ID: 1121230449

View in Genome Browser
Species Human (GRCh38)
Location 14:92353866-92353888
Sequence CGGCACAGGCAGCTGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121230449_1121230456 3 Left 1121230449 14:92353866-92353888 CCCTGTCCCAGCTGCCTGTGCCG 0: 1
1: 1
2: 2
3: 19
4: 296
Right 1121230456 14:92353892-92353914 TCCCAAGTGAGCTTCCCACACGG 0: 1
1: 0
2: 1
3: 25
4: 198
1121230449_1121230459 7 Left 1121230449 14:92353866-92353888 CCCTGTCCCAGCTGCCTGTGCCG 0: 1
1: 1
2: 2
3: 19
4: 296
Right 1121230459 14:92353896-92353918 AAGTGAGCTTCCCACACGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 132
1121230449_1121230462 20 Left 1121230449 14:92353866-92353888 CCCTGTCCCAGCTGCCTGTGCCG 0: 1
1: 1
2: 2
3: 19
4: 296
Right 1121230462 14:92353909-92353931 ACACGGCCGGCCCAGAGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121230449 Original CRISPR CGGCACAGGCAGCTGGGACA GGG (reversed) Intronic
900423553 1:2566192-2566214 GGGAACAGGGAGCGGGGACAGGG - Intergenic
900518535 1:3094815-3094837 CGGCAACCGCAGCAGGGACAAGG - Intronic
900653029 1:3740277-3740299 CTGCACAGACAGCTGCGACCAGG - Intergenic
900868044 1:5282783-5282805 AGGGAGAGGCAGCAGGGACAGGG + Intergenic
901168815 1:7239562-7239584 CTGCAGAGGGCGCTGGGACATGG - Intronic
901810419 1:11764212-11764234 GGCCCCAGGCAGCTGGGACCAGG + Intronic
901926748 1:12570975-12570997 CTGCCCTGGCTGCTGGGACATGG - Intronic
902398541 1:16145189-16145211 CAGCACAGGAAGCGGAGACATGG + Intronic
902512792 1:16975334-16975356 CGGCGGAGGCTGCGGGGACAGGG + Exonic
902696582 1:18144415-18144437 AGGCACAGGCAGCTTGGGCAGGG - Intronic
902706202 1:18206721-18206743 CCGCACAGGCTTCTGGGCCATGG + Intronic
903187779 1:21639027-21639049 TGGCCCAGGCAGCTGGGCCCAGG + Intronic
904054734 1:27662676-27662698 TGGAACAGACAGCTGAGACAAGG - Intergenic
904430353 1:30460228-30460250 CTGCACACCCAGCTGGGAGAAGG + Intergenic
904454371 1:30638531-30638553 CAGCACATGCTGCAGGGACAAGG - Intergenic
904458453 1:30661534-30661556 TGGCACGGGCAGGTGGGACGTGG - Intergenic
908213518 1:61926206-61926228 TGGCAAAGGCAGCTGGAGCAAGG - Intronic
908806460 1:67937799-67937821 CGGCTCAAGCAGCCGAGACAGGG - Intergenic
911090959 1:94016475-94016497 CAGCAGAGGCAGCTGGAGCAGGG + Intronic
911618302 1:100038428-100038450 AGGCACCGGCAGCTCGGACAGGG - Intronic
919755878 1:201066111-201066133 CTGCCCAGGGAGATGGGACAGGG + Intronic
919789976 1:201284527-201284549 TGGCACAGGGAGCAGGGACGAGG + Intronic
922042994 1:221915392-221915414 CGTCACAGCCTGCTGGGACCAGG - Intergenic
922607530 1:226899695-226899717 AGGCACAGGCAGCTTGGAGAGGG + Intronic
923042292 1:230327807-230327829 AGGCAGAGGCAGCTGAGATAAGG - Intronic
923255871 1:232220942-232220964 AGGCACACACAGCTGGGCCATGG + Intergenic
923315106 1:232772882-232772904 CTGCACATGCAGCTTGGACCCGG + Intergenic
