ID: 1121226964

View in Genome Browser
Species Human (GRCh38)
Location 14:92328179-92328201
Sequence TAGGCCAGGGAGGAAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 360}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121226964 Original CRISPR TAGGCCAGGGAGGAAGATGC TGG (reversed) Intronic
900419456 1:2549421-2549443 TAGGCCAGGGTGGGAGAAGGGGG - Intergenic
900589558 1:3453667-3453689 CAGGCCAGGGAGGCAGGTCCTGG + Intergenic
900996218 1:6124859-6124881 TATGGCAGCGAGGAAGATCCCGG - Intronic
901150872 1:7100373-7100395 AAGGCCAGTGAGGAAGAAACAGG - Intronic
901306934 1:8239606-8239628 AAGGCCATGGAGGAAGAGGGAGG + Intergenic
901685350 1:10940635-10940657 AGGGCCAGGGAGGACCATGCTGG - Intergenic
901712444 1:11126309-11126331 GAGGCCAGGGAGGAGGCAGCTGG - Intronic
901757080 1:11448024-11448046 AAGGCCAGGGAGGAGGAGGTAGG + Intergenic
902452874 1:16509221-16509243 TAGGGAAGGGAGGAAGAAGGAGG + Intergenic
902472932 1:16661900-16661922 TAGGGAAGGGAGGAAGAAGGAGG + Intergenic
902485871 1:16745540-16745562 TAGGGAAGGGAGGAAGAAGGAGG - Intronic
902499608 1:16900995-16901017 TAGGGAAGGGAGGAAGAAGGAGG - Intronic
904904375 1:33883989-33884011 TAGGCCAGGCAGGAAGCTAGAGG + Intronic
906242348 1:44249677-44249699 AAGGACAGGGGAGAAGATGCTGG + Intronic
906249929 1:44303153-44303175 TAGGCCAGGGAGGAGGAGCTTGG - Intronic
906701982 1:47866263-47866285 TAGTCCAGGGAGGCAGACACAGG + Intronic
907466364 1:54640401-54640423 GAGGCCAGAGAGGAAGAGGGAGG + Intergenic
908009299 1:59759314-59759336 AAGGCCAGGGTGGAAGGTACAGG + Intronic
908314105 1:62915980-62916002 TATGCCAGGAAAGAAGATGGTGG + Intergenic
911134406 1:94423796-94423818 TAGTGCAGGGAGTAAGAAGCTGG - Intronic
911908305 1:103597483-103597505 TAGGACAGGGAGGAAAAAGGTGG - Intergenic
911910671 1:103630531-103630553 TAGGACAGGGAGGAAAAAGGTGG - Intergenic
911914613 1:103681983-103682005 TAGGACAGGGAGGAAAAAGGTGG + Intronic
911918086 1:103724656-103724678 TAGGACAGGGAGGAAAAAGGTGG - Intronic
911921256 1:103764157-103764179 TAGGACAGGGAGGAAAAAGGTGG - Intergenic
912405201 1:109431942-109431964 TAACCCAGCTAGGAAGATGCTGG + Intergenic
912430067 1:109624255-109624277 TAAGCCAGGGTGGAGGGTGCTGG + Intronic
912449595 1:109760931-109760953 TCTACCAGGGAGGATGATGCAGG - Intronic
912953835 1:114138876-114138898 GAGGCCAGGAATGAACATGCTGG - Intronic
913967761 1:143391364-143391386 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
914004928 1:143724152-143724174 TAGGGAAGGGAGGAAGAAGGAGG + Intergenic
914062139 1:144216954-144216976 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
914117011 1:144749400-144749422 ATGGGCAGGTAGGAAGATGCTGG + Intergenic
914820808 1:151101171-151101193 TGGGCCTGGGAGGCAGAGGCTGG + Intronic
915386380 1:155497415-155497437 TAGGCCAAGGAGGAAGAGTAGGG - Intronic
915732865 1:158066631-158066653 TAGGTCAGGGAGGCAGGTGCAGG + Intronic
917367089 1:174244031-174244053 TAGGGCAGAGAGGAAGATGTTGG - Intronic
919133833 1:193484026-193484048 AAGGTCAGGGAGGGAGATGTTGG - Intergenic
919431924 1:197504597-197504619 TAGGCCTGTCAGAAAGATGCAGG + Intergenic
919820023 1:201466853-201466875 TGGGCCAGGGAAGGAGAAGCTGG - Intronic
919917071 1:202145144-202145166 TACGACAGGGAGGCAGATGGAGG + Intergenic
920075088 1:203330306-203330328 TATCCCAGGGTGGAAGAGGCAGG - Intergenic
920528042 1:206683364-206683386 TAGACTCGGGAGGAAGCTGCTGG + Intronic
921055267 1:211538356-211538378 AAGGCCAGGGAGGAACAGGAAGG - Intergenic
921262327 1:213395139-213395161 TAGTCCAGGGAGGATGGTGGAGG + Intergenic
922125067 1:222713348-222713370 TGGGCACGGGAGGAAGAGGCTGG + Intronic
