ID: 1121201976

View in Genome Browser
Species Human (GRCh38)
Location 14:92125217-92125239
Sequence CACTGCCAGTACCCTAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121201976_1121201982 15 Left 1121201976 14:92125217-92125239 CCTGTATTAGGGTACTGGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1121201982 14:92125255-92125277 GATGTGCAAAGCGTTCCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 68
1121201976_1121201981 14 Left 1121201976 14:92125217-92125239 CCTGTATTAGGGTACTGGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1121201981 14:92125254-92125276 TGATGTGCAAAGCGTTCCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 103
1121201976_1121201983 28 Left 1121201976 14:92125217-92125239 CCTGTATTAGGGTACTGGCAGTG 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1121201983 14:92125268-92125290 TTCCTGAGGGAAGAATAATCAGG 0: 1
1: 0
2: 0
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121201976 Original CRISPR CACTGCCAGTACCCTAATAC AGG (reversed) Intronic
905455795 1:38087173-38087195 CACTGCCCCTGCCCTAATCCAGG - Intergenic
906827383 1:48995983-48996005 CTCTGCCATAACCCTAATCCAGG - Intronic
909296935 1:73962247-73962269 CTCTGCCAGTACTCTAACAATGG + Intergenic
909359674 1:74745802-74745824 CCCTGCCAGTACCTTCATCCTGG - Intronic
913354583 1:117905085-117905107 CACTACCAGTACCCTTGTTCAGG + Intronic
914417339 1:147496182-147496204 CACTGCCTGTGCCCTATTCCTGG + Intergenic
914756985 1:150568383-150568405 CACTGGCAGTAGACTTATACAGG + Intergenic
917576395 1:176325627-176325649 CACTGCCATTACCCTAGTTCAGG - Intergenic
917623183 1:176818913-176818935 CACTCCCAATTCCCTTATACTGG + Intronic
924666517 1:246078704-246078726 CACTGCCAGTCCCTTAATTGAGG - Intronic
924840386 1:247704420-247704442 CACTGCCAGTAATTTATTACTGG + Intergenic
1063578455 10:7283031-7283053 CACTGCCTGTCCCTTAAAACAGG + Intronic
1063810363 10:9697966-9697988 CACTGCCAGTACCCTAGTATAGG - Intergenic
1068081682 10:52326234-52326256 GACTTCCACTGCCCTAATACTGG + Intergenic
1068976970 10:63020754-63020776 TACTTTCAGTACCCTAAAACTGG - Intergenic
1069096067 10:64261428-64261450 CACTGCCAGCCCTCTAGTACAGG - Intergenic
1069135446 10:64758096-64758118 CAGTGCCAGTAACTTATTACTGG - Intergenic
1072138764 10:92572448-92572470 CACTGCTACCATCCTAATACAGG + Intronic
1073507640 10:104013892-104013914 CATTGCCACCACCCTAATATAGG + Intronic
1076266512 10:129113290-129113312 CAGTGCCAGTCCCCTAACAGGGG + Intergenic
1078492366 11:11781314-11781336 CACTACCATTACCCCAATAATGG - Intergenic
1079021765 11:16914980-16915002 CACTCCCAGTGCCCTGAGACAGG + Intronic
1079874379 11:25838369-25838391 CACACCCAGTACCCAGATACTGG - Intergenic
1085967378 11:81544149-81544171 CCCTGCCAGCACCTTAATCCTGG + Intergenic
1086064189 11:82729701-82729723 ACCTGCTAGTACCATAATACAGG + Intergenic
1087561193 11:99793028-99793050 GACTGCTAGTAGACTAATACAGG - Intronic
1088823937 11:113477920-113477942 CTCTGCCAGCACCTTAATATTGG - Intergenic
1089323110 11:117639757-117639779 CACTACCAGTTCTCTCATACTGG - Intronic
1089751374 11:120653798-120653820 CACTGCCATTCCCATATTACTGG + Intronic
1093516294 12:19990580-19990602 CACTCCCTGCACCCTAATCCTGG - Intergenic
