ID: 1121190643

View in Genome Browser
Species Human (GRCh38)
Location 14:92026466-92026488
Sequence GGCTGCGGCGAGCAAGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 2, 1: 2, 2: 4, 3: 30, 4: 379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121190643 Original CRISPR GGCTGCGGCGAGCAAGGAGG CGG (reversed) Intronic
901198080 1:7451466-7451488 GGCTTCGGAGAGCAGGGATGGGG - Intronic
902156629 1:14492907-14492929 GGCTGCAGCGAGCAAGTGGTGGG - Intergenic
902662597 1:17915573-17915595 GGCGGGGACAAGCAAGGAGGGGG - Intergenic
903224131 1:21885304-21885326 GGCTGCAGTGAGCAGGGAGCTGG - Exonic
903652586 1:24930618-24930640 GGCCGCGGCCAGCGGGGAGGAGG - Intronic
904379396 1:30101075-30101097 GGCTGCCCCGAGGAAGGAGGGGG - Intergenic
904392478 1:30195124-30195146 GGCTGCTGCTAGAAAGGATGGGG - Intergenic
904398555 1:30240481-30240503 GGCTGCAGGGAGAAAGGAGACGG - Intergenic
905205214 1:36339466-36339488 GGCTGCGGGGAGCAGGGAGGGGG + Intergenic
905297352 1:36962571-36962593 GCCTGAGGCGAGCAAGCAGACGG + Intronic
905367964 1:37465565-37465587 GGTTGCAGTGAGCCAGGAGGCGG + Intergenic
907312677 1:53548044-53548066 GGATGCGGCCAGCAGGGAGGCGG - Intronic
910788033 1:91021771-91021793 GGCGGCGGCGGCCGAGGAGGCGG - Intronic
911208622 1:95117558-95117580 GGCTGCGCCGAGCCGGGAGAGGG - Exonic
912270139 1:108200274-108200296 GGCTGCGGCGCGCAGGGCGCAGG + Exonic
912890770 1:113527240-113527262 GGCGGGGGCGGGCAGGGAGGAGG + Intronic
914803056 1:150974469-150974491 GGCCGGGGCGAGGAGGGAGGCGG - Intronic
914825845 1:151137699-151137721 GGCTGGGGAGGGTAAGGAGGTGG - Exonic
915344890 1:155192448-155192470 GGCTGCTGCAGGGAAGGAGGCGG - Intronic
915631139 1:157154884-157154906 GGCTGTGGCCACCAAAGAGGAGG - Intergenic
915911896 1:159920526-159920548 GGCTGCGGGGAGCTAGGGAGAGG + Exonic
919667058 1:200302351-200302373 GGCTGCTGCGACCCGGGAGGGGG + Intergenic
922584818 1:226725667-226725689 GGCTGGAGTGAGCAAGGAGGGGG - Intronic
922616862 1:226965790-226965812 CGCTGCGGCCTGCATGGAGGTGG + Intronic
923647790 1:235841694-235841716 GGCTGGGGCGGGGAAGCAGGAGG + Intronic
1064079203 10:12294685-12294707 GGGTGCTGCAACCAAGGAGGTGG - Intergenic
1065099759 10:22321378-22321400 GGCGGCGGCGGCCGAGGAGGAGG + Exonic
1065188760 10:23192518-23192540 TGCGGCGGCGAGCATGGACGCGG + Exonic
1068089150 10:52411118-52411140 GCCGGCGGCGGGCAAGGATGCGG + Intergenic
1071423932 10:85529368-85529390 CTCTGAGGTGAGCAAGGAGGAGG - Intergenic
1071526568 10:86362990-86363012 GGTTGCGGGGAGCAAGGCAGAGG + Intronic
1071729468 10:88233306-88233328 GGCTGCTGAGGGCAAGGAAGGGG + Intergenic
1072107884 10:92291284-92291306 GGCGGCGGAGAGCGAGGAGGAGG - Exonic
1073084989 10:100882605-100882627 TGCTGGGGAGAGCAGGGAGGGGG + Intergenic
1073115685 10:101090194-101090216 GGCTGCCCTGAGCAAGGGGGCGG - Exonic
1074998221 10:118775776-118775798 GGCTGCGGGGAGGGAGGAGTAGG - Intergenic
1075768907 10:124917108-124917130 GGCGGCGGCGCGAAGGGAGGCGG + Intergenic
1075825881 10:125356736-125356758 GGCTGGGCAGAGCAGGGAGGAGG - Intergenic
1076857612 10:133124891-133124913 GGCGGCGGCGAGAAAAGCGGCGG + Intronic
1077170491 11:1163861-1163883 GTCTGCGGCAAGCACAGAGGCGG - Exonic
1077503731 11:2920661-2920683 GGCTGAGGAGGGGAAGGAGGGGG + Intronic
1080902636 11:36510273-36510295 GGCTGCGGGGAGCGAGGGGCAGG + Intergenic
1081725566 11:45325564-45325586 GGCTGGGGGGAGCGAGGAGTGGG - Intergenic
1081831961 11:46121655-46121677 GGCCGCGGCGGGGAGGGAGGGGG + Intergenic
1083176428 11:60952671-60952693 GGCTGCTGTGAGGAAGGAAGTGG + Intergenic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1083680516 11:64349593-64349615 GGCGGCGACCAGCAAGGAGGAGG + Exonic
1083821019 11:65171418-65171440 GGCTGCAGCCGGCAAGGTGGGGG + Exonic