922360812 1:224819684-224819706 ATGGCCAGGGAGAAAGAGGCAGG - Intergenic
922572752 1:226643513-226643535 AAGGCCTGGGAGACAGATGCAGG - Intronic
1063003925 10:1950873-1950895 TTGGCAAGTGAGGAAGATGTTGG + Intergenic
1063299681 10:4840431-4840453 TGGGCCAGGGAGGGAGCTGAGGG - Intronic
1063789504 10:9425735-9425757 TTGTCCAGGGAGGGAGTTGCAGG + Intergenic
1064216812 10:13407278-13407300 AAGGGAAAGGAGGAAGATGCCGG + Intergenic
1066617028 10:37305564-37305586 TAGGGCAGGGAGCAGCATGCAGG + Intronic
1067416080 10:46104273-46104295 TAGCTCTGGGAGGCAGATGCGGG - Intergenic
1069714569 10:70512426-70512448 TAGGCCAGGAAGGGGGAAGCAGG + Intronic
1074843918 10:117380092-117380114 TGGGACATGGAAGAAGATGCTGG - Intergenic
1075417785 10:122278110-122278132 TCGGCCAGGGATGCAGGTGCTGG + Intronic
1075968290 10:126631671-126631693 GAGGCCAGGGAGGTAGAGGGTGG - Intronic
1076065077 10:127442182-127442204 TAGGCTTGGGAGGAAGATTCAGG - Intronic
1076469925 10:130711191-130711213 TTGGCCAGGCAGCCAGATGCTGG + Intergenic
1077221654 11:1420664-1420686 TAGGCAGTGGAGGAAGAGGCTGG - Intronic
1077909859 11:6564280-6564302 TAGGCCAGTGAGGAGGGTGCAGG - Intronic
1078017249 11:7625518-7625540 CTGGTCAGGTAGGAAGATGCAGG + Intronic
1078379267 11:10825342-10825364 TAGGCATGGGAGGGAGATGGGGG + Intronic
1078572854 11:12474495-12474517 TAGGACAGGGAATAAGACGCAGG - Intronic
1078755545 11:14205334-14205356 CAGGCCCTGGAGGAAGATGGAGG - Intronic
1080421780 11:32117305-32117327 AAGGCCTGGGAGGATGATGCTGG - Intergenic
1081480143 11:43478717-43478739 TGGGGCAGGGAGGATGAGGCAGG - Intronic
1083201520 11:61123783-61123805 TGGGCCTGGGAGGGAGATGGTGG - Intronic
1083474908 11:62909442-62909464 AAGGCCCGGGAGGAGGATCCGGG - Exonic
1083904278 11:65660042-65660064 TTGGCCAGTGAGGGAGATGCAGG + Intronic
1083925510 11:65803768-65803790 AAGTGCAGGAAGGAAGATGCTGG + Intergenic
1084137597 11:67198080-67198102 TAGGCTAAGGAGGAAGAGGTGGG + Intronic
1084139469 11:67215460-67215482 CAGCACACGGAGGAAGATGCAGG - Intronic
1084275101 11:68047370-68047392 TTGGGCCGGGAGGCAGATGCTGG + Intronic
1084461778 11:69300254-69300276 CAGGCCAGGCAGGAAGTGGCAGG + Intronic
1085041860 11:73331408-73331430 GGGGCCAGGGAGGAAGGTCCAGG - Intronic
1087212959 11:95461799-95461821 TACACCAGGGAAGAAGATGGAGG - Intergenic
1088576493 11:111277390-111277412 TAGGCCTGGGCAGAAGATGGAGG + Intronic
1089252477 11:117174949-117174971 GAGGACAGGGAGGAAGCTTCAGG - Intronic
1089362968 11:117903399-117903421 CAGGCCAGGCAGGCAGTTGCTGG - Intronic
1089705688 11:120276050-120276072 GAGGCCAGTGAGGGAAATGCAGG + Intronic
1092086478 12:5767134-5767156 AAGTCCAGGGAGGAAGGGGCAGG - Intronic
1092570674 12:9718043-9718065 TAGGCCAAAGAGGAAGAATCAGG - Intronic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1093785977 12:23192698-23192720 TAGGCGAAGGAGGTAGAGGCGGG - Intergenic
1094443487 12:30505121-30505143 TAGGTCAGGTAGGAAGCTGATGG + Intergenic
1096228265 12:49882971-49882993 TAGGGTAGGGAGGAAGAGGGAGG + Intronic
1096475669 12:51907451-51907473 TGGGCCAGGCAGGAAGACGCTGG + Exonic
1096980355 12:55725098-55725120 TTGGCCAGGAAGGGAGGTGCTGG + Intergenic
1097080763 12:56429148-56429170 TAGGACAGGAAGGAAGAAGTTGG - Intronic
1097637229 12:62137729-62137751 AGGGTCAGGGAGGAAGCTGCAGG - Intronic
1098148935 12:67526604-67526626 TAGTCCAGGGAAGAAGTTCCAGG + Intergenic
1098179682 12:67832782-67832804 GAAGCAAGGGAGGCAGATGCCGG + Intergenic
1098462796 12:70751347-70751369 TATCCCAGTGAAGAAGATGCTGG - Intronic
1100730048 12:97455084-97455106 TAGGCCACGGAGGTAGAAGAAGG - Intergenic
1101334989 12:103789049-103789071 TAGGCCAGGGAATATGATGGTGG - Intronic