923634055 1:235677130-235677152 TGGCAGAGACAGCTGTGACAGGG + Exonic
923831811 1:237566556-237566578 CGGCTCTGGCTGCTGGGAAATGG - Exonic
1063461971 10:6220770-6220792 CGGCACAGGTAGATGGTACGCGG - Exonic
1065045806 10:21746886-21746908 CGGGAAAGGCAGATGGGAGAAGG + Intergenic
1067338267 10:45381158-45381180 CTGCCCAGGCCTCTGGGACAAGG - Intronic
1067829149 10:49600103-49600125 CGGCACCAGGTGCTGGGACACGG + Intergenic
1067930780 10:50559308-50559330 CGCCTCTGGCAGCTGGGTCAGGG - Intronic
1069749371 10:70735720-70735742 AGGCACAGGCAGCAGGGACATGG - Intronic
1069962733 10:72087949-72087971 CGGCCCGGGCCGCAGGGACAGGG + Intronic
1070637264 10:78139501-78139523 TGCCACAGCCAGCTGAGACAAGG - Intergenic
1072668063 10:97408880-97408902 CGGCTCACGCAGCTGGGATGTGG - Intronic
1073289711 10:102407496-102407518 GGGCACAGGCAGTTAGCACAGGG + Intronic
1073461623 10:103668854-103668876 GGACACAGCCGGCTGGGACAGGG + Intronic
1074082952 10:110182282-110182304 CAGCAGGGGCATCTGGGACATGG - Intergenic
1075332414 10:121583358-121583380 CAGCAGAGGCATCTGGGACAAGG + Intronic
1076237679 10:128878132-128878154 TGGCACCGTCAGCAGGGACACGG + Intergenic
1076834034 10:133012047-133012069 AGGCACAGGCAGCTGCTGCAAGG + Intergenic
1076940641 10:133604875-133604897 CGGCACAGCCTGCTGTGGCAGGG - Intergenic
1077300415 11:1844114-1844136 TGGCCCAGGCAGCTGGAGCAGGG + Intergenic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1077484811 11:2833791-2833813 TGGGACAGGCAGCTGGGGGAAGG + Intronic
1078908346 11:15708201-15708223 TGGCACAGCCAGCTGGCACGTGG + Intergenic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1080742079 11:35075712-35075734 AGGCAAAGGCAGCTAGTACACGG - Intergenic
1084166321 11:67376319-67376341 GGGCACTGGCAGCTTGGAGATGG - Intronic
1084433718 11:69126026-69126048 AGGCACAGGCTGGAGGGACAGGG - Intergenic
1084936964 11:72592066-72592088 TGGCACAGGGAGCTTGGAGAGGG - Intronic
1084978661 11:72816875-72816897 CAGCACAGGCAGCAGGGGCAGGG - Intronic
1085418916 11:76338611-76338633 GGGCACTGGGAGCTGAGACAAGG + Intergenic
1085745439 11:79110763-79110785 GGACACTGGCACCTGGGACATGG + Intronic
1088030722 11:105246138-105246160 CTCCACAGGCAGCTGGTAGAAGG - Intergenic
1089033697 11:115361846-115361868 CTGCCCAAGTAGCTGGGACATGG + Intronic
1095858897 12:46892530-46892552 CGGCTCAGGCAGCCAAGACAGGG + Intergenic
1095953606 12:47794806-47794828 GAGCACAGGGAGCTGGGCCATGG - Exonic
1096472444 12:51888132-51888154 CGGATCAAGCAGCTGGGACTGGG - Exonic
1096670498 12:53195723-53195745 TGGGACAGGGAGCAGGGACAAGG + Intronic
1099143733 12:79012755-79012777 AGGCACAGGGAGCAGCGACAGGG - Intronic
1101218952 12:102616682-102616704 AGGCAGAGGCAGCTGGCACCTGG - Intergenic
1102565862 12:113797144-113797166 GGGCAAAGGCAGCAGGGATACGG + Intergenic
1103342024 12:120225855-120225877 CAGGACAGGCAGCTGGGACAAGG - Intronic
