ID: 1121209013

View in Genome Browser
Species Human (GRCh38)
Location 14:92192627-92192649
Sequence CATGGCAGAAGTGATGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121209006_1121209013 26 Left 1121209006 14:92192578-92192600 CCTCCCTTTGAATTCAGGCTTGC No data
Right 1121209013 14:92192627-92192649 CATGGCAGAAGTGATGTTCTGGG No data
1121209009_1121209013 4 Left 1121209009 14:92192600-92192622 CCTTAATGACTTGCATCACCAAT No data
Right 1121209013 14:92192627-92192649 CATGGCAGAAGTGATGTTCTGGG No data
1121209007_1121209013 23 Left 1121209007 14:92192581-92192603 CCCTTTGAATTCAGGCTTGCCTT No data
Right 1121209013 14:92192627-92192649 CATGGCAGAAGTGATGTTCTGGG No data
1121209008_1121209013 22 Left 1121209008 14:92192582-92192604 CCTTTGAATTCAGGCTTGCCTTA No data
Right 1121209013 14:92192627-92192649 CATGGCAGAAGTGATGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121209013 Original CRISPR CATGGCAGAAGTGATGTTCT GGG Intergenic
No off target data available for this crispr