGTGTATTAGAGAGGG + Intergenic
978783989 4:112588998-112589020 TTATGGGTGTGGTTGGTAGAAGG - Intronic
980582366 4:134771702-134771724 TGGTGTGTGTGGAAGACAGAGGG - Intergenic
984815359 4:183831110-183831132 TGGTGGGTGTGGAGGCGTGAGGG + Intergenic
985416659 4:189742177-189742199 TTGTGGGAGTGGGTGGCAAATGG + Intergenic
985615379 5:916934-916956 CAGGGGCTGTGGATGCCAGATGG + Intronic
986587638 5:9335335-9335357 TTCTGGCTGTGGATGGCAGCTGG - Intronic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
986623603 5:9702831-9702853 TTGGGGGTGGGGGTGTCAGATGG + Intronic
987554310 5:19427091-19427113 GTGTGTGTGTGTATGCCTGAGGG + Intergenic
987762860 5:22188132-22188154 TTGTGGGGGTGGATCCCTGATGG + Intronic
988148706 5:27347216-27347238 TTGTCGAAGTGGATGCCCGAAGG + Intergenic
991000487 5:61777788-61777810 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
991897646 5:71421530-71421552 TTGTGGGGGTGGATCCCTGATGG + Intergenic
991911454 5:71566577-71566599 TTTTGGGTTTGCAGGCCAGATGG + Exonic
992042916 5:72854708-72854730 TTGTTGGTGTTGATGCCAACTGG + Intronic
997352448 5:133240627-133240649 TTCTGACTGTGGATGCCAAAGGG + Intronic
997361453 5:133297849-133297871 TTGTGGGACAGGATGCCAGGTGG + Intronic
997400485 5:133598215-133598237 TTGTGTGTGTGCATGCGAGGAGG + Intronic
1000832005 5:166114021-166114043 TTGTGTGTGTGCATGGCAGGTGG + Intergenic
1001577544 5:172773945-172773967 TTGTGGGCCTGGCTGCCAGAGGG + Intergenic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1003168679 6:3703312-3703334 TTGTGGATGTGGGGGCCAGGTGG - Intergenic
1003255877 6:4474506-4474528 TTGTGGGTGGAGATGTCAGCAGG - Intergenic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1005570588 6:27141815-27141837 TAGTAGGTGGTGATGCCAGAAGG + Intergenic
1006093495 6:31641982-31642004 TTGTGGGTGGGCAGGCCAGGTGG - Intronic
1006347219 6:33492406-33492428 TTGTGGGTCTGGTGGCCACAGGG - Intergenic
1006606714 6:35262666-35262688 ATGTGGCTGAGGATGGCAGAAGG - Intronic
1008139368 6:47814202-47814224 TTGTGGAAGTGGATGACAGATGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1009558215 6:65202790-65202812 TTGCCAGAGTGGATGCCAGAGGG + Intronic
1011990776 6:93514730-93514752 ATGTGGGTGTAGATGCTGGAAGG - Intergenic
1017078800 6:150646461-150646483 ATGTTGGTGCGAATGCCAGAAGG + Intronic
1017590162 6:155970476-155970498 TTGTGGGTGGGAATGCAAAATGG + Intergenic
1018398088 6:163396339-163396361 ATGTGAGTCTGGATCCCAGAAGG - Intergenic
1020813253 7:12872289-12872311 GTGTGGGTGTCTATGCCAGTGGG + Intergenic
1023966288 7:44964728-44964750 GGGTGGGTGTGGATGACAGGAGG - Intronic
1031144051 7:117978229-117978251 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
1031686949 7:124742154-124742176 TTGTGGGTGGGAATGCAAAATGG + Intergenic
1032453873 7:132057076-132057098 ATCTGGGTGTGGATGTCAAATGG + Intergenic