1083962255 11:66021018-66021040 GGGTGCGGGGAGCAGGGATGGGG - Intronic
1084527490 11:69705850-69705872 GGCTGATGCGATCAGGGAGGTGG + Intergenic
1084659887 11:70540468-70540490 GGCTCCCGCGGGCAGGGAGGAGG - Intronic
1084860484 11:72014754-72014776 GGCTGCCACCAGCAAAGAGGTGG - Exonic
1084876161 11:72135418-72135440 TGCTGCGGGAGGCAAGGAGGTGG - Intronic
1084881026 11:72171897-72171919 TGCTGCGGGAGGCAAGGAGGTGG - Intergenic
1085034639 11:73292667-73292689 GGCTTAGAGGAGCAAGGAGGTGG - Intronic
1085199591 11:74693692-74693714 GGCTGAGGCCAGGTAGGAGGTGG - Intergenic
1085266388 11:75240473-75240495 GACTGCGGAGAGCAGGCAGGTGG - Intergenic
1086846539 11:91756507-91756529 GGCTGCGGTGAGCTATGATGTGG + Intergenic
1089455795 11:118625111-118625133 GGCTGAAGTGAGCAAGGAGGAGG - Intronic
1089556244 11:119317222-119317244 GGCTGCGGCGCGCGGGGCGGGGG - Intronic
1092229154 12:6767091-6767113 GGCAGCGGGGCGCAGGGAGGGGG - Intronic
1093459427 12:19394913-19394935 GGCTGCGGTGAGCAAGCATTGGG + Intergenic
1094213932 12:27921003-27921025 GGCTCCGACCATCAAGGAGGAGG - Intergenic
1096713368 12:53474979-53475001 CGCTGTGGCGAGCGAGGGGGTGG - Intronic
1099989690 12:89709052-89709074 GGCTGCGGCGCTCACGGAGGTGG - Intronic
1100598695 12:96093594-96093616 GGCTTCATTGAGCAAGGAGGGGG + Intergenic
1101409450 12:104456895-104456917 GCCTGCGGAGAGCCGGGAGGAGG - Intronic
1101641238 12:106586895-106586917 GGCTTGGGAGAGCAAGGAGCCGG + Intronic
1102298590 12:111755654-111755676 GGCTGCAGCCTGTAAGGAGGAGG - Exonic
1102947101 12:116999538-116999560 GGCAGGGGCGAGCCAGGAAGGGG - Intronic
1103386228 12:120534596-120534618 GGCAGCGGCGACCGAGGACGAGG - Exonic
1103563360 12:121803919-121803941 GGAAGCGGCGAGGAAGGAGAGGG + Intergenic
1103942198 12:124507188-124507210 GGCTGGGGAGAGCGAGGAAGGGG + Intronic
1104016095 12:124963347-124963369 GGCTGGGGCGGGGAAGAAGGGGG + Intronic
1104843165 12:131834279-131834301 GGCTGCCGGGAGGAGGGAGGAGG - Intronic
1104934729 12:132358396-132358418 GGCTGCTGTGAGCGTGGAGGGGG - Intergenic
1104946487 12:132417024-132417046 GGCTGCCGCCAGCAAGGGGGTGG - Intergenic
1105037103 12:132933523-132933545 GGCTGCAGCGAGGAAGGAGCTGG - Intronic
1105601809 13:21894303-21894325 GGCTGTGGCGCTCCAGGAGGGGG + Intergenic
1106447581 13:29850345-29850367 GGCGGCGGCGGGGAAGGCGGAGG - Exonic
1107435307 13:40376332-40376354 GGCTGCGGCAAGGAAGCATGTGG + Intergenic
1108229558 13:48321387-48321409 GGCAGCGGCGCGCGGGGAGGCGG - Intronic
1110558635 13:76886732-76886754 GGCTGGGGCGAGAGGGGAGGGGG - Intergenic
1111455612 13:88479665-88479687 GGCTGCAGTGAGCTATGAGGTGG + Intergenic
1112507103 13:99981809-99981831 GGCGGCGGCGCGGGAGGAGGAGG - Exonic
1113695899 13:112345208-112345230 GGCTGCGGAGGGCAGGGTGGTGG - Intergenic
1113849307 13:113408971-113408993 GGCTGCAGAGAGGAGGGAGGAGG + Intergenic
1114558945 14:23577666-23577688 GGGAGCGGCGGGCAAAGAGGAGG - Intronic
1115592210 14:34874959-34874981 GGCGGCGGCGGGCGAGGAGCCGG - Intronic
1117278995 14:54219496-54219518 GGCTGCGGAGAGCAAGGGTCAGG - Intergenic
1118767073 14:68917019-68917041 GGGTGCTGTGAGCATGGAGGTGG - Intronic
1119644382 14:76337945-76337967 GGCTGCAGGAAGGAAGGAGGAGG - Intronic
1120815000 14:88846960-88846982 GGGTGGGACGAGCAAGGAGGAGG - Intronic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1121473434 14:94174207-94174229 GGCCGAGGCGGGCAAGGTGGCGG + Intronic
1122263680 14:100537057-100537079 GGCTGCAGAGAGCAAGGCTGGGG + Intergenic
1122290478 14:100678085-100678107 GGCTGTGGCGAGCCAAGGGGCGG - Intergenic
1122453175 14:101828232-101828254 GGCTGCGGGGAGGGAGGAAGGGG + Intronic
1122812366 14:104295389-104295411 GGTTGCGGAAGGCAAGGAGGAGG + Intergenic
