ID: 1121204978

View in Genome Browser
Species Human (GRCh38)
Location 14:92156771-92156793
Sequence AAGAGACTTGTGAAGTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121204978 Original CRISPR AAGAGACTTGTGAAGTATGG TGG Intronic
901476065 1:9490437-9490459 AAGAGAATTGAGAACTATGTTGG - Intergenic
903143597 1:21355555-21355577 AGGAGACTGGTGAGGTGTGGTGG - Intergenic
906780303 1:48567415-48567437 ATGAGCCTGGTGAGGTATGGAGG + Intronic
908088345 1:60660618-60660640 AGGAGTCTGGTGAAGTAGGGTGG - Intergenic
908209275 1:61883236-61883258 AATAAGCTTGAGAAGTATGGTGG - Intronic
911358701 1:96850716-96850738 GTGAGACTTGGGAAGGATGGCGG + Intergenic
912466699 1:109879626-109879648 AAACGACTTGTGAAGTAGGCCGG + Intergenic
919132002 1:193463179-193463201 AACTGACTGGTGAAGTATTGTGG + Intergenic
919209631 1:194463975-194463997 AAGAGTCCTGTGATGTATGTTGG + Intergenic
921599919 1:217095739-217095761 AAGAGATTTATGAAGCATGGTGG + Intronic
923043015 1:230333189-230333211 AAGAGACTGCTGAAGTTTTGAGG + Intronic
924074471 1:240318989-240319011 AAGATGCTTCTGAAGTATGCAGG + Intronic
924282063 1:242448339-242448361 AAGAGACTGGTGATGAAGGGAGG - Intronic
1064817331 10:19280937-19280959 AAGACACTTGAGAAATATGATGG - Intronic
1065167497 10:22994776-22994798 GAGAGATTTGAGAAATATGGAGG + Intronic
1065791382 10:29263666-29263688 AACAGACTTGAGAAGGGTGGGGG + Intergenic
1068929372 10:62573387-62573409 AAGAGACTTGTGAAAAATGCAGG + Intronic
1071509972 10:86255330-86255352 AAGAGTCTTGTGAATTATATAGG - Intronic
1072187540 10:93055309-93055331 AAGAGACTGGTTAAGTAGTGAGG - Intronic
1073952326 10:108824531-108824553 AAGAGATTTGTGAAAAATGGTGG + Intergenic
1074354674 10:112771481-112771503 AAGAGCTTTGTGTAGTTTGGTGG + Intronic
1075400383 10:122157128-122157150 AATAGACTTGTGAAGACAGGAGG + Intronic
1081239686 11:40689389-40689411 AATAAACTTGTGAAGCATGTAGG - Intronic
1083150517 11:60789094-60789116 AAGAGTTTTGGGAAGTTTGGAGG - Intronic
1085375708 11:76059189-76059211 AAGATACTTGTGAAGAAGGCAGG + Intronic
1088275394 11:108080247-108080269 AAGAAATTAGTAAAGTATGGTGG - Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1091189247 11:133676342-133676364 ATGAGACTTGAGAATAATGGAGG + Intergenic
1091913110 12:4247699-4247721 AAGAGACTTAGGAAGTATAAAGG + Intergenic
1095775698 12:46007008-46007030 AATAGAATAGTCAAGTATGGGGG + Intergenic
1100903809 12:99274476-99274498 AGGAGACTTTTGTAATATGGTGG - Intronic
1101555607 12:105806074-105806096 AAGAGACTTGGGTAGCATGTTGG + Intergenic
1102932494 12:116873524-116873546 AAGAAATTAGTGAGGTATGGTGG - Intronic
1103113317 12:118302039-118302061 CAGACACTTGTCCAGTATGGTGG + Intronic
1106318164 13:28613575-28613597 GAGACATTTGTGAAGTATGGGGG - Intergenic
1106965564 13:35062319-35062341 AAGAGAGTTGTGAAAGATTGGGG + Intronic
1107131112 13:36896493-36896515 AAGAGATTTGGGAGGTCTGGAGG - Intronic
1107479577 13:40774348-40774370 GACAGACTTTTGAAGTTTGGGGG - Intergenic
1108869139 13:54960668-54960690 AAGTGACTTGTGATGTATAAGGG - Intergenic
1109473033 13:62835690-62835712 AAGAGACTTTTGCAGTATGAGGG + Intergenic
1110719074 13:78741223-78741245 TAGAGATTTGTGAATTTTGGTGG + Intergenic
1112264857 13:97913989-97914011 AAGAGAATTGTGAGGTATCAAGG - Intergenic
1114074161 14:19145153-19145175 AAGAGACTTATGAAAGATTGGGG + Intergenic
1114088107 14:19254822-19254844 AAGAGACTTATGAAAGATTGGGG - Intergenic
1121204978 14:92156771-92156793 AAGAGACTTGTGAAGTATGGTGG + Intronic
1121728333 14:96169066-96169088 AAGAGAGTTTTGAGGTAAGGAGG - Intergenic
1122035555 14:98946709-98946731 AAGAGACTTGTGCAGGAGTGGGG - Intergenic
1123387599 15:19831151-19831173 GAGAGCCTTGTGGCGTATGGTGG - Intergenic
1125639458 15:41217861-41217883 AAGAGACTTTTGAAACATAGAGG - Intronic
1129935028 15:79440217-79440239 AACAGCCTTGTAAAATATGGGGG - Intronic
1133024469 16:2981955-2981977 CAGAGACTTGGGGAGGATGGAGG - Intergenic