1032524703 7:132571222-132571244 GTGTGGGTGTGAATCCCTGAAGG - Intronic
1033158346 7:138975279-138975301 TTGAGTGTGTGGATGCAAGAGGG + Intronic
1033263553 7:139865308-139865330 TTGTGGGTGTGGGTGAGAAATGG + Intronic
1034302109 7:150025281-150025303 TTTTGAGTGTGGACACCAGAGGG - Intergenic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034803946 7:154072034-154072056 TTTTGAGTGTGGACACCAGAGGG + Intronic
1037551788 8:19981384-19981406 TCGTTGGTGGGGATGCCAGATGG + Intergenic
1041106204 8:54446401-54446423 GTGTGGGTGTGGCTGACAGCAGG + Intergenic
1041425150 8:57712694-57712716 TTCTGGGTGTGGATGGTTGAGGG - Intergenic
1042128054 8:65558781-65558803 TGGTGGGAGTGGATTGCAGAAGG - Intergenic
1044932202 8:97261054-97261076 TTGTGAATGTGGGTGGCAGAGGG - Intergenic
1045816552 8:106283396-106283418 ATGTGTCTGTGGATTCCAGAAGG + Intronic
1046379110 8:113430988-113431010 TTGTGGCTGTGAATACCAGCAGG + Intronic
1048055522 8:130859362-130859384 TTGTGTAAGTGGATGGCAGATGG - Intronic
1048434451 8:134403045-134403067 ATGTGGGTGTGGATACCAGAAGG - Intergenic
1050904305 9:10984822-10984844 TTGAGGGTGTGGAAGGCAAATGG - Intergenic
1052254671 9:26441073-26441095 TGGGGGGTGGGGATGGCAGATGG - Intergenic
1052480526 9:29019512-29019534 TAGTGGGAGTGGAGACCAGAAGG - Intergenic
1052981196 9:34450933-34450955 ATGTGAGTGTGCATGCAAGAGGG - Intronic
1054473509 9:65557005-65557027 CTGGGGGTGAGGATGCCAAACGG - Intergenic
1056672657 9:88644188-88644210 TTGTGGGTGGGAATGTAAGATGG - Intergenic
1057081816 9:92179125-92179147 TCCTGGGTGTGGAAGGCAGAGGG + Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1059632254 9:116137195-116137217 GTGAGTGTGTGCATGCCAGAAGG - Intergenic
1060636458 9:125203305-125203327 TTGGAGCTGAGGATGCCAGATGG - Intronic
1062480648 9:136749295-136749317 GTGTGGGAGTGAATCCCAGAGGG - Intergenic
1186716484 X:12257367-12257389 TTGTGTGTGTGTATGCTAGAAGG - Intronic
1187911272 X:24113484-24113506 TTGTGGGTGGGAATGCAAAATGG - Intergenic
1188098779 X:26056429-26056451 TTGTGTGTGTGTTTGCCAAATGG + Intergenic
1193671777 X:84396540-84396562 TTGTGGCTGTGGTGGCCAGATGG + Intronic
1193901864 X:87189393-87189415 TTGTGTGGGTGAATGCCAGAGGG + Intergenic
1195472267 X:105244169-105244191 TTGTGCGTGTATAAGCCAGAAGG + Intronic
1199056797 X:143306175-143306197 TATTGGCTGTGGATGCCACAGGG - Intergenic
1199733999 X:150667201-150667223 TTGTTGGTGAGGATGCCAGGAGG - Intronic
1200064899 X:153499648-153499670 CTGTGGGAGTGGCTGCCTGAGGG - Intronic
1200842680 Y:7799368-7799390 TTAAGGGTGTGTATACCAGAAGG - Intergenic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1202119277 Y:21507806-21507828 GTGTGGGTGATGATGGCAGAGGG + Intergenic
1202121729 Y:21531346-21531368 GTGTGGGTGATGATGGCAGAGGG + Intronic
1202157276 Y:21898036-21898058 GTGTGGGTGATGATGGCAGAGGG - Intronic
1202159723 Y:21921577-21921599 GTGTGGGTGATGATGGCAGAGGG - Intergenic