1102572999 12:113838965-113838987 AGGGCCTGGCAGGAAGATGCCGG - Intronic
1103957208 12:124583868-124583890 TAGGCCGGGGAGCAAGAGGGAGG + Intergenic
1104075040 12:125381364-125381386 GAGACCAAGGAGGAAGATGAAGG + Intronic
1104607109 12:130198243-130198265 CAGTGCAGGGAGGAAGATGCTGG + Intergenic
1104896798 12:132168733-132168755 GATGCCAGGGAGCAGGATGCGGG + Intergenic
1107629018 13:42324230-42324252 TAGGACAGAGAGGAAGGTGAGGG + Intergenic
1108064637 13:46564609-46564631 TGGGCCAGGGAGGAATAGGCCGG + Intronic
1108342709 13:49513829-49513851 GAGGCCAGAGAGGAAGAACCTGG - Intronic
1109519352 13:63487372-63487394 AAGGGCAGGGAGAAAGATGTAGG - Intergenic
1109877725 13:68428004-68428026 TAGCCCAGGGACTAAGATGATGG + Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113311390 13:109136702-109136724 AAGAACAGTGAGGAAGATGCTGG - Intronic
1113486790 13:110659219-110659241 TATGCCAGGGAGGCATATTCAGG - Intronic
1113631937 13:111893940-111893962 AAGGCCAGGGAGGCAGTTGGGGG + Intergenic
1114408208 14:22475953-22475975 TAGGCCAGGGAAGGAGACGCTGG - Intergenic
1118822384 14:69353822-69353844 CACGCCAGGGAGGAAGATTAGGG - Exonic
1118866985 14:69711807-69711829 AAGGCCAGGAAGGCCGATGCTGG - Exonic
1119708978 14:76807576-76807598 GAGGCCAGGTGGGAAGCTGCTGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120022931 14:79550659-79550681 CAGCCAAGGAAGGAAGATGCTGG + Intronic
1121150461 14:91628666-91628688 GAGGCCATGGTGGAAGATGAAGG - Intronic
1121226964 14:92328179-92328201 TAGGCCAGGGAGGAAGATGCTGG - Intronic
1122194068 14:100071766-100071788 TGGGTCTGGGAGGAGGATGCAGG + Intronic
1123000774 14:105292993-105293015 TGGGTGAGGGAGGAAGCTGCTGG - Intronic
1124440651 15:29683679-29683701 TGAGCCAGGGAGGTGGATGCTGG - Intergenic
1126665126 15:51069005-51069027 TAGGGTAGGGAGGGAGAGGCAGG + Intronic
1127001443 15:54512515-54512537 TGTGGCAGGCAGGAAGATGCAGG - Intronic
1127333377 15:57960201-57960223 TGGTCTATGGAGGAAGATGCAGG - Intronic
1127693714 15:61423103-61423125 CTGTCCAGGGAGGAAGAGGCTGG + Intergenic
1127704960 15:61537355-61537377 TAGGTCAGGGAGGATGAGGATGG + Intergenic
1129233227 15:74208365-74208387 CAGCCCAGGGAGGAACGTGCTGG - Intronic
1130285827 15:82553630-82553652 TGAGCCAGGGAGGAGAATGCTGG - Intronic
1130347659 15:83063704-83063726 TAGGCCAGACAGGATGGTGCAGG - Intronic
1130896529 15:88174432-88174454 GAGGCCAGGAGGGAAGATGCTGG - Intronic
1131511424 15:93051411-93051433 GAGGCCAGGAAGGAAGCTGGTGG - Intronic
1132175473 15:99710781-99710803 TAGGCCAGGAGTAAAGATGCAGG - Intronic
1132700111 16:1218691-1218713 CAGGACAGGGAGGAAGATGGGGG + Intronic
1133162702 16:3922509-3922531 CAGGGCAGGGAGGAAGCCGCTGG + Intergenic
1133303110 16:4795239-4795261 AGGCCCAGGGAGGAAGACGCCGG - Intronic
1134887116 16:17803496-17803518 TACCCCAGGGAGTAAGATTCAGG - Intergenic
1135322640 16:21507485-21507507 GGGGCCAGGGAGGAAGGTACTGG - Intergenic
1135957482 16:26967983-26968005 CAGGCCAAGGAGGCAGAAGCAGG + Intergenic
1136172106 16:28495720-28495742 GGGGTCAGGGAGGCAGATGCAGG + Exonic
1136334116 16:29600622-29600644 GGGGCCAGGGAGGAAGGTACTGG - Intergenic
1136616075 16:31399355-31399377 TGGGACTGGGAGGAAGATACAGG + Intronic
1136984347 16:35084941-35084963 GGAGCCAGGGAGGGAGATGCGGG - Intergenic
1137706574 16:50539695-50539717 GAGGCCAGGAAGGCAGACGCAGG - Intergenic
1138337428 16:56264115-56264137 CAGGCCAGGGCCGATGATGCAGG + Intronic
1138428347 16:56951370-56951392 GAGGGCAGGGTGGAGGATGCGGG + Intergenic
1141290848 16:82716972-82716994 TCGTCCAGACAGGAAGATGCTGG + Intronic
1142034888 16:87856715-87856737 GGGGCCAGGGAGGAAGGTACTGG - Intronic