1135300977 16:21326876-21326898 AAGACACTTGTCCAGGATGGGGG + Intergenic
1136239526 16:28935705-28935727 AAGAGGCTTGGGAAGTTTGAGGG - Intronic
1137747324 16:50832099-50832121 AAAGAACTTGTGAATTATGGAGG - Intergenic
1138319629 16:56101071-56101093 AAAAGTTTTGTGAAGTCTGGAGG - Intergenic
1143185572 17:5008055-5008077 ACAGGACTTGGGAAGTATGGAGG + Intronic
1143583038 17:7837270-7837292 AAGAGTTGTGTGTAGTATGGGGG + Intergenic
1149976893 17:61275001-61275023 AAAAAATTAGTGAAGTATGGTGG - Intronic
1152198193 17:78929822-78929844 GGGAGCCCTGTGAAGTATGGGGG + Intergenic
1155558388 18:27047724-27047746 TAGAAACTTGGGAAGGATGGCGG + Intronic
1156821311 18:41376308-41376330 AGGAGATTTGTGAGGTATGATGG + Intergenic
1158983530 18:62789578-62789600 AAGACACTGATGAAGAATGGAGG - Intronic
1163847293 19:19644984-19645006 AAGAGACCTCAGAAATATGGGGG + Intergenic
1164243730 19:23412768-23412790 AAAAGACTTATAAAGTATTGAGG - Intergenic
1165987664 19:39784930-39784952 AAGAGTCCTGTGTAGCATGGTGG - Intronic
1166782157 19:45348478-45348500 TAGAGAATTGCGAAATATGGAGG + Intronic
1167887851 19:52516667-52516689 AAGAGCCTTCTGAAGGGTGGGGG - Intergenic
1167910700 19:52699546-52699568 AAGAGCCTTCTGAAGGGTGGGGG + Intergenic
925689453 2:6506219-6506241 CAAAGACATGTGAAGTCTGGAGG - Intergenic
925736543 2:6968897-6968919 GAGAGGCTGGTGAAATATGGGGG + Intronic
926828575 2:16934796-16934818 AATAGACTTGTGAACCAGGGTGG + Intergenic
928784157 2:34861928-34861950 AAGAGAATTCTGAAGTATTCTGG - Intergenic
929120631 2:38481217-38481239 AAGAGCCTTCTGAAAAATGGAGG + Intergenic
929443836 2:41987697-41987719 TAGAGATGTTTGAAGTATGGAGG + Intergenic
932915516 2:75854138-75854160 CAGGGACTTTTGAAGTATGAGGG + Intergenic
935872927 2:107470264-107470286 AAGAGGGTTGGGAAGTGTGGTGG + Intergenic
938218918 2:129548856-129548878 AAGAGGCTCGTGAAGAAGGGTGG - Intergenic
941992175 2:171568120-171568142 AAGAGAACTGTGAAATATAGAGG - Intergenic
942515959 2:176753446-176753468 AAGAACCTTGTGAAGTAGGAAGG + Intergenic
1170874614 20:20238818-20238840 AAGATACTTGTAAAGCAGGGAGG - Intronic
1172008107 20:31831103-31831125 GACAGACATGTGGAGTATGGGGG + Exonic
1172138918 20:32708066-32708088 AAGTGACTTGTGAATTGTAGAGG - Intronic
1175478425 20:59293764-59293786 AAGAGAGGTGTGAAGAATTGGGG - Intergenic
1176533954 21:8013199-8013221 GAGAGACTTGAGGACTATGGTGG - Intergenic
1178992827 21:37368317-37368339 AATAGACTGGTGAAGTTTTGTGG - Intronic
1179096683 21:38322440-38322462 AAAAGACATCTGAAGAATGGTGG - Intergenic
1183761893 22:39828208-39828230 AAGGAACTTGAGAAGCATGGAGG + Intronic
950021415 3:9790422-9790444 CAGAGACTTGTGGAGGAAGGAGG - Intronic
950354398 3:12392971-12392993 AAGAGACTTGAAAAATCTGGGGG + Intronic
950818514 3:15732520-15732542 AAGTGTGTTGTGAGGTATGGGGG + Intronic
952314791 3:32223357-32223379 AAGAGAACTGTGAAGTAATGAGG + Intergenic
952454884 3:33463716-33463738 AAGAAACTTCTTAAGGATGGGGG + Intergenic
953795014 3:45978356-45978378 ATGAGTCTTGTGAGGTCTGGTGG - Intronic
955393164 3:58535872-58535894 AAGAGACTTGTGAAATAGGATGG - Intronic
955853608 3:63248358-63248380 AAGATACGGGTGAAGTGTGGTGG + Intronic
957834163 3:85564464-85564486 AAAAGAATTGTGAAGTATTAAGG - Intronic
960007232 3:112792813-112792835 AAGAGACTTGTGGAGAAAGTTGG + Intronic
960090873 3:113636926-113636948 AACAGCCCTGTGAAGTATGCAGG + Intergenic
960440677 3:117683826-117683848 AAGAGTCTAGTTAAGGATGGGGG + Intergenic
962630153 3:137267575-137267597 TTTAGCCTTGTGAAGTATGGAGG - Intergenic
965137828 3:164796002-164796024 AAGAGACTTTTGAAGGACGATGG - Intergenic
969563317 4:7962999-7963021 CAGAGACTTGGGGGGTATGGGGG + Intergenic
971507965 4:27386969-27386991 AAGAGCCTTGTGAGGAATGCAGG + Intergenic
971848701 4:31955050-31955072 AGGAGACGTGTGAAGAATGTAGG + Intergenic
973002846 4:44973254-44973276 AAGAGACATGTGAAATATTATGG + Intergenic
973858019 4:55032940-55032962 AAGGGACCTGTGAAGGCTGGAGG - Intergenic
