ID: 1121202277

View in Genome Browser
Species Human (GRCh38)
Location 14:92128320-92128342
Sequence TCTACCAAAAAGAATTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2439
Summary {0: 1, 1: 10, 2: 88, 3: 346, 4: 1994}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121202274_1121202277 -2 Left 1121202274 14:92128299-92128321 CCAACATGGTGAAACTCCGTCTC 0: 2217
1: 43404
2: 134323
3: 143939
4: 91625
Right 1121202277 14:92128320-92128342 TCTACCAAAAAGAATTAGCTGGG 0: 1
1: 10
2: 88
3: 346
4: 1994

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121202277 Original CRISPR TCTACCAAAAAGAATTAGCT GGG Intronic
Too many off-targets to display for this crispr