ID: 1121223931 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:92307654-92307676 |
| Sequence | CAGTCTAAGAAGAGAGACTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1121223931_1121223932 | -9 | Left | 1121223931 | 14:92307654-92307676 | CCAGAGTCTCTCTTCTTAGACTG | No data | ||
| Right | 1121223932 | 14:92307668-92307690 | CTTAGACTGTGAACATCCAGAGG | No data | ||||
| 1121223931_1121223933 | -8 | Left | 1121223931 | 14:92307654-92307676 | CCAGAGTCTCTCTTCTTAGACTG | No data | ||
| Right | 1121223933 | 14:92307669-92307691 | TTAGACTGTGAACATCCAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1121223931 | Original CRISPR | CAGTCTAAGAAGAGAGACTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||