ID: 1121201460

View in Genome Browser
Species Human (GRCh38)
Location 14:92121666-92121688
Sequence CCCTGTTGCCCTTGGTCTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121201460_1121201470 13 Left 1121201460 14:92121666-92121688 CCCCGAGACCAAGGGCAACAGGG 0: 1
1: 1
2: 2
3: 12
4: 121
Right 1121201470 14:92121702-92121724 CCAGTGGAAGCTGCGACCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 141
1121201460_1121201468 12 Left 1121201460 14:92121666-92121688 CCCCGAGACCAAGGGCAACAGGG 0: 1
1: 1
2: 2
3: 12
4: 121
Right 1121201468 14:92121701-92121723 GCCAGTGGAAGCTGCGACCTCGG 0: 1
1: 0
2: 0
3: 11
4: 128
1121201460_1121201465 -3 Left 1121201460 14:92121666-92121688 CCCCGAGACCAAGGGCAACAGGG 0: 1
1: 1
2: 2
3: 12
4: 121
Right 1121201465 14:92121686-92121708 GGGAACTCAACCCGCGCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121201460 Original CRISPR CCCTGTTGCCCTTGGTCTCG GGG (reversed) Exonic
900290918 1:1923278-1923300 CCCTGCTCCGCTGGGTCTCGGGG + Intronic
900762580 1:4482908-4482930 CCGTGTTGCACTGGGTCTCCAGG - Intergenic
900928433 1:5720388-5720410 CCCTGTTCCCATTGGGATCGGGG - Intergenic
903128269 1:21262242-21262264 CCCAGTAGCCCATGGTCTCCAGG - Intronic
903576819 1:24344516-24344538 CCCTGTTGCCCTTGCTCCCTTGG + Intronic
903954740 1:27017536-27017558 CCCTGTTGCCCTGGCTGTCCAGG - Intergenic
904128428 1:28259025-28259047 CCCTGCTCCCCCTGGCCTCGGGG - Intergenic
904408947 1:30313288-30313310 CCATGTTGCACTTGGTCTCCTGG - Intergenic
907266295 1:53263578-53263600 CCCTGTTGCCTATGGTCTCTGGG - Intronic
908313805 1:62912920-62912942 TCCTTCTGCCCTTGGTCTCTAGG + Intergenic
909515432 1:76502020-76502042 CTGTGTTGCCCTTTGTCTCAAGG - Intronic
910803464 1:91167397-91167419 GCCTGTTGCCATCGGTCTCTAGG + Intergenic
914972003 1:152314442-152314464 CCCTGTTTCTCTTGGGCTCTTGG + Exonic
922027551 1:221765025-221765047 CGATGTTGACCTTGGTCTCCTGG - Intergenic
922279917 1:224114087-224114109 CCCTGTTCCCCTTGCTGTGGGGG + Exonic
922473125 1:225888780-225888802 CCCTGCTGCCCCTGGTCCCATGG - Intronic
1063301182 10:4850190-4850212 CTCTGTGGACCTTGGTCTCCAGG - Intergenic
1065349018 10:24778885-24778907 CCACGTTGCCCTTGGACTCCTGG + Intergenic
1068549190 10:58386597-58386619 CCTTGTTGCCTTTGGTCTAGAGG + Intronic
1069942562 10:71965167-71965189 ATCTGCTCCCCTTGGTCTCGGGG - Intronic
1070064289 10:73018343-73018365 CTCTGTTTCCCTGGGTCTCTGGG - Intronic
1075586470 10:123662027-123662049 CCTTGTTGCCCCTGGTCAGGTGG + Intergenic
1076734261 10:132451729-132451751 CTCTGTTGCGCATGGTCTCCTGG - Intergenic
1077773768 11:5249323-5249345 CCCTGTTGCCTTTAGTCTCGAGG - Intronic
1077774272 11:5254247-5254269 CACTGTTGCCTTTAGTCTCGAGG - Intronic