974033661 4:56798263-56798285 AAAAGACTGATGAAATATGGAGG + Intergenic
974983015 4:68984895-68984917 ACAAGTCTTGTGAAATATGGAGG + Intergenic
983200742 4:164858022-164858044 AAGAAACTAGCCAAGTATGGTGG + Intergenic
984246153 4:177277260-177277282 AAGTGAATTCTGAAATATGGAGG - Intergenic
985300582 4:188484610-188484632 AAGAGAGTTATGATGTATGTAGG - Intergenic
985393517 4:189516229-189516251 AAGAGAGTTGTGAAGGACAGAGG - Intergenic
986454277 5:7899838-7899860 ATTAGACTTGTGAATTAAGGAGG + Intronic
987691491 5:21272610-21272632 AAGAAAATGGTGAGGTATGGTGG + Intergenic
989869544 5:46570299-46570321 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989869678 5:46572857-46572879 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989869816 5:46575415-46575437 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989869948 5:46577973-46577995 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989870087 5:46580532-46580554 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989870220 5:46583091-46583113 GAGTGATTTGTGGAGTATGGTGG + Intergenic
989870354 5:46585649-46585671 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989870495 5:46588206-46588228 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989870909 5:46595886-46595908 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989871037 5:46598275-46598297 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989871174 5:46600835-46600857 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989871312 5:46603392-46603414 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989871451 5:46605950-46605972 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989871592 5:46608509-46608531 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989871852 5:46613287-46613309 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989871992 5:46615845-46615867 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989872132 5:46618404-46618426 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989872271 5:46620961-46620983 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989872401 5:46623522-46623544 GAGTGATTTGTGGAGTATGGTGG + Intergenic
989872552 5:46626248-46626270 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989872767 5:46629998-46630020 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989873027 5:46634947-46634969 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989873310 5:46640065-46640087 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989873442 5:46642623-46642645 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989873579 5:46645183-46645205 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989873853 5:46650130-46650152 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989873995 5:46652688-46652710 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989874128 5:46655246-46655268 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989874263 5:46657804-46657826 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989874541 5:46662920-46662942 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989874674 5:46665476-46665498 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989874805 5:46668036-46668058 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989874939 5:46670594-46670616 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989875084 5:46673152-46673174 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989875219 5:46675709-46675731 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989875356 5:46678270-46678292 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989875495 5:46680828-46680850 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989875770 5:46685947-46685969 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989875912 5:46688505-46688527 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989876044 5:46691068-46691090 GAGTGATTTGTGGAGTATGGTGG + Intergenic
