ID: 1121186124

View in Genome Browser
Species Human (GRCh38)
Location 14:91971440-91971462
Sequence TAGGATACAAAAGCTGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121186124_1121186126 -8 Left 1121186124 14:91971440-91971462 CCATCACCAGCTTTTGTATCCTA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1121186126 14:91971455-91971477 GTATCCTATCAATACAAATCAGG 0: 1
1: 0
2: 0
3: 13
4: 76
1121186124_1121186128 -4 Left 1121186124 14:91971440-91971462 CCATCACCAGCTTTTGTATCCTA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1121186128 14:91971459-91971481 CCTATCAATACAAATCAGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 128
1121186124_1121186132 21 Left 1121186124 14:91971440-91971462 CCATCACCAGCTTTTGTATCCTA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1121186132 14:91971484-91971506 ACTGGACTTGATACAAGAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 190
1121186124_1121186130 3 Left 1121186124 14:91971440-91971462 CCATCACCAGCTTTTGTATCCTA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1121186130 14:91971466-91971488 ATACAAATCAGGCTGGGCACTGG 0: 1
1: 0
2: 2
3: 35
4: 190
1121186124_1121186131 20 Left 1121186124 14:91971440-91971462 CCATCACCAGCTTTTGTATCCTA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1121186131 14:91971483-91971505 CACTGGACTTGATACAAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 141
1121186124_1121186133 22 Left 1121186124 14:91971440-91971462 CCATCACCAGCTTTTGTATCCTA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1121186133 14:91971485-91971507 CTGGACTTGATACAAGAAAGGGG 0: 1
1: 0
2: 0
3: 21
4: 172
1121186124_1121186134 27 Left 1121186124 14:91971440-91971462 CCATCACCAGCTTTTGTATCCTA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1121186134 14:91971490-91971512 CTTGATACAAGAAAGGGGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 282
1121186124_1121186129 -3 Left 1121186124 14:91971440-91971462 CCATCACCAGCTTTTGTATCCTA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1121186129 14:91971460-91971482 CTATCAATACAAATCAGGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121186124 Original CRISPR TAGGATACAAAAGCTGGTGA TGG (reversed) Intronic
902203151 1:14848877-14848899 TTGGAAACAAAAGCTGGGGAAGG + Intronic
904655757 1:32045741-32045763 AAGGATAAAAAATCTGGTGTGGG + Intronic
905502179 1:38448359-38448381 TAGCATCTAAAAGCTGGTGAAGG + Intergenic
906606129 1:47173621-47173643 TAAGACACAAACCCTGGTGATGG + Intergenic
909905815 1:81193307-81193329 AAGGATAGAAAAGTAGGTGAAGG + Intergenic
910364685 1:86452245-86452267 TGTCAAACAAAAGCTGGTGATGG - Intronic
910488196 1:87738875-87738897 TAGAATAAAAAGGCTGGGGAAGG - Intergenic
912651611 1:111444473-111444495 TAGTATACAAAAACTTTTGAGGG + Intronic
915675642 1:157527459-157527481 TAGGATACAAAACTTAGAGATGG + Intronic
