ID: 1121224747

View in Genome Browser
Species Human (GRCh38)
Location 14:92313074-92313096
Sequence AAGACCTTGAATATAATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121224747_1121224749 2 Left 1121224747 14:92313074-92313096 CCAGAAATTATATTCAAGGTCTT No data
Right 1121224749 14:92313099-92313121 GTATATGGTTTGTACACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121224747 Original CRISPR AAGACCTTGAATATAATTTC TGG (reversed) Intergenic
No off target data available for this crispr