1097457535 12:59818422-59818444 CACTGCCACCACCCTTATCCAGG + Intergenic
1099493917 12:83321119-83321141 CACTGCCACTACCCAGATTCAGG + Intergenic
1100543411 12:95579217-95579239 CCCTGCCACTACCTTAATTCAGG - Intergenic
1101853937 12:108426676-108426698 CACAGCCAGCACTCTAATCCAGG + Intergenic
1103157671 12:118700337-118700359 CACTGCCTGTAACCAAAAACGGG - Intergenic
1108604227 13:52021437-52021459 CACTGCAAGTCCCCTAAGGCTGG + Intronic
1109469290 13:62783851-62783873 GACTGACAGTACCCTCAAACTGG + Intergenic
1109845659 13:67987180-67987202 CACTGTCATTATCCTAATTCAGG - Intergenic
1111140582 13:84113280-84113302 CATTGCCAGTACCAAACTACAGG + Intergenic
1114633413 14:24173661-24173683 CACTGCCAAGGCCCTAATCCAGG + Intronic
1114691222 14:24583959-24583981 CACTCCCAGCACCCCACTACAGG + Intergenic
1118136774 14:63037259-63037281 CAGAGCCAGGACTCTAATACAGG + Intronic
1118665021 14:68059184-68059206 CACTGCCACTGCCCTAATTCTGG + Intronic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1121201976 14:92125217-92125239 CACTGCCAGTACCCTAATACAGG - Intronic
1129016205 15:72471433-72471455 CACTGCCACAACCCTAGTTCAGG + Intergenic
1129846443 15:78769871-78769893 CACTGCCCCTGGCCTAATACAGG - Intronic
1130421216 15:83748876-83748898 CACTCCCAGCCCCCAAATACCGG - Intronic
1131189377 15:90301484-90301506 CGCTCCCAGTACCCTAGTAATGG + Intronic
1133365606 16:5206864-5206886 CACTCCCAGTCCCCCAACACAGG + Intergenic
1138705649 16:58912501-58912523 CACTGACAGTGCCCTAAGATGGG - Intergenic
1138844136 16:60544717-60544739 CAGTGTCAGTGCTCTAATACAGG + Intergenic
1143588862 17:7867788-7867810 CACTGCCACTAACCTAGTTCTGG - Intronic
1144259621 17:13505529-13505551 CACTATCAGCACCCTAATCCTGG - Intronic
1148195387 17:45709301-45709323 CACTTCCAGTACCCCTATAGGGG + Intergenic
1149218263 17:54384502-54384524 CACTGCTAAGACCCTAAAACAGG - Intergenic
1151617908 17:75226366-75226388 CATTGCCAGTGCCCTGATCCTGG - Intronic
1157375999 18:47165838-47165860 CCATGCCAGTACCCTGATCCTGG + Intronic
1160932730 19:1578289-1578311 CACTGCCAGGACCCGACTCCAGG + Intronic
926457893 2:13091478-13091500 ACCTGCCAGCACCCTAATTCTGG - Intergenic
932675712 2:73779236-73779258 TTCTGTCAGTACCCTAATACAGG - Intronic
932679747 2:73814913-73814935 CACTGCCAATCTCCTAATACAGG + Intronic
935324637 2:101925138-101925160 CACTGCCAGCACCATACTCCTGG + Intergenic
938971532 2:136437584-136437606 CACTGACACTACCTTGATACAGG + Intergenic
941068678 2:160931778-160931800 TACTGTCACTACCCTAATTCAGG - Intergenic
941774614 2:169378892-169378914 CACTGCCAGGACCCAAACACAGG + Intergenic
941908771 2:170742407-170742429 CACTGCCATCACCCTACTTCAGG - Intergenic
1171515611 20:25730435-25730457 CACTGCCAGGGCCCAAAGACTGG - Intergenic
1173239526 20:41281954-41281976 CCCTGCCAGCACCCTAATGTGGG - Intronic
1173560798 20:44004027-44004049 CACTGCCACTATCCTAGTCCAGG - Intronic
1178511231 21:33206817-33206839 CACTGCCAGCACGCTAATCTTGG + Intergenic
1180029080 21:45190573-45190595 CACAGCCAGTACACAAAGACTGG - Intronic
1182047701 22:27288720-27288742 CACTCCCAGTACCCTGTTCCAGG + Intergenic
1183864407 22:40692837-40692859 CACTGCCACCACCCTAATCCAGG - Intergenic