1080213766 11:29817720-29817742 CCCTTTGGCCCTTGGTAGCGAGG + Intergenic
1083871219 11:65489632-65489654 CCCTGCTGCCCTTACTCTGGGGG - Intergenic
1084941765 11:72616906-72616928 CCCTGTAGCCCCTGGTCCCTGGG - Intronic
1085273143 11:75282107-75282129 CCCTGGGGCCCTTGGTCTGATGG - Intronic
1086511482 11:87562815-87562837 CCCTGTTATCCTTGGCCTCTGGG + Intergenic
1096226539 12:49869896-49869918 TCCTATTGCCCTTGGCCTCCAGG + Exonic
1097147124 12:56949403-56949425 CATTGTAGCCCTTGGTATCGAGG + Intergenic
1097912808 12:64988950-64988972 CCCTATTACCCTTGGTCTTCTGG + Intergenic
1103949464 12:124543109-124543131 CCCCCTTGGCCTTGGTCTGGTGG - Intronic
1104533056 12:129590700-129590722 CCCTGTTGCCATTGAGCTCTGGG - Intronic
1107175533 13:37394621-37394643 CCCTGTTGCCCTCAGGCTCTCGG + Intergenic
1111372199 13:87333428-87333450 ACATTTTGCCCATGGTCTCGGGG + Intergenic
1113846479 13:113394370-113394392 CCCTGTTGCCCATTGTCTCCAGG - Intergenic
1115401215 14:32962922-32962944 CCATGCTGGCCTTGGTCTCCTGG + Intronic
1115865040 14:37736310-37736332 CACTGTTGCCCTCGATCTCCTGG - Intronic
1118831860 14:69440872-69440894 CCATGTTGGCCTTGATCTCCTGG + Intronic
1121201460 14:92121666-92121688 CCCTGTTGCCCTTGGTCTCGGGG - Exonic
1121515051 14:94543953-94543975 CGCTTTTGACCTTGGTCTCTTGG + Intergenic
1122045180 14:99017872-99017894 CCCTGTTGCCCTTGCTGGCTAGG - Intergenic
1124011646 15:25843913-25843935 TCCTGCTTCCCATGGTCTCGCGG + Intronic
1125395449 15:39242685-39242707 CCATGGTGCCCCTGGTCTTGAGG - Intergenic
1127756498 15:62097590-62097612 CCCTTTTGTCCATGGTCTGGGGG - Intergenic
1128723962 15:69974265-69974287 CCCTGCTGCCCTGGGTCGGGGGG - Intergenic
1129584493 15:76849015-76849037 CCCTCCTGCCCTTGGACTAGGGG + Intronic
1129707250 15:77801806-77801828 CCCTGTCGACCTTGGCCTGGGGG - Intronic
1131131898 15:89905649-89905671 GCCTGTTCCCCTTGGCTTCGCGG + Intronic
1133224343 16:4333471-4333493 CCCCGTTGCCCTGGCGCTCGGGG - Exonic
1136058732 16:27710006-27710028 CCCTGCTGCCCTAGGTCGTGAGG + Intronic
1137033053 16:35543354-35543376 CCCTGCTGCACTGGGTCTCCTGG + Intergenic
1140899931 16:79358117-79358139 CCCTGCTGCCCTTCCTCTGGGGG - Intergenic
1142053393 16:87975394-87975416 CCCTGTGACACTTTGTCTCGAGG + Intronic
1142294477 16:89211436-89211458 CCCTGCTGCCCCAGGTCTCCGGG + Intergenic
1144408358 17:14974598-14974620 CCCTCTTCCCTTTGGGCTCGAGG + Intergenic
1145350229 17:22075342-22075364 CACTGTTGCCCTGTATCTCGTGG - Intergenic
1145408966 17:22638650-22638672 CCCTGTTGCTCTTCCCCTCGTGG - Intergenic
1147893962 17:43738254-43738276 CCCTGTGGCCCTTGTGCTCAAGG + Intergenic
1148358815 17:46995247-46995269 CCCTGCTGCCCTAGGTCCTGGGG - Intronic
