ID: 1121211600

View in Genome Browser
Species Human (GRCh38)
Location 14:92211555-92211577
Sequence GGGGGGCCTCACCATTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121211598_1121211600 -10 Left 1121211598 14:92211542-92211564 CCATGTGGCTGGGGGGGGGCCTC No data
Right 1121211600 14:92211555-92211577 GGGGGGCCTCACCATTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121211600 Original CRISPR GGGGGGCCTCACCATTATGG TGG Intergenic
No off target data available for this crispr