1142191605 16:88720721-88720743 GAGGACAGGGAGGAAGAAGAGGG - Exonic
1142305804 16:89284753-89284775 GAAGCCAGTGAGGAAGAGGCAGG - Exonic
1142754427 17:2007549-2007571 TAGGCCAGGCTGCCAGATGCTGG + Intronic
1142902434 17:3020399-3020421 TAGACCAGGGAGGAGGATGAGGG + Intronic
1143082958 17:4395029-4395051 TGGGCCAGGGAGGCTGAGGCAGG - Intergenic
1143587104 17:7855781-7855803 CAGGGCAGGTCGGAAGATGCCGG - Exonic
1144965926 17:19077385-19077407 TAAGACAGGGAGGAAGGGGCTGG + Intergenic
1144982042 17:19174804-19174826 TAAGACAGGGAGGAAGGGGCTGG - Intergenic
1144986181 17:19203435-19203457 TAAGACAGGGAGGAAGGGGCTGG + Intergenic
1145211642 17:21017627-21017649 TAGACCATGGAGGAAGAGGAAGG + Intronic
1146560288 17:33863009-33863031 TTGCTCAGGGAGAAAGATGCAGG - Intronic
1148357629 17:46986278-46986300 TAGACCAGGGATGATGATGATGG + Intronic
1149656173 17:58310648-58310670 TTGGCCAGTGAGGGAGCTGCGGG + Exonic
1149658103 17:58320673-58320695 GAGGCAGGGGAGGAAGAAGCCGG + Intronic
1149669442 17:58393026-58393048 TAGGTTAAGGAGGAAGATGAGGG - Intronic
1150134555 17:62688800-62688822 TAGCACAGGGAGGCAGCTGCTGG + Intronic
1150270428 17:63860849-63860871 ACTGCCAGGGAGGAAGATGATGG + Intergenic
1150568922 17:66368870-66368892 CAGGCCAGGGAGCAAGACTCAGG - Intronic
1150914370 17:69421959-69421981 CAAGCCAGGGAGGAAGGGGCTGG - Intronic
1151080068 17:71319229-71319251 TAGGGCAGTGAGGACTATGCTGG - Intergenic
1151487523 17:74410589-74410611 TAGGCCTGGGAGAAGGCTGCAGG + Intergenic
1151522438 17:74640043-74640065 TGGGTCTCGGAGGAAGATGCAGG - Intergenic
1151647819 17:75445532-75445554 TAGGACAGTTGGGAAGATGCAGG + Intronic
1151674542 17:75590775-75590797 TAGCCCGGGGAGGAAGAGGAAGG - Intergenic
1152134071 17:78493874-78493896 TGGGCCAGGGAGGAAGCTGGGGG - Intronic
1152187556 17:78867473-78867495 CATTGCAGGGAGGAAGATGCAGG - Intronic
1152529278 17:80907572-80907594 GAGGCCAGGGAGGAGGCTGATGG - Intronic
1153610427 18:6879062-6879084 CAGCCCTGGGAGGAAGCTGCTGG + Intronic
1155218297 18:23662540-23662562 GAGGCCCGGGAGGAAGCGGCGGG - Intronic
1155386376 18:25282388-25282410 TAGACCAGGGAGCAAAGTGCAGG + Intronic
1156498092 18:37538982-37539004 TGGGGCAGGGAGGGAGCTGCTGG - Intronic
1158328703 18:56338050-56338072 TAGGGAATGGAGGAAAATGCTGG - Intergenic
1160536449 18:79597053-79597075 CAGCCCAGGGAGTGAGATGCTGG - Intergenic
1160560182 18:79751108-79751130 CAGGCCAGGGAGGGAGGGGCTGG + Intronic
1160560254 18:79751309-79751331 CAGGCCAGGGAGGGAGGGGCTGG + Intronic
1160793353 19:933029-933051 TGGGCCTGGGAGGGAGAGGCTGG + Intronic
1160863450 19:1247510-1247532 TAGGCCAGAGAGGGAGAGGCTGG - Intergenic
1160865185 19:1253125-1253147 TTCCCCAGGGAGGAAGTTGCAGG + Intronic
1161146753 19:2683537-2683559 CAGGCCAAAGAAGAAGATGCAGG + Intronic
1161221409 19:3119836-3119858 TAGGGCACAGAGGAGGATGCAGG - Intronic
1161459511 19:4388545-4388567 GAGGCCAGGGAGAGAGCTGCAGG + Intronic
1162969265 19:14170290-14170312 AAGGCGAGGGAGGCAGATGGGGG + Intronic
1165256692 19:34580546-34580568 CAGGGCAGGGAGGAAGAGACAGG - Intergenic
1165265894 19:34663847-34663869 CAGGGCAGGGAGGAAGAGACAGG + Intronic
1165273534 19:34730878-34730900 TAGGGCAAGGAGGAAGAGACAGG + Intergenic
1165306447 19:35005574-35005596 GAGACCAGGGAGGAGGCTGCTGG + Intronic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165490288 19:36119469-36119491 GAGGCCAGGGAGGAAGCTGCCGG - Intronic
1166066166 19:40360316-40360338 GAGCCCAGGGAGGAGGCTGCTGG - Intronic
1166126936 19:40720581-40720603 TGGGCCATGGAGGCAGATTCTGG - Intronic
1167648809 19:50719051-50719073 TACGCCAGGGAGGGCGAGGCGGG + Intronic
