ID: 1121210856

View in Genome Browser
Species Human (GRCh38)
Location 14:92207221-92207243
Sequence CCCTCCAGCCAAACTCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121210856_1121210863 -7 Left 1121210856 14:92207221-92207243 CCTGAGGGAGTTTGGCTGGAGGG No data
Right 1121210863 14:92207237-92207259 TGGAGGGGAGGGGTTTGGAATGG No data
1121210856_1121210864 -6 Left 1121210856 14:92207221-92207243 CCTGAGGGAGTTTGGCTGGAGGG No data
Right 1121210864 14:92207238-92207260 GGAGGGGAGGGGTTTGGAATGGG No data
1121210856_1121210866 1 Left 1121210856 14:92207221-92207243 CCTGAGGGAGTTTGGCTGGAGGG No data
Right 1121210866 14:92207245-92207267 AGGGGTTTGGAATGGGCTCCGGG No data
1121210856_1121210865 0 Left 1121210856 14:92207221-92207243 CCTGAGGGAGTTTGGCTGGAGGG No data
Right 1121210865 14:92207244-92207266 GAGGGGTTTGGAATGGGCTCCGG No data
1121210856_1121210867 12 Left 1121210856 14:92207221-92207243 CCTGAGGGAGTTTGGCTGGAGGG No data
Right 1121210867 14:92207256-92207278 ATGGGCTCCGGGCTCTGCAGAGG No data
1121210856_1121210869 28 Left 1121210856 14:92207221-92207243 CCTGAGGGAGTTTGGCTGGAGGG No data
Right 1121210869 14:92207272-92207294 GCAGAGGAAGAGAACACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121210856 Original CRISPR CCCTCCAGCCAAACTCCCTC AGG (reversed) Intergenic
No off target data available for this crispr