ID: 1121198157

View in Genome Browser
Species Human (GRCh38)
Location 14:92094053-92094075
Sequence AGCTACTCGGGAGCCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100407
Summary {0: 1, 1: 121, 2: 7665, 3: 41796, 4: 50824}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121198157 Original CRISPR AGCTACTCGGGAGCCTCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr