ID: 1121217438

View in Genome Browser
Species Human (GRCh38)
Location 14:92259447-92259469
Sequence CCTCCCAGTCAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121217438_1121217445 8 Left 1121217438 14:92259447-92259469 CCAGCCTCCCTCTGACTGGGAGG No data
Right 1121217445 14:92259478-92259500 GTTGAAATTGCTCCCTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121217438 Original CRISPR CCTCCCAGTCAGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr