ID: 1121208462

View in Genome Browser
Species Human (GRCh38)
Location 14:92188555-92188577
Sequence GGCATATGCGCTTCCTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121208462_1121208466 2 Left 1121208462 14:92188555-92188577 CCATTCCAGGAAGCGCATATGCC No data
Right 1121208466 14:92188580-92188602 TATTACAGCACCTCTGAAACTGG No data
1121208462_1121208467 3 Left 1121208462 14:92188555-92188577 CCATTCCAGGAAGCGCATATGCC No data
Right 1121208467 14:92188581-92188603 ATTACAGCACCTCTGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121208462 Original CRISPR GGCATATGCGCTTCCTGGAA TGG (reversed) Intergenic
No off target data available for this crispr