ID: 1121225219

View in Genome Browser
Species Human (GRCh38)
Location 14:92316821-92316843
Sequence CCAAGTGAGCAGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121225209_1121225219 26 Left 1121225209 14:92316772-92316794 CCTGTGGTTATCCCAACCTGCCT No data
Right 1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG No data
1121225212_1121225219 10 Left 1121225212 14:92316788-92316810 CCTGCCTTATTTCCACTCTCAGA No data
Right 1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG No data
1121225210_1121225219 15 Left 1121225210 14:92316783-92316805 CCCAACCTGCCTTATTTCCACTC No data
Right 1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG No data
1121225208_1121225219 27 Left 1121225208 14:92316771-92316793 CCCTGTGGTTATCCCAACCTGCC No data
Right 1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG No data
1121225207_1121225219 28 Left 1121225207 14:92316770-92316792 CCCCTGTGGTTATCCCAACCTGC No data
Right 1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG No data
1121225214_1121225219 -2 Left 1121225214 14:92316800-92316822 CCACTCTCAGACTGACAAGAGCC No data
Right 1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG No data
1121225211_1121225219 14 Left 1121225211 14:92316784-92316806 CCAACCTGCCTTATTTCCACTCT No data
Right 1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG No data
1121225213_1121225219 6 Left 1121225213 14:92316792-92316814 CCTTATTTCCACTCTCAGACTGA No data
Right 1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121225219 Original CRISPR CCAAGTGAGCAGAGGGCAGT GGG Intergenic
No off target data available for this crispr