1150787803 17:68176893-68176915 CCCTGCTGCCCTAGGTCCTGGGG + Intergenic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152274004 17:79343599-79343621 AGCTGATGCCCTTGGTCTGGTGG - Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1156568847 18:38228186-38228208 CCCTGTTGGCCTTAGTGTAGGGG + Intergenic
1160348364 18:78153168-78153190 CCTTTGTGCCCTGGGTCTCGGGG + Intergenic
1161428507 19:4217464-4217486 CCCCGCTGCCCTCGGCCTCGCGG - Exonic
1164617419 19:29675267-29675289 CCCGGCTGCCCTGGGCCTCGGGG - Exonic
1164708720 19:30339499-30339521 CATTGATGCCCTTGGTCTCAGGG + Intronic
926157728 2:10466870-10466892 CCCTCTGGCCCTTGGCCTGGAGG - Intergenic
926875354 2:17470795-17470817 CCCATTTGCCCTTGTTCTTGTGG + Intergenic
927152171 2:20202555-20202577 CCCTGGTGCCCTAAGTCTCCAGG + Exonic
927258263 2:21059765-21059787 TCCTGTGGGCCTTGGTCTCATGG - Intergenic
929434011 2:41913456-41913478 CCGTGTTTCCCTTGCTCTGGTGG - Intergenic
931489236 2:62726003-62726025 CCCTGTGTCCCTTGGTCTGCTGG - Intronic
937205105 2:120231319-120231341 CCCTGTGGCCCTTGTTCCCAAGG + Intergenic
938072812 2:128317456-128317478 CCCTGTTGACCTGGGGCTGGGGG - Intronic
938537284 2:132256918-132256940 CCCAGGTGCCCTTGCCCTCGCGG - Intronic
940487743 2:154317677-154317699 CCCTGTTTCCCTGGGACTCCTGG + Intronic
941354663 2:164475231-164475253 CCCTGCTGCTCTTGTTCTAGGGG - Intergenic
943353501 2:186822655-186822677 TGCAGTTGCCCTTGGTCTCCTGG - Intergenic
947721774 2:232374101-232374123 CCCTGTGGCCCTTGGTCTTGGGG - Intergenic
947955082 2:234182688-234182710 TCCTCTTGCCCTTGGTCTAGGGG + Intergenic
948480666 2:238248181-238248203 TCTTGCTGCCCTTGGTCTCCAGG - Intronic
949030505 2:241794687-241794709 CCCTGCTGCCTTTGCTCTGGGGG - Intronic
1169278700 20:4249616-4249638 CGCTGGTGCCCTTGGGCGCGCGG + Intergenic
1171567343 20:26208127-26208149 CCCAGGTGCCCTTGCCCTCGCGG - Intergenic
1173972793 20:47165526-47165548 CCCTGCTGCCGTTGGTCTCCAGG + Intronic
1176547503 21:8208153-8208175 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1176555412 21:8252362-8252384 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1176566454 21:8391200-8391222 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1176574330 21:8435387-8435409 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1178973454 21:37201327-37201349 CTCACTTGCCCTTGGTCTCTTGG - Intronic
1179880876 21:44292894-44292916 CCCTGCTGCCCTGGGTTTCAGGG + Intronic
1180205653 21:46258006-46258028 CCCCGTTGCCAGTGGTCTTGAGG - Intronic
1182205252 22:28617801-28617823 CCCAGTTGCCATTGTTCTCCTGG + Intronic
1203252376 22_KI270733v1_random:124438-124460 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1203260433 22_KI270733v1_random:169524-169546 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
