ID: 1121224064

View in Genome Browser
Species Human (GRCh38)
Location 14:92308420-92308442
Sequence ACGTGTCCCCAGCAGTATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121224061_1121224064 5 Left 1121224061 14:92308392-92308414 CCTGCCAGGCAGCATGATCCAGA No data
Right 1121224064 14:92308420-92308442 ACGTGTCCCCAGCAGTATCACGG No data
1121224055_1121224064 28 Left 1121224055 14:92308369-92308391 CCATGGGCTGGGCAGGACCCACC No data
Right 1121224064 14:92308420-92308442 ACGTGTCCCCAGCAGTATCACGG No data
1121224062_1121224064 1 Left 1121224062 14:92308396-92308418 CCAGGCAGCATGATCCAGAGCAT No data
Right 1121224064 14:92308420-92308442 ACGTGTCCCCAGCAGTATCACGG No data
1121224060_1121224064 6 Left 1121224060 14:92308391-92308413 CCCTGCCAGGCAGCATGATCCAG No data
Right 1121224064 14:92308420-92308442 ACGTGTCCCCAGCAGTATCACGG No data
1121224058_1121224064 10 Left 1121224058 14:92308387-92308409 CCACCCCTGCCAGGCAGCATGAT No data
Right 1121224064 14:92308420-92308442 ACGTGTCCCCAGCAGTATCACGG No data
1121224059_1121224064 7 Left 1121224059 14:92308390-92308412 CCCCTGCCAGGCAGCATGATCCA No data
Right 1121224064 14:92308420-92308442 ACGTGTCCCCAGCAGTATCACGG No data
1121224057_1121224064 11 Left 1121224057 14:92308386-92308408 CCCACCCCTGCCAGGCAGCATGA No data
Right 1121224064 14:92308420-92308442 ACGTGTCCCCAGCAGTATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121224064 Original CRISPR ACGTGTCCCCAGCAGTATCA CGG Intergenic
No off target data available for this crispr