ID: 1121209007

View in Genome Browser
Species Human (GRCh38)
Location 14:92192581-92192603
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121209007_1121209012 22 Left 1121209007 14:92192581-92192603 CCCTTTGAATTCAGGCTTGCCTT No data
Right 1121209012 14:92192626-92192648 ACATGGCAGAAGTGATGTTCTGG No data
1121209007_1121209010 5 Left 1121209007 14:92192581-92192603 CCCTTTGAATTCAGGCTTGCCTT No data
Right 1121209010 14:92192609-92192631 CTTGCATCACCAATAGAACATGG No data
1121209007_1121209013 23 Left 1121209007 14:92192581-92192603 CCCTTTGAATTCAGGCTTGCCTT No data
Right 1121209013 14:92192627-92192649 CATGGCAGAAGTGATGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121209007 Original CRISPR AAGGCAAGCCTGAATTCAAA GGG (reversed) Intergenic
No off target data available for this crispr