1168102353 19:54148040-54148062 GAGGCCAGAGAGGAGGCTGCTGG + Intronic
1202701548 1_KI270712v1_random:168832-168854 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
925130091 2:1488519-1488541 CAGGTCAGGGAGGAGGCTGCCGG - Intronic
925737167 2:6973566-6973588 TAGGCCAGTGAGGATGAGGTTGG + Intronic
925880211 2:8345895-8345917 TATGCCTGGGAGAAAGATGCAGG - Intergenic
926649908 2:15331979-15332001 TAAGCCATGAAGGAAGAGGCAGG + Intronic
927699488 2:25258926-25258948 TAAATCAAGGAGGAAGATGCAGG + Intronic
928276579 2:29906132-29906154 TGGGGCAGGGGGGAAGAAGCAGG + Intronic
929484568 2:42342254-42342276 TAGGCTAGGGTGGAAGAGGCAGG - Intronic
932419018 2:71590557-71590579 CAGGTCAGGGAGGAGGCTGCAGG - Intronic
932472067 2:71966113-71966135 CAGCCCAGGGAAGAAGATGAGGG + Intergenic
934172465 2:89552279-89552301 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
934282778 2:91626631-91626653 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
934523339 2:95033423-95033445 CGGGCCAGGGAGGGAGAAGCCGG + Intronic
934743250 2:96741081-96741103 TCAGCCAGGGAGGGAGAGGCTGG - Intergenic
936953748 2:118003802-118003824 GAGGACATGGAGGAAAATGCAGG + Intronic
937733858 2:125265955-125265977 TAGGCCTGGGAGCAATAAGCTGG + Intergenic
937913734 2:127088860-127088882 CAGGCCAGGAAGGAAGAAGAAGG + Intronic
941159093 2:162015614-162015636 TAGGTCAGGGAGGAGGGAGCCGG - Intronic
941232004 2:162921899-162921921 TAGACAAGATAGGAAGATGCTGG - Intergenic
941299295 2:163781326-163781348 TTGGTCAGGCAGGAAGATACGGG + Intergenic
945143030 2:206707362-206707384 AAGGCCAGGGAGGAAAACCCAGG - Exonic
945194745 2:207227578-207227600 TAGGTCAGGGAAGAAAATGCAGG - Intergenic
945268327 2:207913295-207913317 TAGTCCAGGGGGGCACATGCTGG + Intronic
945842280 2:214901985-214902007 TTGGCCAGGAAGGAAGAAGTGGG + Intergenic
946397737 2:219451714-219451736 GAGGCCAGGGCAGCAGATGCCGG + Exonic
946475263 2:220000806-220000828 AAGGCCAGTGAGAAAGATGCGGG + Intergenic
946704613 2:222445854-222445876 TAGGCCAAGCAGGAAGCTCCTGG - Intronic
948027898 2:234792382-234792404 TAGACCATAGAGCAAGATGCAGG + Intergenic
948568956 2:238905297-238905319 TGGGCCAGGCAGGCAGATACAGG + Intronic
948725879 2:239933629-239933651 TAGCCCTGGGAGGAGGCTGCAGG - Intronic
1170539712 20:17375483-17375505 TGTGACAGGGAAGAAGATGCAGG - Intronic
1171150632 20:22823879-22823901 TGAGCCAGGGAGGAAGAGGAAGG - Intergenic
1171451263 20:25237616-25237638 TAAGGTAGGGAGGAAGATGGTGG + Intergenic
1172306404 20:33883888-33883910 TAGGCAGGTGAGGACGATGCAGG - Intergenic
1172883414 20:38216292-38216314 TGGGCAAGGGAGGCAGATGTTGG - Intronic
1173538983 20:43837603-43837625 TAGGCTGGGGAGGAAGAGGAGGG + Intergenic
1174449632 20:50611245-50611267 TAGGCCTTGGAGGAACATGTGGG - Intronic
1175876394 20:62232256-62232278 GGGGCCAGGGAGGACCATGCTGG - Intronic
1176122438 20:63460205-63460227 AAGGCCAGGGAGGGACCTGCAGG - Intronic
1179593074 21:42423916-42423938 TGGGCCAGTGAGGCAGATGACGG + Intronic
1179865387 21:44213591-44213613 GAAGCCAGGGAGGAAAACGCGGG - Intergenic
1179987831 21:44931257-44931279 GAGGCGCGGGAGGAAGAGGCTGG - Intronic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181860461 22:25813883-25813905 TGGGGCAGGGAGGAGGATGCAGG - Intronic
1183603481 22:38853751-38853773 TTGGGGAGGGAGCAAGATGCAGG + Intergenic
1183618109 22:38957129-38957151 ACAGCCAGGGAAGAAGATGCAGG + Intronic
1184281796 22:43441588-43441610 CAGGCAGGGGAGGAAGATGAGGG + Intronic
1184392607 22:44213127-44213149 TAGCCCAGGGTGGAAGGGGCTGG + Intronic
1184634407 22:45815343-45815365 TTGGCAGGGGAGGAGGATGCTGG + Intronic