1124922308 15:34038901-34038923 GGCGGCGGCGGGGACGGAGGCGG - Exonic
1125890279 15:43260481-43260503 GGCCCCGGCGAACAAGCAGGTGG + Exonic
1125917117 15:43497706-43497728 GGCTGCCAGGAGCTAGGAGGAGG + Intronic
1127499520 15:59543463-59543485 GGCTGCGCCGAGGAAGAGGGAGG + Intergenic
1128078237 15:64841633-64841655 GGCTGCGGCGGGGGAGGAGAGGG - Intergenic
1128081989 15:64862274-64862296 GGCAGGGGCCAGGAAGGAGGTGG + Intronic
1128242895 15:66113489-66113511 CACTGCAGCGGGCAAGGAGGGGG - Intronic
1128987310 15:72230868-72230890 GGCTGGGGCGGGAAAGGAGCCGG + Intronic
1129082278 15:73052053-73052075 GGCTGCGGCGAGCGGGCGGGAGG + Intronic
1129461426 15:75701895-75701917 GGCTGTGGGGAGGGAGGAGGAGG - Intronic
1129723407 15:77889912-77889934 GGCTGTGGGGAGGGAGGAGGAGG + Intergenic
1129947011 15:79547965-79547987 GCCTGCTGGGACCAAGGAGGCGG + Intergenic
1130224415 15:82046316-82046338 GGCTGCGGCGAGCGCGGGGGTGG - Intergenic
1130654751 15:85784670-85784692 GGCTGCAGCCAGCAAGGAAATGG + Intronic
1132599891 16:768739-768761 GGCTGGGGCCAGCAAGGGAGTGG - Exonic
1133058313 16:3158521-3158543 GGCTGCGGCCCGCGGGGAGGTGG - Intergenic
1133327256 16:4949279-4949301 GGGTGCAGAGAGCACGGAGGAGG - Intronic
1133439949 16:5812747-5812769 GACTGGGCCGAGCAAGGTGGTGG - Intergenic
1134091898 16:11396001-11396023 GGCTGCTGGGAGTAAGGAGGGGG + Intronic
1134208871 16:12259489-12259511 AGCTGCGGGGAGCCAGGTGGGGG - Intronic
1134649578 16:15898137-15898159 GGCTGGGAGGAGGAAGGAGGAGG - Intergenic
1135396918 16:22138589-22138611 GGCTGGGGCCAGCAGGGATGGGG + Intronic
1135421254 16:22307107-22307129 GGCCGCTGTGAGCACGGAGGAGG - Intronic
1135517615 16:23148939-23148961 GGCGGCGGCGGGCACGGCGGCGG + Exonic
1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG + Exonic
1136576082 16:31126234-31126256 GGCTGCTGATAGCAATGAGGAGG + Intronic
1137237315 16:46626350-46626372 GGCTGGGGAGAGCAAGGAGGTGG + Intergenic
1137388795 16:48064508-48064530 GGCTGTGGGGAACAAGGATGCGG - Intergenic
1138539547 16:57679975-57679997 GGATGCAGGGAGCAAAGAGGAGG - Intronic
1138595129 16:58025738-58025760 GGCCGCGGCGCGCGGGGAGGAGG + Exonic
1141173255 16:81704263-81704285 GGGTGAGGGGAGCAGGGAGGAGG - Intronic
1141173304 16:81704386-81704408 GGGTGAGGGGAGCAGGGAGGAGG - Intronic
1141620578 16:85234997-85235019 GGATGCGAGGAGCCAGGAGGGGG - Intergenic
1142243884 16:88959648-88959670 AGCTGCTGGGAGGAAGGAGGAGG - Intronic
1142810930 17:2395195-2395217 GGCTGCCGCGGGCAAGGGTGGGG + Exonic
1145018404 17:19413168-19413190 GGAGGCGGGGAGCAAGGATGGGG + Intronic
1145285935 17:21506065-21506087 GGCTAGGGGGAGCAAGGAGATGG - Intergenic
1145733306 17:27210137-27210159 GGCTGCTGCGAGCTATGATGAGG - Intergenic
1146149907 17:30458531-30458553 GGCGGCAGGGAGCAGGGAGGTGG - Intronic
1146182755 17:30708373-30708395 GGCAGCGACGTGCAAGGGGGAGG - Intergenic
1147458176 17:40551700-40551722 GGTTGCAGCCAGCAAGGATGAGG + Intergenic
1147629074 17:41918563-41918585 GGGTGAGGCGCGCCAGGAGGGGG + Intronic
1147714775 17:42498147-42498169 GGCTGAGGCAAGGCAGGAGGTGG + Intronic
1147957693 17:44146016-44146038 GGCTGCCGGGGGCAGGGAGGTGG - Intronic
1148617850 17:49013959-49013981 GGCCGCAGCGCGCAAGGAAGGGG - Intronic
1150692475 17:67377925-67377947 GGCCTCGGCGAGGGAGGAGGCGG + Intronic
1151869505 17:76826876-76826898 GGCTGGGGCGTGCATGTAGGGGG + Intergenic
1151877051 17:76872830-76872852 GCCTGCGGAGAGGAAGGAGGCGG - Exonic
1152158041 17:78647758-78647780 GGCTCCGGAGGGCAGGGAGGGGG + Intergenic
1152222215 17:79075072-79075094 GGCGGCGGCCGGGAAGGAGGTGG + Exonic
1152432627 17:80257785-80257807 GGCTGGGGCGGGGAAGCAGGTGG + Intergenic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1152745629 17:82037401-82037423 CGAGGCGGCGAGCCAGGAGGGGG - Intronic