1103992484 12:124808436-124808458 GGGCACAGGAAGTTGGGGCAGGG - Intronic
1105250791 13:18697479-18697501 CGGCAGATGCAGCTGGAAGATGG + Intergenic
1106314079 13:28578273-28578295 AGGCACAGGAAGCAGGGACCTGG + Intergenic
1108270792 13:48757552-48757574 AGGCATGGGCAGCAGGGACAGGG - Intergenic
1108533256 13:51346824-51346846 CAGCACAAGGAGCTGAGACAGGG + Intronic
1109658827 13:65431434-65431456 GGGCAGAGGGAGGTGGGACAGGG + Intergenic
1110219624 13:73059368-73059390 CGGCGCCGGCGGCTGGGGCACGG - Exonic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1110588518 13:77224466-77224488 CAGCATGGGCAGCTAGGACATGG - Exonic
1113067627 13:106388012-106388034 GGGTTCATGCAGCTGGGACAAGG + Intergenic
1114775531 14:25476422-25476444 AGGCACATTCAGCTGGAACAGGG + Intergenic
1116953906 14:50903918-50903940 AGAGACAGGCAACTGGGACATGG + Intronic
1117668103 14:58078214-58078236 AGCCACATGCAGCTGTGACAGGG - Intronic
1121230449 14:92353866-92353888 CGGCACAGGCAGCTGGGACAGGG - Intronic
1121328851 14:93037044-93037066 AGGCCCAGGCAGCTGGACCAGGG + Intronic
1122106985 14:99465440-99465462 TGGCACAGTCACCTGGAACATGG - Intronic
1122137545 14:99643658-99643680 CTGCACAGACAGCTGGGAATAGG - Intergenic
1122782440 14:104149401-104149423 CGGCCCAGGCATCTGGGCCAGGG - Intronic
1122856149 14:104561129-104561151 TGGGGCAGGCAGCTGGGGCAGGG - Intronic
1122859647 14:104576812-104576834 CGGCAGAGGGAGCTGGGATCAGG + Intronic
1123012875 14:105357729-105357751 GGGCTCAGGCAGCTGTGCCATGG + Intronic
1124244345 15:28056904-28056926 GGGGGCAGGCAGCTGGGGCAGGG - Intronic
1124604914 15:31162711-31162733 AGGCACAGGCGGCTGGGAGAGGG + Intergenic
1124854908 15:33378317-33378339 TGGGACAGGCAGAGGGGACATGG - Intronic
1125674619 15:41495438-41495460 CCGCACAATCGGCTGGGACAAGG + Intronic
1125678883 15:41518171-41518193 GGACACAGGCAACTGTGACAGGG + Exonic
1128550774 15:68596685-68596707 GGGCAGAGGCAGCAGGCACAGGG + Intronic
1129182448 15:73885709-73885731 GGGCAGAGCCAACTGGGACAAGG - Intronic
1129519336 15:76176183-76176205 GGGGACTGGCAGCTGGGCCAGGG + Intronic
1129669623 15:77600020-77600042 CGGCCCAATCAGCTGGGACTGGG - Intergenic
1129709395 15:77812820-77812842 TGGCACAGCCATCAGGGACAGGG + Intronic
1131186714 15:90280355-90280377 TGGCTCAAGCAGCTGAGACAGGG + Intronic
1132058362 15:98669758-98669780 CGGCACGGGAAGCTAGAACACGG - Intronic
1134470695 16:14522677-14522699 TGGCACAGGAAGCTGGAACAAGG + Intronic
1137056811 16:35749993-35750015 GGGCACAGGCGGGTGGGAAAGGG - Intergenic
1139448655 16:67013998-67014020 CCGCCCAGGCGGCTGGGAAAGGG + Intergenic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1140113271 16:72021337-72021359 TGGGACAGGCTGGTGGGACAGGG - Intronic
1141382169 16:83586274-83586296 CGGCACAGGGCGCTGAGGCAGGG + Intronic
1141498836 16:84429683-84429705 AGGCAGAGGCAGGTGGGAGAGGG + Intronic