1184756092 22:46516808-46516830 TGTGCCAGGCAGGAAGCTGCGGG + Intronic
1184764302 22:46563710-46563732 CAGCCCAGGTAGGAGGATGCTGG - Intergenic
1184863915 22:47192209-47192231 TAGGCCTGAGAGGAAGAATCAGG - Intergenic
1185398646 22:50604926-50604948 GAGGCCAGCGAGGAGGAGGCGGG + Exonic
950203310 3:11059800-11059822 CAGCTCAGGGAGGAAGGTGCAGG + Intergenic
950706261 3:14784371-14784393 TAGGGAAGGGAGAAAGAGGCAGG - Intergenic
951079032 3:18429295-18429317 AAGAGCAGGGAGGAAGAAGCTGG + Intronic
951391849 3:22114668-22114690 CAGGTCAGGGGTGAAGATGCTGG + Intronic
952464302 3:33565059-33565081 TAGGCTAAGGAGGAAGAGGAGGG - Intronic
952847553 3:37701090-37701112 GGGTCCAGGGAGGAATATGCAGG - Intronic
953376215 3:42430669-42430691 TAGGAGAGGGATGAAGAGGCTGG - Intergenic
954327446 3:49871189-49871211 CAAGCCAGGGAGGAAGGTGAAGG - Intergenic
954699887 3:52445650-52445672 CAGGCCTGGGTGGAAGAGGCTGG - Intergenic
954705871 3:52480253-52480275 TGGGGCAGGGAGGCAGATGCGGG - Exonic
960023195 3:112978616-112978638 TTGTCCATGGAGGAAGATACAGG - Intergenic
961648105 3:128403374-128403396 CAGTGCAGGGAGGAAGATGGGGG + Intronic
961673187 3:128549485-128549507 GAAGCCAGGCAGGAAGAGGCTGG + Intergenic
961722451 3:128905997-128906019 TCGGCCAGGGAGGAACTTGAGGG - Intronic
962056473 3:131877029-131877051 AAGGCAAGGGAGAAGGATGCCGG - Intronic
962207940 3:133450478-133450500 TAGGGCAGAGTGGAGGATGCTGG - Intronic
962849288 3:139295831-139295853 GAGACCAGGGAGGAAGCTCCAGG - Intronic
963308542 3:143681829-143681851 TAGGCCAGTGATGGAGAAGCAGG + Intronic
967095450 3:186173873-186173895 GAGGCCAGGCAGGAACATGGGGG - Intronic
967770174 3:193325867-193325889 GAGACAAGGGAGGAAGATGGAGG + Intronic
968647518 4:1748049-1748071 CAGCCCAGGGAGGCAGCTGCAGG - Intergenic
969027277 4:4183589-4183611 ATGGGCAGGTAGGAAGATGCTGG + Intergenic
969215700 4:5720635-5720657 CCAGCCAGGGAGGGAGATGCAGG - Intronic
969266299 4:6066294-6066316 TAAGGCAAGGAAGAAGATGCAGG + Intronic
969385409 4:6843307-6843329 TAGTCCAGGAAGGAAGTTTCTGG - Intronic
969439334 4:7208146-7208168 CAGGCCAGGGAGGGAGCTGGGGG - Intronic
969480398 4:7443889-7443911 CAGGCCAGGGAGGTGGAGGCTGG - Intronic
969530814 4:7729267-7729289 TTAGCCAGGGAGGAAGGTGCTGG + Intronic
971349366 4:25842876-25842898 CAGGCCAGGAAGGAAAATGAAGG + Intronic
971572683 4:28233059-28233081 TATTCCAGTGAGGAAGAGGCTGG - Intergenic
972194631 4:36638695-36638717 TATGTCAGGGAGGAAATTGCAGG - Intergenic
978720613 4:111904292-111904314 GAAGCCAGGGAGGATGATGAGGG - Intergenic
979704445 4:123705490-123705512 TAGGACTGGGAGGAAGAATCAGG + Intergenic
985810607 5:2081505-2081527 TAGGCAAGGGAGGAATAGGCTGG + Intergenic
986452860 5:7883756-7883778 TCAGCCTGAGAGGAAGATGCTGG + Intronic
986612460 5:9583012-9583034 TGGTCCAGGGAGGAAGAAGGTGG + Intergenic
986754615 5:10823969-10823991 TGGGCCTGGGAGGAGGCTGCAGG + Intergenic
987666955 5:20955374-20955396 AAGGCCAGGCAGGATGACGCAGG + Intergenic
988384981 5:30551367-30551389 TAGGCAAGGGGAGAAGATACTGG + Intergenic
988918615 5:35920633-35920655 AAGGCCAGGGTGGAAGAGGGAGG - Intronic
990210697 5:53479875-53479897 TCTGCCAGGGTGGAAGGTGCCGG + Intergenic
990448723 5:55916517-55916539 TGGGCCTGGGAGGAAGGTGGGGG + Intronic
991061469 5:62380789-62380811 TAGGCTGAGGAGGAAGAGGCAGG + Intronic
992312128 5:75511601-75511623 TGGGCCAGGCAGGAAGATGGCGG - Intronic
998621062 5:143794572-143794594 CAGGTCAGAGAGGACGATGCTGG + Intergenic
999430718 5:151522991-151523013 TAAGTCAGGCAGGAAGTTGCAGG - Intronic
1000020563 5:157315109-157315131 TTGGGGAGGGAGGGAGATGCAGG - Intronic
1001223473 5:169924070-169924092 CAGGGCAGGGAGGAAGAGGGTGG - Intronic