1153006223 18:500641-500663 GGCGGCGGCGAGGGAGGACGGGG - Exonic
1153900770 18:9614941-9614963 GGCTGCGGCTGGCAGGGCGGTGG - Intronic
1154138660 18:11803230-11803252 GGCTGTGGGGAGGAAGGAGTTGG - Intronic
1155507767 18:26549002-26549024 GGCTCCGGGGGGCAATGAGGGGG - Exonic
1160408638 18:78659931-78659953 GGCTGCGGCTGGCCAGGTGGTGG + Intergenic
1160710142 19:547639-547661 GGCTGCGGTGTGGAAGGAGCTGG - Intronic
1160724239 19:610596-610618 GGCAGCGGGAAGCAAGGCGGGGG - Intronic
1161086009 19:2335174-2335196 GGATGCGGTGGGAAAGGAGGCGG - Intronic
1161086063 19:2335359-2335381 GGATGCAGTGAGAAAGGAGGCGG - Intronic
1161101565 19:2424415-2424437 GGCTGCAGGGAGCGAGGATGGGG - Intronic
1161216687 19:3098282-3098304 GGCGGCGGCGCGGACGGAGGCGG - Intronic
1161263639 19:3352267-3352289 GGCTGCGGTGAGCCATGATGAGG + Intergenic
1161513272 19:4683280-4683302 GGCGGTGGCGGGCAATGAGGAGG + Intronic
1161520287 19:4720020-4720042 GGCTGCCTGGAGCAATGAGGAGG - Intronic
1161730804 19:5959447-5959469 GGCTTCGGGGAGCATGGTGGGGG - Intronic
1161967127 19:7555042-7555064 GGCTGCGGCGCGAAAAGAGGCGG - Exonic
1162034676 19:7932557-7932579 GGCTGCGGCGGGGGAGGTGGTGG + Intronic
1162494309 19:11014579-11014601 GGCAGAGGGGAGCCAGGAGGTGG - Intronic
1162589000 19:11578596-11578618 GGCGGCGCCCAGCACGGAGGAGG - Exonic
1162607279 19:11719366-11719388 GGCTGAGGAGAGCAAGGAAAAGG + Intergenic
1162778649 19:12995601-12995623 GGCAGCGGCGAGCGCGGCGGCGG + Exonic
1162935109 19:13978296-13978318 GGCTGGGGCCAGCAAGGGTGGGG + Intronic
1162950644 19:14070357-14070379 GGACGCGGCGACCAAGGAGGAGG - Intergenic
1163271696 19:16258511-16258533 GGCTGTGGGGAACCAGGAGGGGG - Intergenic
1163585510 19:18161455-18161477 GGCGGCGGCGAGGACGGCGGCGG - Exonic
1163783414 19:19261943-19261965 GGCCGGGGCGGGCAGGGAGGGGG + Intronic
1165706602 19:37980604-37980626 GGCTGAGGCCAGGGAGGAGGGGG + Intronic
1166097364 19:40549263-40549285 GGAGCCGGCGAGCAAGGAGCTGG + Exonic
1166457981 19:42960052-42960074 GGCTGCTGCAGCCAAGGAGGTGG + Intronic
1166852865 19:45768760-45768782 GGCGGCGGCGACCGAAGAGGAGG - Exonic
1166997750 19:46727908-46727930 GGCTGGGGTGTGCCAGGAGGCGG + Exonic
1167240310 19:48339443-48339465 GGGTGCGGGGAGCAAGGTGCGGG - Intronic
1168009839 19:53521297-53521319 GGGAGCGGCGAGCAGGGAAGTGG + Exonic
925388419 2:3479404-3479426 GGCTGTCGCCGGCAAGGAGGGGG + Exonic
925419953 2:3703721-3703743 GGCCCCGGCGAGCGAGGAGCGGG + Exonic
925473053 2:4183353-4183375 GGCTGCAAGGAGGAAGGAGGAGG + Intergenic
926186320 2:10693561-10693583 GGTTGCAGTGAGCCAGGAGGTGG + Intergenic
927787262 2:25982452-25982474 GGCGGCGGCGGGGAAGGCGGAGG - Exonic
927846525 2:26475171-26475193 GGCTGCCGCAAGCAGGCAGGAGG + Intronic
927964777 2:27262250-27262272 GGGGGCGGCGAGGAAGGAGCAGG - Intronic
928421121 2:31138407-31138429 GGCGGCAGCGGGCAAGGCGGCGG - Intronic
929688403 2:44054514-44054536 GGCTGCGGCGAGCTGTGATGGGG - Intergenic
932463553 2:71898581-71898603 GGCTGCGGGAAGCCTGGAGGTGG - Intergenic
935592482 2:104855375-104855397 GGCGGGGGCGGGGAAGGAGGGGG + Intergenic
935938254 2:108209794-108209816 GGGTGCTGCAACCAAGGAGGTGG - Intergenic
936241314 2:110790808-110790830 GGCTGGGAGGAGCCAGGAGGAGG - Intronic
937412032 2:121685100-121685122 AGCTGCCGGGAGCAAGGTGGTGG + Intergenic
937905743 2:127052027-127052049 GGCTGGGGTGGGCAAGCAGGAGG + Intronic
939921662 2:148122991-148123013 GGCTGGGGTGAGCAATGAAGAGG + Intronic
941292483 2:163694470-163694492 GGATGGGGCAAGCAAGAAGGAGG + Intronic
941706209 2:168661031-168661053 GGCAGCGGGGAGCAGAGAGGCGG + Intronic
942450941 2:176107703-176107725 GGCCGCGGCGGCCGAGGAGGCGG + Exonic
942992722 2:182221125-182221147 GGCTGTGGAGAGGGAGGAGGAGG - Intronic