917596009 1:176529760-176529782 TAAAAAAAAAAAGCTGGTGATGG - Intronic
918361863 1:183767416-183767438 TAAAATACAAAAGCACGTGACGG + Intronic
920603752 1:207358197-207358219 TTGGAAACATAAGCTGTTGAGGG + Intronic
921526437 1:216224002-216224024 TAGGACACCAAGGCTGGTTAGGG - Intronic
921877981 1:220220558-220220580 TAGGAGGCAAAAGCTGAAGATGG + Intronic
923784379 1:237053535-237053557 GAGGATACGGAAACTGGTGAAGG + Intronic
924143501 1:241050180-241050202 CAGGATAAAAAACCTGGGGAAGG - Intronic
1065540038 10:26754767-26754789 TATGCTAGAAAAGCTGTTGATGG - Intronic
1066005825 10:31145366-31145388 CAGAATTCACAAGCTGGTGATGG - Intergenic
1068446109 10:57125818-57125840 TAGGAAAGAAAAGAAGGTGAGGG - Intergenic
1070492192 10:76987921-76987943 TAGAATACTAAAGTTGGTGGTGG + Intronic
1071008379 10:80910079-80910101 TTGAATCCACAAGCTGGTGAAGG + Intergenic
1071260805 10:83917254-83917276 AAGGATTCAAAAGCCGATGATGG - Intergenic
1072889015 10:99304975-99304997 TAGGAAACAAAGACTGGTTAGGG + Intergenic
1073455924 10:103636731-103636753 TAGGACAAAACAGCTGGTGGGGG + Intronic
1073873855 10:107898711-107898733 TAGGGTTCAAGAGCTGGGGAGGG - Intergenic
1073902029 10:108233502-108233524 TGGAAGACAAAATCTGGTGAGGG - Intergenic
1078521908 11:12070343-12070365 TGGGATCCAAAAACTGGTGAGGG - Intergenic
1079291882 11:19195769-19195791 TAGGATACATTAGTTTGTGAAGG - Intronic
1079897617 11:26141532-26141554 TCCTTTACAAAAGCTGGTGATGG + Intergenic
1090165900 11:124546556-124546578 TAGGAGACAACAGCTGCTGGGGG + Intergenic
1090236793 11:125154332-125154354 TAGGATAGATAAGCTGGTGGAGG - Intergenic
1091270205 11:134305253-134305275 TAGGGTGCACAAGCTGGTGAAGG - Intronic
1091987124 12:4919820-4919842 CAGGAAACAAAAGCGGGGGAGGG - Intronic
1092339409 12:7662615-7662637 AAGGAGACAAAAGGTGGTGGGGG + Intronic
1092774241 12:11928536-11928558 CACGATACAAAAACAGGTGAGGG + Intergenic
1096761259 12:53843838-53843860 GAGGATACAAAGACTGGAGAAGG + Intergenic
1097582667 12:61477596-61477618 AAGGATACAAAACCTTGTAAAGG - Intergenic
1097709582 12:62903268-62903290 TAAGATAAAACAGCTGGTGAAGG + Intronic
1099134334 12:78876500-78876522 TAGGATACAAAAGAGCCTGATGG - Intronic
1101366524 12:104076626-104076648 TATAATACAAAATCTGGTCAGGG - Intronic
1103637415 12:122318945-122318967 AAGGATACAAAAGCTAGAGCAGG + Intronic
1104797306 12:131528628-131528650 GAGGATTCAATATCTGGTGAGGG + Intergenic
1105801909 13:23912732-23912754 TTAGTTACAAAAGCAGGTGATGG + Intergenic
1108062655 13:46548847-46548869 AATGATACAACAGCTGGTCATGG - Intergenic
1108863959 13:54899187-54899209 GCAGATACATAAGCTGGTGAAGG - Intergenic
1109811248 13:67515430-67515452 AAGGTTAAAAATGCTGGTGAGGG - Intergenic
1110093867 13:71490417-71490439 AAGGAAAGAAAAGCTGGAGAGGG + Intronic
1114809293 14:25877851-25877873 TAGTGTACAAAAGCTTGTTATGG - Intergenic
1121186124 14:91971440-91971462 TAGGATACAAAAGCTGGTGATGG - Intronic
1121458014 14:94051412-94051434 TCGGAGACAAAAGCAGATGAAGG - Exonic