1142120445 16:88383985-88384007 CGGCCCAGGGTGCAGGGACAAGG - Intergenic
1142196887 16:88743120-88743142 GGCCACAGGCAGCTGGGAGCAGG - Intronic
1142329713 16:89443809-89443831 CTGCACAGGAAGGTGGAACAAGG + Intronic
1142954953 17:3515319-3515341 AGGCTCAGGCAGTTGGGTCAGGG + Intronic
1142967330 17:3589816-3589838 TGGCTCTGGCAGCTGGGACCGGG - Exonic
1145105312 17:20110555-20110577 CGGCACAGGTAGGAGGGACCGGG + Exonic
1146310077 17:31761587-31761609 CCTCTCAGGTAGCTGGGACATGG - Intergenic
1146566916 17:33921504-33921526 AGGCAAGGGGAGCTGGGACATGG + Intronic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1147601861 17:41751662-41751684 CTGCAAAGACAGCTGGGAAATGG - Intergenic
1147674338 17:42194332-42194354 AGGGACAAGGAGCTGGGACAGGG - Intronic
1147952130 17:44113125-44113147 AGGCAGAGAGAGCTGGGACAGGG - Intronic
1148460989 17:47838849-47838871 GCGCACAGGCTGCTGGGTCAGGG + Exonic
1148957448 17:51365484-51365506 CGGACCAAGCAGCTGAGACAGGG - Intergenic
1149566108 17:57641845-57641867 AGCCACAGGCTGCTGGCACAGGG + Intronic
1149614839 17:57988505-57988527 TGGCTCAGGCAGCTGGAGCAGGG + Intergenic
1151475105 17:74340787-74340809 AGCCACAGGCAGCTGGGTGAGGG - Intronic
1152252653 17:79219924-79219946 TGGGACAGGGGGCTGGGACAGGG - Intronic
1152581011 17:81165667-81165689 GGGCACAGGTAACTGGGGCACGG - Intronic
1152813023 17:82391129-82391151 CTCCCCAGGCAGCTGGGTCAGGG + Intronic
1152855171 17:82661541-82661563 CGGCACACGCAGCAGGTACTGGG + Intronic
1153812637 18:8765434-8765456 CGCCAGAGGCAGCTGTGATATGG + Intronic
1154326030 18:13390986-13391008 CTGCCCAGGCAGCTGGGTGAAGG + Intronic
1154438059 18:14361447-14361469 CGGCAGATGCAGCTGGAAGATGG - Intergenic
1156023895 18:32630130-32630152 CAGCTCAAGCAGCTGAGACAGGG + Intergenic
1156310728 18:35919351-35919373 AGGCAGAGGGAGCTGGTACAAGG + Intergenic
1157478903 18:48040289-48040311 CTGCTCAGGCAGCTGGGCAAAGG + Exonic
1158112069 18:53951491-53951513 TGGCACATGCATATGGGACATGG - Intergenic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1160239771 18:77114835-77114857 AGGGGCCGGCAGCTGGGACAGGG + Intronic
1161043200 19:2120957-2120979 CAGCGCAGACATCTGGGACACGG + Exonic
1161296504 19:3523094-3523116 GGGCAGAGGCAGCTGGGGGAGGG - Intronic
1161314092 19:3609849-3609871 CAGGACAGGCTGCTGGGGCAGGG - Intergenic
1161594675 19:5144979-5145001 AGGCAAAGGCACCTGGGCCAGGG - Intronic
1161726593 19:5932953-5932975 TGCCAAAGGCAGATGGGACAAGG + Intronic
1162050300 19:8028747-8028769 CTTCAGAGGCAGCAGGGACAAGG + Intronic
1162444307 19:10712878-10712900 TGGCACTGGGAGCTGGGGCAGGG + Intronic
1163554004 19:17982462-17982484 GGGCGCAGGCAGCAGGCACAGGG + Intronic
1163828333 19:19535925-19535947 CTGCCCAGGCAACTGGGCCAGGG - Exonic
1165804638 19:38572945-38572967 AGGCACAGGCAGGGGGGTCAGGG - Intronic