989876245 5:46694994-46695016 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989876382 5:46697553-46697575 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989876516 5:46700110-46700132 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989876651 5:46702669-46702691 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989876787 5:46705228-46705250 CAGCGATTTGTGGAGTATGGTGG + Intergenic
989876919 5:46707785-46707807 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989877050 5:46710348-46710370 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989877190 5:46712906-46712928 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989877326 5:46715464-46715486 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989877462 5:46718021-46718043 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989877606 5:46720578-46720600 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989877878 5:46725700-46725722 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989878020 5:46728258-46728280 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989878154 5:46730816-46730838 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989878494 5:46737299-46737321 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989878630 5:46739859-46739881 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989878757 5:46742245-46742267 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989878895 5:46744806-46744828 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989879039 5:46747364-46747386 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989879181 5:46749921-46749943 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989879318 5:46752482-46752504 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989879452 5:46755046-46755068 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989879590 5:46757604-46757626 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989879731 5:46760163-46760185 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989879862 5:46762554-46762576 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989880000 5:46765112-46765134 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989880137 5:46767672-46767694 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989880270 5:46770231-46770253 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989880408 5:46772787-46772809 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989880547 5:46775345-46775367 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989880820 5:46780461-46780483 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989880957 5:46783020-46783042 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989881092 5:46785584-46785606 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989881230 5:46788143-46788165 GAGCGATTTGTGGAGTATGGTGG + Intergenic
989881506 5:46793258-46793280 GAGCGATTTGTGGAGTATGGTGG + Intergenic
991077978 5:62563205-62563227 AAGTGACTTGAGAATTATTGAGG + Intronic
991748889 5:69777527-69777549 AAGAAAATGGTGAGGTATGGTGG - Intergenic
991800467 5:70357339-70357361 AAGAAAATGGTGAGGTATGGTGG - Intergenic
991828133 5:70652702-70652724 AAGAAAATGGTGAGGTATGGTGG + Intergenic
991892825 5:71356779-71356801 AAGAAAATGGTGAGGTATGGTGG - Intergenic
992409515 5:76491833-76491855 AAGAGTCTTGTGAGTTATGCAGG - Intronic
993602317 5:89942520-89942542 AAGATACTTATTAATTATGGAGG + Intergenic
994195613 5:96919888-96919910 ATGGGCCTTGTGAAGAATGGGGG - Intronic
995591069 5:113699986-113700008 GAGAAACATGTGAAGTATAGTGG - Intergenic
996290566 5:121847067-121847089 AAAATATTAGTGAAGTATGGTGG + Intergenic
997098676 5:130943208-130943230 AAGATACTTGTGTAGTACTGGGG - Intergenic
