ID: 1121223931

View in Genome Browser
Species Human (GRCh38)
Location 14:92307654-92307676
Sequence CAGTCTAAGAAGAGAGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121223931_1121223932 -9 Left 1121223931 14:92307654-92307676 CCAGAGTCTCTCTTCTTAGACTG No data
Right 1121223932 14:92307668-92307690 CTTAGACTGTGAACATCCAGAGG No data
1121223931_1121223933 -8 Left 1121223931 14:92307654-92307676 CCAGAGTCTCTCTTCTTAGACTG No data
Right 1121223933 14:92307669-92307691 TTAGACTGTGAACATCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121223931 Original CRISPR CAGTCTAAGAAGAGAGACTC TGG (reversed) Intergenic
No off target data available for this crispr