952981273 3:38738139-38738161 CCATGTTGCCCTTGAACTCCTGG + Intronic
954070982 3:48142652-48142674 CCCTGCTACCCTTGCCCTCGAGG + Intergenic
954076037 3:48181498-48181520 CCCCGTTGCCCTTGGTCTCGGGG + Intronic
954676023 3:52315844-52315866 CCCTGTTCTCCTGGGTCTCAGGG - Intergenic
955407957 3:58637381-58637403 CCCTGTAGCCCTTGTCCTAGGGG + Intronic
956295947 3:67713797-67713819 TCCTGTTGCTCTTGCTCTGGGGG + Intergenic
964590876 3:158361017-158361039 CCCTGTGGCCCTGGCTCTCAGGG + Intronic
966151949 3:176875298-176875320 CACTGTTGCCCTTGTGCTCTGGG - Intergenic
969491845 4:7503954-7503976 CCCTGTCGGACTTGGTCTCTAGG + Intronic
969493826 4:7514736-7514758 CCCTGTGAGCCTTGGTGTCGGGG + Intronic
970671922 4:18406579-18406601 CCCTGTAGCCTTTCTTCTCGAGG + Intergenic
979828186 4:125266132-125266154 CCCTGGTGCACATGGTCTGGAGG - Intergenic
992350207 5:75920901-75920923 CCCTGCAGGCCCTGGTCTCGTGG + Intergenic
993564581 5:89457507-89457529 CCCTGTTGCTCTTCCTCTCCTGG - Intergenic
996406229 5:123106976-123106998 CCCTGCTGTTCTTGGTCTCAAGG + Intronic
996727661 5:126686854-126686876 ACCTGTTGCCCTTGGTCCTTGGG + Intergenic
999078010 5:148815508-148815530 ACCTGGTGCCCTAGGTCTCCTGG + Intergenic
1004098672 6:12585778-12585800 TCCTGTTGCCTCTGGACTCGGGG + Intergenic
1009911710 6:69937874-69937896 CCCTTTTTCCCTTGTTCACGTGG + Intronic
1016643913 6:146381257-146381279 TCCTGTTGCCCTTGGTGGCAAGG + Intronic
1022257082 7:28669662-28669684 CCCTGTTGCCCTTGATGTGATGG - Intronic
1026774614 7:73223676-73223698 CCCTCTTGCCCTGGGTCTCAAGG + Intergenic
1027015472 7:74777065-74777087 CCCTCTTGCCCTGGGTCTCAAGG + Intronic
1027072559 7:75168890-75168912 CCCTCTTGCCCTGGGTCTCAAGG - Intergenic
1036759054 8:11494343-11494365 CCCTGTTGCACTTGCTCACTGGG + Exonic
1051571776 9:18566813-18566835 CCCTTCTGCCCTTGCTCTCCTGG - Intronic
1052611004 9:30773745-30773767 CCCTCTGGTTCTTGGTCTCGAGG - Intergenic
1057843454 9:98504051-98504073 TCCTGGTGCCCTGGGTCTGGAGG - Intronic
1062522914 9:136966072-136966094 CCATGTTGACCTTGGTCACCTGG - Intergenic
1203468781 Un_GL000220v1:107589-107611 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1203476602 Un_GL000220v1:151561-151583 CCCGGGTGCCCTTGCCCTCGCGG + Intergenic
1203361388 Un_KI270442v1:221050-221072 CCCGGGTGCCCTTGCCCTCGGGG - Intergenic
1186117331 X:6318645-6318667 CCCTGTTGGCCTTGGTGTTGTGG - Intergenic
1187023071 X:15404958-15404980 CACTGTGGCCCATGGTCACGAGG + Intronic
1195794074 X:108624277-108624299 CCAGGTTGCCCTGGGTCTCCAGG - Exonic
1197366329 X:125568099-125568121 CCCTGTTGCCCTCTGTCAGGGGG + Intergenic
1198550822 X:137743345-137743367 GCCGGTTGCCCTGGGACTCGGGG - Intergenic