946019812 2:216633401-216633423 GGCTGCGGCGGCGAGGGAGGAGG + Exonic
946041709 2:216788332-216788354 GGGTGGGGTGAGCAAGGGGGAGG + Intergenic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
948227024 2:236319116-236319138 GGCTGCGATGAAGAAGGAGGAGG - Intergenic
948436782 2:237959192-237959214 GGCTGCAGAAAGCAAGGAAGGGG - Intergenic
948742139 2:240055110-240055132 GGCTGGGGAGTGCAAGAAGGGGG + Intergenic
948772311 2:240257992-240258014 GGCGGCGGAGAGCCAGGAGCGGG + Intergenic
948801592 2:240435772-240435794 GGCGGCGGCGGCCGAGGAGGCGG - Exonic
949034499 2:241810351-241810373 GGGGGCGGCGAGGAAGCAGGAGG - Intronic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1171426846 20:25054209-25054231 GGCTTCGGAGAGCATGCAGGTGG - Intronic
1174066449 20:47869079-47869101 GGCTGCGATGAGCCAGGCGGAGG - Intergenic
1174136570 20:48384391-48384413 GGGTGTGGCCAGCGAGGAGGCGG - Intergenic
1174163699 20:48569762-48569784 GGCTTCAGCCAGCAAGCAGGCGG + Intergenic
1174317459 20:49713751-49713773 GGCGGCGGCGGCCCAGGAGGCGG - Exonic
1175349637 20:58309306-58309328 GGCTGCGGCGAGAGGGGACGGGG + Intergenic
1175491648 20:59384289-59384311 GGAGGAGGCGAGCAGGGAGGAGG + Intergenic
1175798360 20:61786234-61786256 GCCTGGGGCCAGGAAGGAGGTGG - Intronic
1176112602 20:63417445-63417467 AGCTGCCGTGAGAAAGGAGGTGG - Intronic
1177136688 21:17311722-17311744 GGCTGAGGCAGGCCAGGAGGCGG + Intergenic
1178507129 21:33171372-33171394 GTCTGCGGCCAGCGAGGAGAGGG + Intergenic
1178616098 21:34134054-34134076 GGCTGAGGGTTGCAAGGAGGTGG + Intronic
1178784615 21:35641910-35641932 GGTCCAGGCGAGCAAGGAGGAGG - Intronic
1178880641 21:36447451-36447473 GGCTGCAGTCAGGAAGGAGGAGG - Intergenic
1179873286 21:44254522-44254544 GGATGAGGCGGGCAAGGAGGCGG - Intronic
1179926766 21:44539144-44539166 GGCTCCTGGGAGCAAGGAGGGGG + Exonic
1180175038 21:46083196-46083218 GGGTGCGTTGAGCAGGGAGGGGG + Intergenic
1180734995 22:18009803-18009825 GGCTGCTGCGAGCTATGATGAGG + Intronic
1180870578 22:19144532-19144554 GGCTGCGACGAGCAAGCAGCGGG - Exonic
1180947227 22:19702920-19702942 GTCAGCGAGGAGCAAGGAGGAGG + Intergenic
1181316615 22:21974723-21974745 GGCTGCCGGGAGCCAGGAGCAGG + Intronic
1182122124 22:27795017-27795039 GGGTGGGGGGAGCAAGCAGGAGG + Intronic
1182146932 22:28002286-28002308 GACTGCGGTGAACAAAGAGGTGG + Intronic
1184285959 22:43471657-43471679 GGCTGCGGAGAGGAGGGAAGAGG - Intronic
1184533736 22:45072499-45072521 AGCTGCGGCGGGGGAGGAGGCGG - Intergenic
1185101787 22:48844541-48844563 GGCTCCCGCGTGCTAGGAGGAGG + Intronic
950447423 3:13046419-13046441 GGCTGCAGGGAGCGAGGGGGTGG - Intronic
950530577 3:13550257-13550279 GGCTGTGGGGAGCATGGGGGTGG + Intronic
951334538 3:21405755-21405777 GGCTGCTGCCAGCCACGAGGTGG - Intergenic
951543785 3:23806509-23806531 GGCTGCGGCGGGGAATGGGGGGG - Intronic
952228744 3:31407178-31407200 GGCTGAGGCCAGCAAGGCAGAGG - Intergenic
952258533 3:31716437-31716459 GGCCTCGGGGAGCAGGGAGGAGG - Intronic
952887052 3:38018381-38018403 GGCTGCGTCCTGCCAGGAGGAGG - Intronic
953024887 3:39139073-39139095 GGCGGAGGGGAGCAAAGAGGGGG + Intergenic
954786760 3:53099043-53099065 TTCTGGGGTGAGCAAGGAGGTGG + Intronic
955221576 3:57027474-57027496 GTCTGCAGGGAGCAAGTAGGAGG + Intronic
956736708 3:72244082-72244104 TGCTGGGGAGAGCAAGGAGGTGG - Intergenic
959941652 3:112086989-112087011 GGCTGCGGCGAGGTGGGTGGAGG - Intronic
961243990 3:125435692-125435714 GGCTGCGGCCAACAAGCAGTTGG - Intergenic
961252655 3:125520067-125520089 GGCTGCGGTCGGCAAGGAAGCGG - Exonic
961305703 3:125958296-125958318 GGCTGCCGCGAGCTAGGCGCTGG + Intergenic
961734671 3:128993921-128993943 GGCTGCGGCGGCCGAGGTGGGGG + Intronic