1122274752 14:100585844-100585866 TATGAGACAAAAGCTGGGGAGGG + Intronic
1125485780 15:40109800-40109822 CAGAATACAAAGGCTGGAGAAGG + Intergenic
1126425328 15:48521480-48521502 TAGGATACAATAGCTCTAGAAGG + Intronic
1128921416 15:71613667-71613689 CAGAACACAATAGCTGGTGAAGG - Intronic
1128957934 15:71969247-71969269 TTGAATACAAAAGCAGGTCAAGG - Intronic
1129874506 15:78964508-78964530 AAGGAGACAAAAGCAGGAGATGG + Intronic
1130437299 15:83913956-83913978 TAGGATCCAAAAGGGAGTGAAGG + Intronic
1131433587 15:92405742-92405764 TTGGATACACAAGCTGGAGGTGG + Intronic
1133524817 16:6594415-6594437 TGAGATACAAAAGCAGGTGGTGG + Intronic
1136207795 16:28737301-28737323 AGGGATACAAAAGCTGCGGAAGG - Intergenic
1138745549 16:59359460-59359482 GAGACTATAAAAGCTGGTGAAGG - Intergenic
1139096789 16:63714336-63714358 TAGTATAATACAGCTGGTGAAGG + Intergenic
1145061333 17:19736227-19736249 TTGGGAACACAAGCTGGTGAGGG + Intergenic
1146004194 17:29150453-29150475 TAGGATTCCAGAGCTGGTGGTGG + Intronic
1149453124 17:56765798-56765820 TAGGATACCCCAGCTGGAGAGGG - Intergenic
1151521146 17:74630629-74630651 GAGGAAACAACAGCTGGAGAGGG + Intergenic
1154461257 18:14590162-14590184 TAGGAGAGAAAAGATGGTAAAGG - Intergenic
1156804139 18:41156189-41156211 TAGGTTTCAAATTCTGGTGATGG + Intergenic
1159677544 18:71304509-71304531 TAGAAAACAAAAGCTAGGGAAGG + Intergenic
1164559714 19:29282130-29282152 TAGAATTCAAAAGCTGGTTTTGG + Intergenic
926575217 2:14572584-14572606 TAGGATACAACAGCCAGTGCTGG - Intergenic
929329021 2:40656967-40656989 TAAGCTGTAAAAGCTGGTGAAGG - Intergenic
930686353 2:54312607-54312629 TAGGAAACAAAAACTGATGATGG - Intergenic
931269695 2:60690507-60690529 TAGGATACAATCTCAGGTGAAGG - Intergenic
931461048 2:62450455-62450477 AAGGCTTCAAAAGGTGGTGAAGG + Intergenic
931899415 2:66771015-66771037 AAGGATACAAGAGCTAGGGAAGG + Intergenic
932411382 2:71549904-71549926 TAGGAGACAGAAGGTGTTGAAGG + Intronic
940338365 2:152552818-152552840 TAGGATTTAAATGGTGGTGAGGG + Intronic
940440368 2:153708105-153708127 TAGAATACAGAAATTGGTGACGG - Intergenic
940601546 2:155868165-155868187 TGGGTTACAAAAGATTGTGATGG - Intergenic
940803371 2:158157110-158157132 TTGGTAACAAAAGATGGTGAAGG + Intergenic
940940940 2:159559595-159559617 TAGGATAAAAAAACTAGTAAAGG + Intronic
942506400 2:176645991-176646013 TAGGAAAAAAATGCTGCTGAAGG - Intergenic
944068786 2:195647147-195647169 AAGGGTACAAAGGCTGGAGATGG - Intronic
944960974 2:204873575-204873597 TAGAATACAAATGCTTTTGAGGG + Intronic
945775144 2:214097618-214097640 TAGGAAAGGACAGCTGGTGAAGG + Intronic
947808963 2:232987945-232987967 TAGGAGACCCAAGCTGGAGAAGG + Intronic
948308962 2:236970924-236970946 TAGGATGCAAAGGCTGGGGCTGG + Intergenic
1170373161 20:15671601-15671623 CAGGATACTAAAGCTGGAGGGGG - Intronic
1170471204 20:16669955-16669977 TAGGATGCAGAAGCTGAGGAGGG + Intergenic
