ID: 1121209008

View in Genome Browser
Species Human (GRCh38)
Location 14:92192582-92192604
Sequence TAAGGCAAGCCTGAATTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121209008_1121209013 22 Left 1121209008 14:92192582-92192604 CCTTTGAATTCAGGCTTGCCTTA No data
Right 1121209013 14:92192627-92192649 CATGGCAGAAGTGATGTTCTGGG No data
1121209008_1121209012 21 Left 1121209008 14:92192582-92192604 CCTTTGAATTCAGGCTTGCCTTA No data
Right 1121209012 14:92192626-92192648 ACATGGCAGAAGTGATGTTCTGG No data
1121209008_1121209010 4 Left 1121209008 14:92192582-92192604 CCTTTGAATTCAGGCTTGCCTTA No data
Right 1121209010 14:92192609-92192631 CTTGCATCACCAATAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121209008 Original CRISPR TAAGGCAAGCCTGAATTCAA AGG (reversed) Intergenic
No off target data available for this crispr