1165806557 19:38584353-38584375 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806577 19:38584420-38584442 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806603 19:38584490-38584512 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806629 19:38584558-38584580 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806655 19:38584626-38584648 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165806668 19:38584661-38584683 GGGCACAGGCAGAGGGGTCAGGG - Intronic
1165863231 19:38920036-38920058 GGGTGCAGGCAGCTGGGAGAGGG + Intronic
1165999619 19:39870645-39870667 AGGCACAGGCAGAGGGGTCAGGG + Intronic
1165999749 19:39871018-39871040 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1165999761 19:39871050-39871072 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166069126 19:40377296-40377318 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166069151 19:40377365-40377387 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166069178 19:40377434-40377456 GGGCACAGGCAGAGGGGTCAGGG + Intronic
1166117395 19:40664088-40664110 AGGCACAGGCAGATGGGTCAGGG + Intergenic
1166120134 19:40681315-40681337 AGGCACAGGCAGAGGGGTCAGGG + Intronic
1166496281 19:43305382-43305404 CAGGACAGTCAGCTGGGCCAAGG - Intergenic
1167211616 19:48137205-48137227 CGGCCATGGGAGCTGGGACATGG - Intronic
1167500770 19:49846126-49846148 CGTCACAGGCTGCGGAGACACGG - Intergenic
1167610699 19:50506548-50506570 GGGCAGGGCCAGCTGGGACAGGG + Exonic
1168332416 19:55578294-55578316 CGGCGCGGGCAGCGGGGGCACGG + Exonic
925411412 2:3641945-3641967 AGGCAGAGGCTGCTGGGCCACGG + Intronic
925456460 2:4020662-4020684 CGACTCAAGCAGCTGAGACAGGG + Intergenic
925624121 2:5825331-5825353 GGGCATAGGAAGCTGGGAGAAGG + Intergenic
925747267 2:7054144-7054166 CAGCTCAAGCAGCTGAGACAAGG + Intronic
927809512 2:26173537-26173559 AGGCACAGACACCGGGGACAGGG + Intronic
927888438 2:26732699-26732721 AGACAGAGGCAGGTGGGACAGGG - Exonic
929497108 2:42454869-42454891 AGTTACAGGCAGCTGGGAAAAGG + Intronic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
932024168 2:68116745-68116767 CAGGGCAGGCAGCTGGGCCAGGG - Intergenic
932699626 2:73984430-73984452 AGCCAGCGGCAGCTGGGACAGGG + Intergenic
933767220 2:85718527-85718549 CAGGACAGGCAGCTGGGAGAGGG - Intergenic
933847331 2:86336903-86336925 CGGCAAAGGCAGCTGGGACATGG - Intronic
935695414 2:105766909-105766931 CTGCACAGGCAGCAGGAAGACGG - Intronic
937252615 2:120534113-120534135 GGGAGCAGGCAGCTGGGACTGGG - Intergenic
942261721 2:174171941-174171963 CGGCACAGGGAGCGGGGCCCCGG + Intronic
942448347 2:176092896-176092918 CCGCGCCGGGAGCTGGGACATGG + Exonic
942462305 2:176176854-176176876 GGGCACAGGGAGCTGAGACTGGG + Intergenic
945664682 2:212725859-212725881 TGGCTGAGGCAGCTGGGACTTGG - Intergenic
947533692 2:230928052-230928074 AGGCACAGGCAGGAGGGGCACGG + Intronic