1175334503 20:58186271-58186293 TGGGATCCAAGAGGTGGTGAAGG + Intergenic
1176813250 21:13567686-13567708 TAGGAGAGAAAAGATGGTAAAGG + Intergenic
1177759534 21:25388058-25388080 TAGGAAACAAGATCTGGTTAGGG - Intergenic
1181008858 22:20028624-20028646 TATTATACAAAAGCTAGTGGAGG + Intronic
1182607886 22:31521260-31521282 AAGGCTACAATTGCTGGTGATGG - Intronic
951862764 3:27272390-27272412 GCAGATACAAGAGCTGGTGAGGG - Intronic
953710560 3:45266248-45266270 TAGGATTCTAAGGCTGATGAAGG - Intergenic
954766403 3:52921209-52921231 CAGGATAAAAAAGCTGCTCAGGG + Intronic
955880122 3:63534778-63534800 GAGGATGCAAAAGTTGGAGAAGG + Intronic
956323374 3:68024258-68024280 TAGGAAACAAAACCTTGTAAGGG + Intronic
956762134 3:72452921-72452943 CAGGTTGCAAAATCTGGTGAAGG - Intergenic
959072166 3:101712785-101712807 GAAGTTACCAAAGCTGGTGAGGG + Intergenic
960288245 3:115853790-115853812 TAGGATAGAGCAGCTGGGGAGGG + Intronic
962069637 3:132020132-132020154 TGGGAGACAAGAGCTTGTGAAGG + Intronic
965465247 3:169021632-169021654 TAGGACCTAAAAGCTGGTGTTGG + Intergenic
965552317 3:169979709-169979731 TTAGATACAAAGGCTGATGAAGG - Intronic
967188009 3:186961791-186961813 AAGGATACAAGAGCTGGCTAGGG + Intronic
969064324 4:4466369-4466391 TAGGATGGAAAAGTGGGTGAGGG + Intronic
970623618 4:17852592-17852614 TAGGAAACTAATGCAGGTGAGGG + Intronic
970913721 4:21308446-21308468 GAGGAAACAAAGGCTTGTGAAGG + Intronic
974930839 4:68359209-68359231 CAGGGTACAATATCTGGTGAGGG - Intergenic
978350727 4:107818156-107818178 TAGGAAATAAAAGATGGTCAGGG - Intergenic
979924404 4:126542601-126542623 TACAATACAAAAGCAGCTGAGGG + Intergenic
980555578 4:134399361-134399383 TAGTATACATAAGTTGTTGATGG - Intergenic
980720073 4:136683971-136683993 CAGGATGCAAAAGCTTATGATGG + Intergenic
984758928 4:183347564-183347586 TAGAATACAAAAGCAGAAGAAGG + Intergenic
984966843 4:185146789-185146811 GTGGAAACAAATGCTGGTGAGGG - Intronic
985089480 4:186348680-186348702 AAGGAGACAGAAGCTGGGGAGGG - Intergenic
990275844 5:54195367-54195389 AAGGTTACAAAACATGGTGATGG + Intronic
991301785 5:65135351-65135373 GAGGATAAAAAAGTTGGTGTTGG - Intergenic
994909063 5:105878240-105878262 TAAGATAGAAAAGCTGGGAATGG + Intergenic
995495027 5:112732657-112732679 TATGAGACAAAATCAGGTGAGGG + Intronic
1001717392 5:173827717-173827739 TAGGATACAGAAGGTGGGAAAGG + Intergenic
1002707315 5:181170483-181170505 TAGGAGAGAAAAGCTGCTGTCGG - Intergenic
1003852225 6:10236970-10236992 CAGGAGACAAAGGCTGGGGAAGG - Intergenic
1003870664 6:10400076-10400098 TAGGATACAAAAACTGATATAGG + Intronic
1005468317 6:26137018-26137040 TAGAATATAAAAGCTGGGGTCGG - Intronic
1006547767 6:34793313-34793335 TGAGATACAAAGGCTGGTTAAGG - Intronic
1007687928 6:43678221-43678243 TAGGCTACCGAAGATGGTGATGG + Intronic
1010469068 6:76204284-76204306 TAAGATACAAAAGCTAGGGCAGG + Intergenic
1011269440 6:85561966-85561988 TAGGATAAAAAAACTGCTTATGG - Intronic