998822523 5:146069536-146069558 AAGAACCTTGTGAGGTATGCAGG + Intronic
999163661 5:149528577-149528599 AATAGACGTGGGAAGCATGGAGG - Intronic
999467762 5:151823327-151823349 AAGAAACTTGTGGAGTAGTGGGG - Intronic
999730070 5:154470244-154470266 AACAGTCTTGTGAAGCATTGAGG - Intergenic
1000567744 5:162871431-162871453 AAGAGACTTTTGGAAGATGGTGG + Intergenic
1002628766 5:180553575-180553597 AAGAAACTGATGAAGTCTGGGGG - Intronic
1003878626 6:10460652-10460674 AAGATACATGTGAAGTATTTAGG + Intergenic
1005366975 6:25088467-25088489 AAGAGACTTGGGAAGAACAGTGG + Intergenic
1006606782 6:35263123-35263145 AAGAGACTGATGAAGTTTGGTGG - Intronic
1011231242 6:85164654-85164676 AAGAGATTTTTGAAGAGTGGAGG - Intergenic
1011819601 6:91235755-91235777 AAGAGCCTAGAGAAGGATGGAGG - Intergenic
1012134612 6:95540728-95540750 AAAAGACTTGTCTAGTATGTCGG - Intergenic
1012382362 6:98635274-98635296 AAGAAAGATGTGAAGTTTGGGGG + Intergenic
1013657784 6:112263404-112263426 AAGAAACTTTGGAAGTAGGGAGG + Intergenic
1014417679 6:121203750-121203772 AAAAGAATAGTGCAGTATGGTGG - Intronic
1014788775 6:125647332-125647354 AAGGGACATGTGTAGTGTGGTGG - Intergenic
1016503139 6:144745345-144745367 AAGCGACATGTGAAATATGAAGG - Intronic
1016695045 6:146984431-146984453 AAGAGAGATGTGAAGTCTGGAGG - Intergenic
1018040204 6:159915217-159915239 AGGAAACTGGTGAAGTTTGGGGG + Exonic
1020988972 7:15171807-15171829 AAGAAACTTGAGAAATTTGGGGG + Intergenic
1021267103 7:18538322-18538344 AACATACTAGTTAAGTATGGTGG + Intronic
1022038784 7:26559505-26559527 ATGACACTTGAGAATTATGGTGG + Intergenic
1024191973 7:47021430-47021452 AGGAGACTTGTGAATCAAGGAGG + Intergenic
1024532683 7:50406511-50406533 AGGAGACTTGGGAGGTAAGGAGG - Intergenic
1028350518 7:89841637-89841659 AAGAGACTTGGCAGGTACGGTGG + Intergenic
1030544293 7:110873008-110873030 AAGTGACTTGTGATATTTGGGGG + Intronic
1034012092 7:147540268-147540290 AAGAGATGTGTAAAGGATGGAGG - Intronic
1037853701 8:22354081-22354103 AAGAGGCTACTGAAGAATGGTGG - Intronic
1038262954 8:26013506-26013528 AAGAGAGTTTTGCAGGATGGAGG - Intronic
1038350836 8:26774900-26774922 AAGAGATTTGGGAAGAATGGAGG - Intronic
1039931477 8:41994599-41994621 AAGGAACTTGTGAATTATTGGGG - Intronic
1041163163 8:55065438-55065460 AAGATTCATGTGAAGTCTGGAGG + Intergenic
1041250259 8:55927226-55927248 AATAAACATGTGAAGAATGGGGG - Intronic
1043833735 8:85020757-85020779 GTGAGAGTGGTGAAGTATGGAGG + Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1047037118 8:120952211-120952233 AAAAGACTTGTGAGGCTTGGAGG + Intergenic
1047716058 8:127596345-127596367 AAGATCCTTGTGAAGGATGACGG - Intergenic
1048836805 8:138526781-138526803 AATAGATTAGTGAAGTATAGAGG - Intergenic
1051868241 9:21706815-21706837 AAGAGACTTACAAAGTATAGTGG + Intergenic
1051964464 9:22810697-22810719 AAGTGACCTGAGAAGTTTGGCGG + Intergenic
1052035084 9:23671316-23671338 AACAGGCTTTTGAAGTATGATGG + Intergenic
1055524089 9:77112418-77112440 AAGATATTTGTGAATTAAGGTGG + Intergenic
1056097567 9:83271187-83271209 AACAGACTTGACAAGTATAGTGG + Intronic
1057341964 9:94210916-94210938 AAGAGACTTGTGAAGCAGACAGG - Intergenic
1060401871 9:123354200-123354222 AAGTGTCTTGTGAGGTCTGGAGG - Intergenic
1186422432 X:9436928-9436950 AAGAGACCTGAGAATTATGAAGG - Intergenic
1186945183 X:14558443-14558465 AAGATATATTTGAAGTATGGTGG - Intronic
1187224911 X:17366689-17366711 GAGAAACCTGTGAAGTATGAAGG + Intergenic
1188808411 X:34620663-34620685 AAAAGACTTGAGCAATATGGGGG - Intergenic
1193977674 X:88142809-88142831 AAGAGAGTTGGGAAATATGGAGG - Intergenic
1194446346 X:93991665-93991687 AAGATAATTGTAAGGTATGGAGG + Intergenic
1195423709 X:104704090-104704112 AAGAGACTTATGTGGCATGGTGG + Intronic
1198736586 X:139792304-139792326 AAGAGATGGGTGAAGTATGGGGG - Intronic
1200300614 X:154971027-154971049 AAGAGAATAATGAAGTATGAGGG - Intronic
1201965106 Y:19724186-19724208 AAGGGACTTTTGGAGTTTGGAGG + Intronic