961750434 3:129091042-129091064 GGCTGGGGAGAGCAAGGAGGTGG + Exonic
962932086 3:140048066-140048088 GACTGAGGGGAGAAAGGAGGAGG + Intronic
964303851 3:155319793-155319815 GGTTGCTGGGAGCCAGGAGGTGG - Intergenic
966912334 3:184566435-184566457 GGCTGTGGCAGGAAAGGAGGAGG + Intronic
967297308 3:187977974-187977996 TGCAGCTGCCAGCAAGGAGGTGG - Intergenic
967984857 3:195087081-195087103 GGCTGCGGGGAGCAGTAAGGGGG + Intronic
968258190 3:197297998-197298020 GGCCGCGGCGAGCGAGGAGGCGG - Intronic
968353432 3:198081081-198081103 GGCTGCTGCGAGCAGGCAGAGGG + Intergenic
968509507 4:989210-989232 GGCTGCCAGGAGGAAGGAGGGGG - Exonic
968614626 4:1571767-1571789 GGGTGCATCGTGCAAGGAGGTGG + Intergenic
968965154 4:3765955-3765977 AGCTCCGGCGAGCGAGGCGGCGG + Intergenic
969413378 4:7043540-7043562 GGCTGCGGCGGGCCGGGCGGCGG + Exonic
969427932 4:7136785-7136807 GTCTGCCGCGAGCAGGCAGGGGG + Intergenic
969873186 4:10117005-10117027 GGGCGGGGCGAGCAAGGCGGAGG - Intergenic
969921855 4:10547651-10547673 GGCTGCCAGGAGCAAGGAGGAGG - Intronic
970202895 4:13627526-13627548 GGCTGCGGCGGGGGAGGCGGCGG + Exonic
973279297 4:48342020-48342042 GCCCGCCGCTAGCAAGGAGGTGG - Exonic
973537761 4:51901167-51901189 GGCTGTGGGGAGCAGGAAGGTGG - Intronic
973718761 4:53702797-53702819 GGCTGCAGCGAGCAGGGGTGGGG - Intronic
975035683 4:69677326-69677348 GGCTGGAGGGAGGAAGGAGGTGG + Intergenic
976475268 4:85475637-85475659 GGCTGCGGGGGGCGGGGAGGGGG + Intronic
976475280 4:85475658-85475680 GGCTGCGGGGGGCGGGGAGGGGG + Intronic
976475292 4:85475679-85475701 GGCTGCGGGGGGCGGGGAGGGGG + Intronic
976475304 4:85475700-85475722 GGCTGCGGGGGGCGGGGAGGGGG + Intronic
977354422 4:95927083-95927105 GGCTGTGGGGAGCAAGGGGAGGG - Intergenic
977511227 4:97965268-97965290 GGCTGCAGCCAGCCAGGGGGAGG + Intronic
980210507 4:129781566-129781588 GGTGGGGGCGAGCAGGGAGGTGG + Intergenic
980999023 4:139810253-139810275 GGCTGCAGCGAGCTATGATGGGG - Intronic
981044542 4:140253106-140253128 GGCTTCGGCGACCCAGGAGCAGG - Intergenic
982171743 4:152668564-152668586 TGCTGAGCCGAGCAAGGAGTGGG - Intronic
984870008 4:184317393-184317415 GGGTGCGGAGAGGAATGAGGTGG - Intergenic
986445353 5:7816335-7816357 GCCTGCGGTGAGCAGGGAAGAGG + Intronic
991031345 5:62085375-62085397 GGCTGGGGCAGGCCAGGAGGAGG - Intergenic
991131965 5:63132796-63132818 GACTGCAGAGAGCAAGGATGTGG - Intergenic
991371649 5:65925834-65925856 GGGAGCGGAGAGAAAGGAGGAGG - Intergenic
992778824 5:80110156-80110178 GGCTCGGGGGAGCAGGGAGGAGG - Intergenic
992905862 5:81345112-81345134 GGCAGCGGTGGGCGAGGAGGTGG - Intronic
993386279 5:87267495-87267517 GGCGGTGGAGAGGAAGGAGGGGG - Intergenic
993501827 5:88674503-88674525 GCCCGCGGGGAGCAGGGAGGCGG + Intergenic
996055052 5:118973605-118973627 GGCTGCCGCGAGCAAGGAGGCGG - Intronic
996799194 5:127384074-127384096 GGCAGTGGAGAGAAAGGAGGGGG - Intronic
997390278 5:133509448-133509470 GGCTGAAATGAGCAAGGAGGAGG - Intronic
997539323 5:134648714-134648736 GGCTGCTGCGAGCCCGGAGCCGG + Intronic
998599866 5:143574749-143574771 GGCTGGGGCCAGCATGGAAGTGG - Intergenic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1000358258 5:160421930-160421952 GGCTCCGGCGGGGAAGGAGGCGG + Exonic
1001035085 5:168291755-168291777 GGCTGCAGGGAGGAGGGAGGCGG + Intronic
1001763299 5:174225085-174225107 GGCAGCCACGAGCCAGGAGGAGG - Intronic
1002291631 5:178204585-178204607 TGCGGCGGCGGCCAAGGAGGAGG + Exonic
1002312609 5:178323732-178323754 CGCTGCAGGGAGCAGGGAGGTGG + Intronic
1002897769 6:1389468-1389490 GGCGGCGCGGAGCGAGGAGGGGG + Intergenic
1003163075 6:3652623-3652645 GGCTGAGGAGAGGAAGGAGCGGG - Intergenic
1004470381 6:15923630-15923652 GGCAGCTGGGAGAAAGGAGGAGG + Intergenic