1011329765 6:86190902-86190924 TGGGCTACCAAAGCTGGTGAGGG + Intergenic
1011535981 6:88376549-88376571 TAGGATACAACAGTGTGTGATGG - Intergenic
1012930135 6:105307994-105308016 AAGGATGCTAAAGATGGTGATGG - Intronic
1013763005 6:113540074-113540096 TAGGAAACAGGAGCTGGTGTGGG - Intergenic
1014403649 6:121022254-121022276 TAGGATACAAAAGCAGTAGTAGG - Intergenic
1017246074 6:152226727-152226749 TTGGGTAAAAGAGCTGGTGAGGG + Intronic
1017375144 6:153760173-153760195 TAAGCTACCAGAGCTGGTGATGG - Intergenic
1017804993 6:157937546-157937568 TAGAAGACAACAGCAGGTGAAGG + Intronic
1019874102 7:3793554-3793576 AAGGATACAAAAGCTGTAAAGGG - Intronic
1021648775 7:22812374-22812396 TAGGATTCAAATACAGGTGAAGG + Intergenic
1027496926 7:78899511-78899533 TAGGAAACTAAAGCTTATGAAGG - Intronic
1029340877 7:99943759-99943781 GAGGAGACTAAAGTTGGTGATGG + Intergenic
1031502684 7:122539627-122539649 TTGGTTACAAAGGCTGTTGATGG - Intronic
1033509240 7:142038338-142038360 TAGGAGACATGAGCTGGGGAAGG + Intronic
1034333501 7:150304832-150304854 CAGCATACAAAAGCTAGTGAGGG + Intronic
1034664542 7:152805058-152805080 CAGCATACAAAAGCTAGTGAGGG - Intronic
1035822198 8:2605500-2605522 CAGGATACACAGGCTGATGATGG + Intergenic
1039289792 8:36082033-36082055 TAGAAAGGAAAAGCTGGTGAGGG - Intergenic
1041732845 8:61079676-61079698 TGAGTTACAAAAGCTGATGAAGG + Intronic
1042699668 8:71598455-71598477 GAGGACACAAAAGATGATGATGG + Intergenic
1046506496 8:115144629-115144651 GAGGAAACAAAAGATGGAGAAGG - Intergenic
1048491936 8:134902081-134902103 GAGGCTACAAAAGCAGGTGAAGG - Intergenic
1055711795 9:79071501-79071523 GAGGATACAAAAGCATGAGAAGG - Intergenic
1055838209 9:80470571-80470593 TAAGCTACAAATGTTGGTGAGGG + Intergenic
1056009613 9:82313444-82313466 TAGGACACCAAGGCCGGTGATGG + Intergenic
1057038833 9:91833013-91833035 TGGTACACAAAAGCAGGTGAGGG + Intronic
1057730243 9:97602212-97602234 TGGGATCCCAAAGCTGCTGAGGG - Exonic
1061356378 9:130108693-130108715 AAGAAAACAAAAGCTGGTGCAGG - Intronic
1185581598 X:1213997-1214019 TAGGAAAGAAAAGCTGGGCACGG - Intergenic
1187340361 X:18415596-18415618 GAGGATCCAGCAGCTGGTGAGGG - Intergenic
1188143239 X:26578175-26578197 TAGAGTAATAAAGCTGGTGAGGG + Intergenic
1188462870 X:30448862-30448884 TAGGATAAAAAATGTGATGAAGG - Intergenic
1192040706 X:67618357-67618379 TAGGATTCAAAAGTTGTTCAGGG + Intronic
1192510883 X:71719732-71719754 TGGGATGCAGAAGGTGGTGACGG - Intergenic
1192515814 X:71761821-71761843 TGGGATGCAGAAGGTGGTGACGG + Intergenic
1192699218 X:73449538-73449560 TTGGATAGAAAATCTTGTGACGG - Intronic
1195464062 X:105160134-105160156 CAGGCAACAAAAGTTGGTGAAGG - Intronic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198810551 X:140531701-140531723 TAGTATACATAAGGTGGTGTGGG - Intergenic
1200773043 Y:7144882-7144904 TAGGGTAAAAAAACTGGTTAGGG - Intergenic
1201667749 Y:16478120-16478142 TAGAATACAAAATTTGGTGGAGG - Intergenic