947646868 2:231748754-231748776 CGGCTGGAGCAGCTGGGACATGG - Intronic
948600385 2:239104576-239104598 AGGCACAGGCAGCTGTGGCCAGG + Intronic
948887980 2:240893336-240893358 CCGCCCAGGCAGCAGGGCCAGGG - Intronic
949019623 2:241734128-241734150 CTGAACAGGCAGAAGGGACAGGG + Intergenic
1168890689 20:1293847-1293869 TGGCAGGGACAGCTGGGACAAGG + Intronic
1169864046 20:10181011-10181033 CAGCAATGTCAGCTGGGACATGG + Intergenic
1170171352 20:13416893-13416915 TGCCACAGGCATGTGGGACATGG + Intronic
1170427068 20:16245831-16245853 AAACACAGGCAGCTGGGCCAAGG - Intergenic
1171094336 20:22316912-22316934 CAGCACAGGCCTCTGGTACATGG - Intergenic
1172939067 20:38642325-38642347 CGGTACAGGGAGCTGGGCCAAGG - Intronic
1173278529 20:41606054-41606076 AGGCATTAGCAGCTGGGACAAGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175928596 20:62482679-62482701 TGGCCCAGGCAGCTGGGGGAGGG + Intergenic
1175937382 20:62519988-62520010 ACGCACAGGCAGCTGGGTCTGGG + Intergenic
1176044819 20:63087118-63087140 CTCCACATGCGGCTGGGACAGGG - Intergenic
1176457618 21:6928022-6928044 CGGCAGATGCAGCTGGAAGATGG + Intergenic
1176835790 21:13793106-13793128 CGGCAGATGCAGCTGGAAGATGG + Intergenic
1178610052 21:34072861-34072883 CGGCACAGGCAGCAGGCCCAAGG + Intergenic
1179996497 21:44976768-44976790 CGGCAGATGCAGCTGGAAGATGG + Exonic
1181042242 22:20197665-20197687 TGGCACTGGCACCCGGGACATGG - Intergenic
1182041712 22:27243271-27243293 CAGCAAAGGCTTCTGGGACAGGG + Intergenic
1182766382 22:32760898-32760920 CTGCCCAGGCAGCTGGTCCAGGG + Intronic
1183630399 22:39029167-39029189 TGGCAGGGGCAGCAGGGACAGGG - Intronic
1183932083 22:41240967-41240989 CAGGCCTGGCAGCTGGGACAGGG + Intergenic
1184220884 22:43099133-43099155 CTTCACAGGCAGCTGAGACAAGG + Intergenic
1184247422 22:43242627-43242649 CGGCTCAGGCGCCTGGGACTGGG + Intronic
949355843 3:3179698-3179720 CCGCAAAGGAGGCTGGGACAGGG + Exonic
950330655 3:12153562-12153584 CGGCACCTGCAGCTGGTACCGGG - Exonic
950891408 3:16408078-16408100 GGCCAGAGACAGCTGGGACAGGG - Intronic
951196470 3:19828616-19828638 CGGCACACCCAGCAGGGGCATGG - Intergenic
952631012 3:35467184-35467206 CAGCAGAGCTAGCTGGGACAGGG + Intergenic
954322590 3:49842214-49842236 GGCCACAGGCAGCAGAGACAGGG + Intronic
954431200 3:50471708-50471730 GGGCTCAGGTAGGTGGGACAGGG - Intronic
954708887 3:52495327-52495349 CAGCACAGGCAGGCGGGACGGGG - Exonic
955920150 3:63946864-63946886 GGGCTCAGGCAGCTGGGAGGAGG + Intronic
960936517 3:122907484-122907506 CTGCTGAGCCAGCTGGGACAAGG + Intergenic
961042229 3:123685738-123685760 AGGCAGAGGCAGATGGGGCAGGG - Intronic
961111949 3:124291922-124291944 CGGGGGAGGCAGCTGGGATATGG - Intronic
961371374 3:126433927-126433949 CACCAGAGGCAGCTGGGAGAGGG + Intronic
961656959 3:128448140-128448162 AAGCACAGGCTGCTGGGCCATGG - Intergenic
961662595 3:128477560-128477582 GGGCTGGGGCAGCTGGGACAAGG + Intergenic
