ID: 1121224747 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:92313074-92313096 |
| Sequence | AAGACCTTGAATATAATTTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1121224747_1121224749 | 2 | Left | 1121224747 | 14:92313074-92313096 | CCAGAAATTATATTCAAGGTCTT | No data | ||
| Right | 1121224749 | 14:92313099-92313121 | GTATATGGTTTGTACACTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1121224747 | Original CRISPR | AAGACCTTGAATATAATTTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||