1004690349 6:17987698-17987720 GGCGGCGGCGGGCGGGGAGGAGG + Intergenic
1004784457 6:18951107-18951129 GGCTGGGGAGAGCAGGAAGGTGG + Intergenic
1004913315 6:20307660-20307682 GGCTGAGGGGAGCAAGGAATGGG + Intergenic
1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1005802363 6:29440261-29440283 GGCGCCGGCCAGTAAGGAGGTGG - Exonic
1006642991 6:35497938-35497960 AGCTGGGGCGGGCTAGGAGGAGG - Exonic
1007602453 6:43091031-43091053 GGAAGCGGGGAGCAAGGAGGGGG - Intronic
1008582908 6:52922460-52922482 AGCTGCCGGGAGCAAGGTGGCGG - Intergenic
1009461788 6:63922050-63922072 GGCTGTGTGGAGCAAGAAGGTGG + Intronic
1011099726 6:83708529-83708551 GCCGGCGGCGAGGAAGGAAGGGG - Intronic
1011393538 6:86881076-86881098 GGGTATGGGGAGCAAGGAGGGGG - Intergenic
1012450552 6:99349484-99349506 GGCGGCGGCGACTGAGGAGGCGG + Exonic
1012450556 6:99349502-99349524 GGCGGCGGCGACTGAGGAGGCGG + Exonic
1012857030 6:104514273-104514295 GGCTGAAGCGGGCAAGGAAGAGG + Intergenic
1013619422 6:111873333-111873355 GGCTGCCGCGGGCGAGGAGGAGG - Exonic
1013793635 6:113860243-113860265 GGCGGCAGCGGGCGAGGAGGGGG + Exonic
1014126508 6:117782515-117782537 GGCTGCAGCGAGCTATGATGGGG - Intergenic
1014632435 6:123803570-123803592 GGCTGCTGCGCGCAATGATGCGG - Intergenic
1016239851 6:141917274-141917296 GGCAGCAGCGAGCATGGGGGAGG + Intergenic
1016923497 6:149317969-149317991 GGCGGCGGCGGCCGAGGAGGAGG + Intronic
1017542074 6:155413321-155413343 GGGTGGGGAGAGCAAGGAGATGG + Intronic
1018370762 6:163165665-163165687 GCGTGGGGTGAGCAAGGAGGGGG + Intronic
1018434958 6:163751423-163751445 GGCTGCGGGGAGGGAGGAGGAGG - Intergenic
1018876516 6:167826844-167826866 GGCGGCGGCGCGCACGGCGGCGG + Intergenic
1018975628 6:168563043-168563065 GTCTGCGTCGAGGAAGGGGGCGG + Intronic
1019381813 7:727761-727783 GAGGGCGGCGTGCAAGGAGGAGG - Intronic
1019540856 7:1550394-1550416 GGCTGCAGGGAGCACAGAGGGGG + Exonic
1019578886 7:1750421-1750443 GGTTTGGGCGAGGAAGGAGGTGG + Intergenic
1019731511 7:2631946-2631968 GGCGGCGGCGAACAAAGAGGCGG + Exonic
1020220498 7:6232934-6232956 GGCTGCAGGGAGGTAGGAGGTGG - Intronic
1022489351 7:30804909-30804931 GGATGCTGTGAGCAAAGAGGTGG + Intronic
1022786135 7:33639234-33639256 GGCTGGGGAGAGGGAGGAGGGGG + Intergenic
1023016048 7:35969148-35969170 GGCTGCAGTGAGCCAGGATGGGG + Intergenic
1023629875 7:42153548-42153570 GGATGGGGCGGGCAGGGAGGAGG + Intronic
1024533188 7:50409896-50409918 GCCTGCGGCCAGGGAGGAGGGGG - Intergenic
1024569085 7:50709488-50709510 GCCTGAGGCCAGCAAGGAGAGGG - Intronic
1025175900 7:56802348-56802370 GGCCACGGTGAGGAAGGAGGTGG + Intergenic
1025693863 7:63765132-63765154 GGCCACGGCGAGGAAAGAGGTGG - Intergenic
1025695893 7:63774074-63774096 GGCCACGGTGAGGAAGGAGGTGG - Intergenic
1026806828 7:73434112-73434134 GGCTGCGCCGTGCCAGGCGGTGG + Exonic
1028477003 7:91264497-91264519 GGCGGCGGCGGAGAAGGAGGCGG + Exonic
1028612370 7:92726096-92726118 TGCTGGGGAGAGGAAGGAGGAGG + Intronic
1029622600 7:101699306-101699328 GGCTGCGCTGAGGCAGGAGGAGG - Intergenic
1030505611 7:110418122-110418144 GGCTGCAGTGAGCAAAGTGGAGG - Intergenic
1031607523 7:123787455-123787477 GGCTGAGTTGAGCATGGAGGAGG - Intergenic
1032322994 7:130901341-130901363 GCCTGCGGGGAGCAGGGAGCAGG - Intergenic
1033113855 7:138607629-138607651 GGCTGCAGCCAGCTTGGAGGAGG + Intronic
1034253909 7:149714376-149714398 GGCTGCGGCGAGCGGGGGCGCGG + Intergenic
1035029401 7:155847757-155847779 GGCTGCGGGGAGGAAGGTGTGGG - Intergenic
1035344207 7:158188024-158188046 GGCTGCTGGGTGCATGGAGGAGG - Intronic
1036485206 8:9173181-9173203 GGCAGCGGAGAGAAGGGAGGTGG - Intergenic
1036782146 8:11657177-11657199 GGCTGTAGTGGGCAAGGAGGTGG - Intergenic