961906071 3:130264246-130264268 CGAGACAAGTAGCTGGGACAGGG + Intergenic
962875238 3:139530975-139530997 CAGGGCAGGCAGCAGGGACAAGG + Intronic
962969587 3:140386521-140386543 CAGCTCAAGCAGCTGAGACAGGG - Intronic
963106573 3:141652703-141652725 GACCACAGGCAGGTGGGACATGG - Intergenic
966808725 3:183825516-183825538 CAGCACAGGCGGCTGATACAGGG + Exonic
968551080 4:1223614-1223636 GGAGACAGGCAGCTGGGCCAAGG + Intronic
969411465 4:7031228-7031250 CTGAACAGGCAGGTGGGAGAGGG - Exonic
974402361 4:61424097-61424119 GGGCATAGGCAGGTGGGACATGG + Intronic
977347368 4:95834113-95834135 GGAGACAGGCAGCTGGGGCAGGG + Intergenic
982278199 4:153658471-153658493 CGGCACCGACAGCTGGGGCCTGG + Intergenic
985082493 4:186280415-186280437 CCTCACAGGCAGACGGGACAAGG - Intronic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
985660029 5:1152417-1152439 GGGCACAGGCAGGTCTGACAGGG - Intergenic
985702973 5:1384705-1384727 AGGGACAGGCAGATGGGAGAGGG - Intergenic
985947734 5:3200038-3200060 GTGCACAGGCAGGTGGAACAAGG - Intergenic
986132877 5:4947023-4947045 TGGCAGTGGCAGCTGGGGCAGGG - Intergenic
987115989 5:14727033-14727055 CATCACAGGCAGTGGGGACACGG + Intronic
991625143 5:68593534-68593556 GGGCACTGGCAGCAGGCACAGGG + Intergenic
996389231 5:122941937-122941959 AGGCACAGGCTCCTGTGACAGGG + Intronic
998583411 5:143403472-143403494 CGGCCGAAGCAGCTGGGACCGGG - Exonic
1001205956 5:169763398-169763420 TGGCACAGGCAGCAGGGAGTGGG + Intronic
1001548836 5:172587422-172587444 GGGAAGAGGCAGCTGGGATAGGG + Intergenic
1002043743 5:176530983-176531005 GGGCACAGGCAGCTGCTGCATGG + Exonic
1002316838 5:178349250-178349272 GGGCACAGGCAGCTGGGTGAGGG + Intronic
1002469942 5:179429124-179429146 CTGCACTGGCAGCTGGGCCAGGG + Intergenic
1002578678 5:180193944-180193966 CGGCCCTGGGAGCTGGGAGACGG + Intronic
1002792583 6:446926-446948 TGGCACAGGCAGCTGGGGGGCGG + Intergenic
1007393912 6:41566447-41566469 AGGCCCAGGCAGCTGGGTAAAGG + Intronic
1007400014 6:41598112-41598134 AAGAACAGGCAGGTGGGACAAGG - Intronic
1007742911 6:44023661-44023683 CCTCACAGCCAGCTGTGACATGG - Intergenic
1007832268 6:44647565-44647587 GGGCACAGCCAGCTTGGCCAGGG + Intergenic
1007838663 6:44697637-44697659 AGGCATGGGCAGCAGGGACAGGG + Intergenic
1008879315 6:56364548-56364570 TGGCACAGGCAGCTGGTGAAAGG + Intronic
1013184324 6:107744887-107744909 GGGCAGAGACACCTGGGACAGGG + Intronic
1019156041 6:170039602-170039624 GGACACAGCCAGCGGGGACACGG - Intergenic
1019174514 6:170153479-170153501 CGGCTCATGCAGGTGGGACTGGG - Intergenic
1019292150 7:256069-256091 CGGCAGAGGGAGCTGGGCCTGGG + Intronic
1019717607 7:2547208-2547230 CGGGGCAGGCCGCTGGGACTTGG + Intronic
1019989941 7:4683527-4683549 AGGCCCAGGCAGCAGGGACTGGG - Intronic
1023858474 7:44201245-44201267 CGGCACAGGCTGGTGGGCCGTGG + Intronic
