ID: 1121224196

View in Genome Browser
Species Human (GRCh38)
Location 14:92309378-92309400
Sequence CGCCCCCTCGGGTTTTCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121224187_1121224196 -8 Left 1121224187 14:92309363-92309385 CCTCCCCTGGAAGCCCGCCCCCT No data
Right 1121224196 14:92309378-92309400 CGCCCCCTCGGGTTTTCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121224196 Original CRISPR CGCCCCCTCGGGTTTTCTAT GGG Intergenic
No off target data available for this crispr