1037905949 8:22716110-22716132 GGCTGAAGGGAGAAAGGAGGAGG + Intronic
1038828551 8:31033181-31033203 GGCGGCGGCGGGGGAGGAGGCGG - Exonic
1038883622 8:31640125-31640147 GGCGGCGGCCGGCAACGAGGCGG + Intronic
1039068782 8:33632008-33632030 GGCGGCGTGGAGCAAGGAGCGGG - Intergenic
1039542296 8:38382214-38382236 GGCGGCGGCCAGCACGGAGGCGG - Exonic
1042962865 8:74321492-74321514 GGCGGCGGCGAAGGAGGAGGAGG - Intronic
1042962866 8:74321495-74321517 GGCGGCGGCGGCGAAGGAGGAGG - Intronic
1043428424 8:80171418-80171440 GACCGCGGCGAGCAAGGTGAGGG - Intronic
1044374019 8:91448245-91448267 GCCTGCGGGGAGCAAGGATTAGG - Intergenic
1047757330 8:127928635-127928657 GGGTGCGGTGAGTAAGGGGGTGG + Intergenic
1048442789 8:134472261-134472283 GGCTAAGGGGAGCAGGGAGGAGG - Intergenic
1049015556 8:139917651-139917673 GGCTGCTGCGAAGATGGAGGCGG - Intronic
1049044978 8:140142546-140142568 AGCTGCTCCCAGCAAGGAGGTGG + Intronic
1049620730 8:143597359-143597381 GGACGCGGCGACCAAGGAGGAGG + Exonic
1049799167 8:144509848-144509870 GGCCGCGGCCAGCCAGTAGGTGG - Exonic
1053142673 9:35690939-35690961 GGCTGCGGCGGGGAAGGCGGAGG + Exonic
1054849039 9:69827631-69827653 GGATGAGGCGAGCAAGGACAAGG - Intronic
1056547789 9:87627456-87627478 GGCTGGGCTGAGCAGGGAGGAGG - Intronic
1056572781 9:87830431-87830453 CTCTGCAGCCAGCAAGGAGGAGG + Intergenic
1056637975 9:88347181-88347203 GGCTGCGGTGAGCCAGGATCTGG + Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057464476 9:95300170-95300192 GGCTGAGGTGAGGAAGGTGGGGG - Intronic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1057852907 9:98578949-98578971 GGCTGGGGGGAGCAGGGAAGGGG + Intronic
1059354259 9:113687165-113687187 GGGTGGGGAGAGGAAGGAGGAGG + Intergenic
1060266832 9:122116532-122116554 GGCTTCGGTGAGGCAGGAGGTGG - Intergenic
1061080103 9:128364889-128364911 GGCTGCGGCAGCAAAGGAGGGGG + Intergenic
1061181690 9:129028286-129028308 GGCTGCGGCGGGCGGGCAGGCGG - Intronic
1061912474 9:133732390-133732412 CCCTGCGGGGGGCAAGGAGGGGG - Intronic
1061996793 9:134190184-134190206 GGCTGCGGGGAGGTGGGAGGTGG - Intergenic
1062197475 9:135282251-135282273 GGCTGGGGCGGGAGAGGAGGAGG + Intergenic
1062231965 9:135486859-135486881 GGGTGCCGCGAGCCAGGACGCGG + Exonic
1062357026 9:136169939-136169961 GGCTGGGGGAAGCAAGGTGGAGG - Intergenic
1062584089 9:137241329-137241351 GGCGGCGGCGGGGAAGCAGGAGG - Exonic
1185508286 X:644533-644555 GGCGGCGGCGACCACGGCGGCGG - Exonic
1186496500 X:10015710-10015732 GGCGGCGGCGCGGAAGGAGCTGG - Exonic
1187067514 X:15854888-15854910 GGCTGCGGCGAGCTGAGGGGCGG + Exonic
1190440476 X:50470578-50470600 GGCGGCGGCGGCCAAGGCGGCGG + Exonic
1190692212 X:52921128-52921150 GGCTCCGGCGAACAGGGAAGAGG - Intergenic
1190693834 X:52935024-52935046 GGCTCCGGCGAACAGGGAAGAGG + Intronic
1191712241 X:64162428-64162450 GGCTGGGGAGAGTAGGGAGGAGG - Intergenic
1192757948 X:74066131-74066153 GGCTGGGCCGAGTAAGGTGGTGG - Intergenic
1194801312 X:98276840-98276862 GGATGGGGGGAGGAAGGAGGGGG + Intergenic
1195605638 X:106802950-106802972 GGCTACGGGGAGGAAGGCGGAGG + Exonic
1196717338 X:118824130-118824152 GGCTGCGCTGAGGGAGGAGGTGG + Intronic
1198767089 X:140091328-140091350 GGCGGCGGCGACCGAGGCGGCGG + Intergenic
1200086529 X:153609947-153609969 GGCTTCGGAGAGGAAGGAGAAGG - Intergenic
1200120690 X:153788916-153788938 GGCTGCAGCCAGCCTGGAGGTGG - Intronic
1200136078 X:153875452-153875474 GGCTAAGGAGAGCATGGAGGAGG + Intronic
1200163319 X:154019967-154019989 GGCCGCGGCGCGCAAGATGGCGG - Exonic
1200217524 X:154374652-154374674 GGGTGCGGCCAACAAGAAGGCGG - Intergenic
1202377868 Y:24255044-24255066 GGCTCAGGCGAGGCAGGAGGTGG + Intergenic
1202492914 Y:25415077-25415099 GGCTCAGGCGAGGCAGGAGGTGG - Intergenic