1002795267 6:466521-466543 CTGGCCAGGGAGGGAGGTGCAGG + Intergenic
1003038078 6:2662234-2662256 AGGGCCAGGGAGGAAGAAGATGG + Intergenic
1003084279 6:3049068-3049090 GAGGCCAGGGAGGAAGGCGCAGG + Intergenic
1004670291 6:17789780-17789802 GAGGCCAGGGAGGAGGAAGGAGG - Intronic
1005298573 6:24449580-24449602 AAGGCCAGGGAGGCAGCAGCAGG + Intronic
1005367723 6:25095992-25096014 AAGGCCAGGGCAGAAGAGGCTGG + Intergenic
1006734184 6:36260829-36260851 TGGGGCAGGGAGGAGGGTGCGGG + Intronic
1006735134 6:36268022-36268044 CAGGCCAGGGTGGCAGCTGCAGG - Intronic
1006865148 6:37203382-37203404 GAGGCTGGAGAGGAAGATGCCGG + Intergenic
1007088918 6:39169779-39169801 AAGCCCAGGGATGAAGCTGCTGG + Intergenic
1007780178 6:44248098-44248120 TAGGGCAGGGAGGAATAACCTGG - Intronic
1008579909 6:52897553-52897575 TGGGGGAGGAAGGAAGATGCTGG + Intronic
1011768742 6:90652729-90652751 TGGGCCATGGAGGTACATGCCGG - Intergenic
1013613501 6:111818879-111818901 TAGGCAATGGAGGAAGCTGATGG - Intronic
1015338100 6:132064905-132064927 TAAGCCAGGGAGGAAGATGGTGG + Intergenic
1015768569 6:136745475-136745497 TGTGGCAGGGAGGAGGATGCTGG + Intronic
1015834399 6:137404358-137404380 CAGGCCAGAGAGATAGATGCAGG - Intergenic
1015941215 6:138454091-138454113 TGGGGCATGGAGGGAGATGCAGG - Intronic
1016993862 6:149947404-149947426 GATGCCAGGGAGGATGAAGCAGG - Exonic
1017004471 6:150020133-150020155 GATGCCAGGGAGGATGAAGCAGG + Exonic
1017956863 6:159185856-159185878 AAGGCAAGGGAGAAAGAAGCTGG + Intronic
1018587262 6:165375051-165375073 AAGGACAGGGAGGGAGATGGGGG - Intronic
1018893044 6:167996171-167996193 TGGGGCAGGGAAGGAGATGCTGG - Intergenic
1018936666 6:168278289-168278311 TAGGCCAGAGGGGAAGGAGCAGG - Intergenic
1018989563 6:168663157-168663179 TAGGAAAGGGATGAGGATGCTGG + Intronic
1019351518 7:556257-556279 TAGGCCACGGAGGAAACTTCTGG + Intronic
1019404906 7:877912-877934 GAGGCCAGGGGGGAAGGTGGGGG - Intronic
1021626545 7:22599082-22599104 CAGGCCAGACAGGAAGATGAGGG + Intronic
1022141128 7:27493833-27493855 GACCCCAGGGAGGAAGAGGCAGG - Intergenic
1022498114 7:30865847-30865869 CAGTCCAGGGAAGACGATGCAGG - Intronic
1022941860 7:35249385-35249407 TTGGCCAGGCAGGAAGCTGCAGG - Intronic
1023376498 7:39561337-39561359 TAGGGAAGGGAGGAAGAAGCAGG - Intergenic
1023744007 7:43304992-43305014 GAGGCCAGAGAGGAAGCTGCGGG + Intronic
1026915914 7:74120456-74120478 CAGGCCCAGGAGGCAGATGCCGG - Intronic
1027803300 7:82783067-82783089 AAGGCAAGGGATGAAGTTGCTGG - Intronic
1027987179 7:85308252-85308274 TAGGACAGGGCAGAAGAGGCAGG + Intergenic
1028925758 7:96355414-96355436 GAGGCCAAGGGGGCAGATGCAGG + Intergenic
1030455142 7:109762804-109762826 GAGGACAGGGAGGAATAGGCAGG - Intergenic
1031162220 7:118182383-118182405 TATACCAGGGAGGCAGAGGCAGG - Intergenic
1031719168 7:125148478-125148500 TTGGGCAGGGAGGAGGATGATGG + Intergenic
1032400468 7:131620744-131620766 GAGGCCTGGGAGGAAGATCTGGG - Intergenic
1032489645 7:132314549-132314571 TAGGGAAGGGAGGAAGAGGAAGG + Intronic
1032508841 7:132455889-132455911 GAGGCCTGGGAGGAAGATGTGGG + Intronic
1033761954 7:144445390-144445412 TAGGGCAGGGAGGCCGAGGCGGG + Intergenic
1033978908 7:147139592-147139614 AAGGTGAGGGAGGTAGATGCTGG - Intronic
1035389267 7:158494914-158494936 GGGGCCAGGGAGGAAAAGGCTGG - Intronic
1036150060 8:6288739-6288761 GAGGACAAGAAGGAAGATGCAGG - Intergenic
1037484394 8:19333832-19333854 AAGGCCAGGAAGGAAAGTGCAGG + Intronic
1037505776 8:19527881-19527903 TACGCCAGAGAGGTAGATTCAGG + Intronic
1037613819 8:20499037-20499059 TAGGCTGAGGAGGAAGATGAGGG - Intergenic