951362870 3:21745325-21745347 CCCAGCCAATGCCCTAATACAGG + Intronic
955431613 3:58851340-58851362 CACTGCCATTGCCTTAATTCAGG - Intronic
963267326 3:143252499-143252521 CACTTCCAGTACCCCAAGGCTGG - Intergenic
966504467 3:180684035-180684057 CACTGCCACTACTCTAATTTAGG + Intronic
969735899 4:8990227-8990249 CACTCCCAATCCCCCAATACAGG + Intergenic
971189781 4:24416454-24416476 CACTGCCTATGCCCTAATTCTGG - Intergenic
978665415 4:111176014-111176036 CAGTGACAGTACCTTAATATTGG - Intergenic
978862875 4:113471662-113471684 CACTGCCACTACTCTGATTCAGG + Intronic
982357227 4:154484217-154484239 CACTACCATTCCCCTAATTCAGG + Intronic
987073189 5:14357526-14357548 CACTGCCACCACCATAAAACAGG - Intronic
987171902 5:15268031-15268053 AACTGCCAGGATCCAAATACTGG - Intergenic
988324008 5:29738189-29738211 CACTGCCACTGCCCCAATAAGGG + Intergenic
989175496 5:38521483-38521505 CACTGCCGGGACCCAAAGACTGG - Intronic
992013356 5:72552629-72552651 CAGTTCCAGTACACTAAAACTGG + Intergenic
994479185 5:100311351-100311373 CACTGCCAGCAAACTAACACAGG + Intergenic
996620794 5:125500077-125500099 CACTGCCAGTCCCATTATAATGG - Intergenic
1002000049 5:176192291-176192313 CACTGCCAGCACCCAAATCTGGG + Intergenic
1007109061 6:39302610-39302632 CACTGCCATTTCCCTAGTTCAGG - Intronic
1009982982 6:70747536-70747558 CACTGCCATTACATTAATTCAGG - Intronic
1012247773 6:96945357-96945379 CCCAGCCTGTACCCTAAGACTGG + Intronic
1019093613 6:169561142-169561164 CACTGCCAGCACCTTCATCCTGG - Intronic
1023024860 7:36041187-36041209 CACTGCTAGCACCCTAATCCAGG - Intergenic
1029994752 7:104996673-104996695 CACTGCCACTACTTTAATTCAGG - Intergenic
1030311283 7:108071737-108071759 CCCTGCCACTTCCCTAATTCAGG + Intronic
1031679825 7:124658311-124658333 CACTGCCAACACCCCAATCCAGG + Intergenic
1032757814 7:134907836-134907858 CGCTGCCAGTGTCCTAATAAGGG + Intronic
1033057014 7:138065934-138065956 CACTGACAATTTCCTAATACAGG - Intronic
1036921502 8:12859667-12859689 CTCTGCCAGTACCCTGATCTTGG + Intergenic
1036953838 8:13166245-13166267 TCCTGCCATTACCCTAATTCAGG + Intronic
1040606544 8:48938559-48938581 CACTGGCAGGACCCTAAAAAAGG + Intergenic
1041581859 8:59470159-59470181 CATTCCCAGTAAACTAATACAGG - Intergenic
1047030918 8:120879815-120879837 CACTGACACTACCCTACTCCAGG - Intergenic
1047299254 8:123598769-123598791 CACTCCCCGTACCCTACAACAGG - Intergenic
1051703940 9:19856717-19856739 CACTGCCAGACACCTTATACAGG - Intergenic
1054992337 9:71343708-71343730 CACTCTCAGAACCCAAATACTGG + Intronic
1055320862 9:75082212-75082234 CACTGCCACCATCCTGATACAGG - Intronic
1057973205 9:99576907-99576929 TACTACCACTACCCTAATTCAGG - Intergenic
1061866327 9:133493461-133493483 CACTGCCAGGACCTTAAGCCTGG + Intergenic
1062676473 9:137748457-137748479 TGCTGCCAGCACCCTCATACAGG + Intronic
1189458992 X:41221832-41221854 CACTGCCAGTTCTCCAGTACAGG - Intronic
1195913926 X:109916833-109916855 CACTATCACTACCCTAATCCAGG + Intergenic
1195950729 X:110269945-110269967 CTCTGCCAGTACCTTAATCTTGG - Intronic
1197866369 X:131022950-131022972 CACTCCCAGTCCCCTTGTACTGG + Intergenic
1197978128 X:132187073-132187095 CACTGCCACTACCCTAGACCAGG + Intergenic
1198788529 X:140317188-140317210 TACTGCCAGCACCTTAATTCAGG - Intergenic