1037817872 8:22121228-22121250 TCTGTCAGGGAGGAAGATGGTGG + Exonic
1037911522 8:22746543-22746565 GAGGACAGGGAGGAAGAGGCTGG - Intronic
1039981531 8:42412922-42412944 TAGGCCCGGGAGGAAGTTCCAGG - Intergenic
1041072944 8:54143004-54143026 TTGGCCAGGCAGGCAGATGCAGG - Intronic
1041440166 8:57886254-57886276 TAGGCCAGAGGGGTACATGCTGG - Intergenic
1041698640 8:60763732-60763754 TAGGCCAGGGAGTCTTATGCTGG - Intronic
1042750655 8:72154265-72154287 GGGGCCAGGGAGGAGGAGGCAGG - Intergenic
1042771147 8:72383788-72383810 TTGGGCAGGGAGTAAGATGGTGG + Intergenic
1043018808 8:74974824-74974846 TGTGCCAGGGAGGAAGAAGTAGG - Intergenic
1043163924 8:76879774-76879796 CAGGCCAAGAAGGGAGATGCTGG - Intergenic
1043537954 8:81226746-81226768 CAGGCAAGGAAGGAAGATGGTGG - Intergenic
1044915545 8:97109491-97109513 TGGGTCAGGAAGGAAGATGGAGG - Intronic
1045870521 8:106921978-106922000 TAGGTCAGGGAGGAAGCTGGGGG - Intergenic
1047470324 8:125165088-125165110 TAGGCCAGGGAGGAACAAGGAGG - Intronic
1047771852 8:128036347-128036369 AAGGCACGGGAGGAAGGTGCTGG - Intergenic
1047922969 8:129654189-129654211 TAGGCCAGGAAGGGAGAAGGTGG - Intergenic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049279224 8:141735807-141735829 TAGGCCTTGGAGGCAGAGGCTGG + Intergenic
1055719512 9:79156096-79156118 GGGGCCAGGGAGGAAAATGCAGG - Intergenic
1056790845 9:89624408-89624430 TATGCCAGGGAGGAAGCGGCTGG + Intergenic
1057065204 9:92043273-92043295 GTGGCCAGTGAGGAAGAGGCAGG - Intronic
1057082365 9:92182279-92182301 TAGGGCAGAGAGGAAAGTGCTGG - Intergenic
1057112311 9:92484950-92484972 TAGGCCCTGGAATAAGATGCTGG + Intronic
1057845366 9:98518578-98518600 AGGGCCTGGGAGGAAGAAGCAGG - Intronic
1057954260 9:99395378-99395400 GAGGACTGGGAGGAAGAGGCTGG + Intergenic
1057970957 9:99557000-99557022 TGAGCCAGAGAAGAAGATGCAGG - Intergenic
1058428694 9:104899182-104899204 TAGGCCACTGAGGCAGATGGTGG + Intronic
1060213888 9:121726796-121726818 TGGGACAGGGAGGAAGAAGCTGG + Intronic
1060423542 9:123486483-123486505 GAGGCCAGGAAGGAAGCAGCTGG + Intronic
1060522508 9:124301647-124301669 AAGGCCAGGAAGGAAGACACCGG - Intronic
1060656650 9:125376670-125376692 CAGGCCCGGGAGGAAGCAGCAGG + Intergenic
1060756424 9:126217709-126217731 TGAGCCAGGGAGGAAGCAGCTGG - Intergenic
1061093018 9:128437236-128437258 CCGGCCAGGGAGGAGGGTGCTGG - Exonic
1061138464 9:128750415-128750437 TGGGGCAGGGAGGAGGATGGAGG + Intronic
1061444324 9:130629255-130629277 CTGGCCAGGGTGGAAAATGCAGG + Intronic
1062129535 9:134885150-134885172 GAGGCCTGGGAGGAAGAAGCAGG - Intronic
1062261344 9:135664696-135664718 GAAGCCAGCCAGGAAGATGCCGG - Intronic
1062325632 9:136011173-136011195 AAGGGCAGGGAGGAAGGGGCAGG + Exonic
1062334852 9:136060606-136060628 TTGGCCAGGGAGGATCAAGCAGG - Intronic
1062573028 9:137194254-137194276 GAGGCCAGGCAGGGAGAGGCTGG + Intronic
1185446384 X:259970-259992 CACCCCAGGGAGGAATATGCAGG - Intergenic
1186712372 X:12212771-12212793 TAGGCCTGGGTGAAAGGTGCAGG - Intronic
1190616947 X:52243573-52243595 TAGGCCAGGGAGGCTGAGGTGGG + Intergenic
1194619973 X:96158974-96158996 TAGGCCAAGGAAGAAGAAGAAGG - Intergenic
1197146692 X:123179834-123179856 TAGTCCAGAGAGGAAGGTGTTGG + Intergenic
1198099500 X:133412568-133412590 CAGCCCAGGGAGGGAGATGAAGG + Intronic
1199451329 X:147981693-147981715 CAGGCCAGGCAGGGAAATGCTGG + Intronic
1199672056 X:150155641-150155663 GAGGGCAGGCAGGAAGAGGCAGG + Intergenic
1200080066 X:153571878-153571900 TCTGCCGTGGAGGAAGATGCTGG + Intronic
1200311026 X:155077550-155077572 AAGACTAGGGAGGAAGATGGAGG - Intronic
1202189025 Y:22221818-22221840 TAAGCCAGGGAAGAAAATGTGGG - Intergenic