1024555333 7:50598872-50598894 CTGCACAGGCAGATGACACAGGG + Intronic
1025142756 7:56479304-56479326 GGGTGAAGGCAGCTGGGACAGGG + Intergenic
1025188108 7:56876588-56876610 GGGCAGGGGCAGCTGGGGCACGG + Intergenic
1025610661 7:63073284-63073306 GGGTGAAGGCAGCTGGGACAGGG - Intergenic
1025683815 7:63700334-63700356 GGGCAGGGGCAGCTGGGGCACGG - Intergenic
1026786483 7:73304796-73304818 CGGCACAGGCATCGATGACATGG + Exonic
1027107587 7:75415163-75415185 CGGCACAGGCATCGATGACATGG - Intergenic
1027173235 7:75887666-75887688 AGGCACTGGCAGCTGTGACCTGG + Intronic
1027232389 7:76280457-76280479 CGGCACCGGGAGCGGGGCCAGGG - Intronic
1031008355 7:116499483-116499505 CGACGCCGGCAGCTGGGACGAGG - Exonic
1032197286 7:129796646-129796668 TGCCACAGGCAGGTGGGACCTGG - Intergenic
1033930213 7:146510128-146510150 GACCACAGGCAGTTGGGACATGG + Intronic
1034227518 7:149495452-149495474 AGTGACCGGCAGCTGGGACAAGG + Intronic
1036561613 8:9904025-9904047 CGGCAGCGGCAGCCGGGGCAGGG + Intergenic
1036567441 8:9949545-9949567 CTGCAAAGGAAGCTGGGAGAGGG - Intergenic
1036815159 8:11896945-11896967 AGGCACTGGCTGCTGGGAGAAGG - Intergenic
1037205987 8:16320727-16320749 GAGCAGAAGCAGCTGGGACATGG - Intronic
1037982140 8:23261808-23261830 CACCTCAGGCAGCAGGGACAGGG - Exonic
1038498627 8:28024963-28024985 CGGGACAGGGTGGTGGGACAGGG - Intronic
1044250809 8:90001935-90001957 GGGCTCAGGGAGCTAGGACAGGG + Intronic
1046024872 8:108710641-108710663 CAGCTCAAGCAGCTGAGACAAGG - Intronic
1047349415 8:124059395-124059417 TGGTAGAAGCAGCTGGGACAGGG + Intronic
1047482838 8:125301194-125301216 CAGCACAGGCTGGTGGGAAAGGG + Intronic
1049229846 8:141476278-141476300 CTGCAGAGGCAGGTGGGCCAGGG - Intergenic
1049376985 8:142294004-142294026 GGGCAGGGGCAGCTGGGACAGGG + Intronic
1049580009 8:143406913-143406935 GGGCACAGGCAGCTCGTGCATGG - Intergenic
1049724589 8:144139785-144139807 CTGCACAGGCAGCCGAGTCACGG - Exonic
1056528335 9:87464894-87464916 GGGCACCGGCAGCAAGGACAAGG - Intergenic
1057623243 9:96655162-96655184 CAGCACCGGCAGCTCGGCCACGG + Exonic
1057999285 9:99848819-99848841 GGGCAAAGGGAGCTGGGGCAAGG - Intronic
1059805707 9:117798240-117798262 AGGCAGAGGCAGCTGGGAAAAGG - Intergenic
1060398986 9:123336709-123336731 TGGCACAGGCAGCAAGGCCAGGG - Intergenic
1060783384 9:126430284-126430306 CGACCCAGGCTGGTGGGACACGG - Intronic
1060994280 9:127867473-127867495 CTGCACAGGCAGCAAGGTCATGG - Exonic
1061181571 9:129027878-129027900 CGCCCCAGGCAGCAGGGCCAAGG + Intronic
1061416318 9:130448970-130448992 TGCCACAGGCATCTGGGAGATGG + Intronic
1061902515 9:133680350-133680372 CCTCACAGGCAGGTGGGAGATGG - Intronic
1061935161 9:133853434-133853456 CAGCAGAGGCCGCTGGGGCAGGG - Intronic
1062048402 9:134434944-134434966 CTGGGCAGGCAGCGGGGACACGG - Intronic
1062075493 9:134586404-134586426 CCTCCTAGGCAGCTGGGACATGG + Intergenic
1062176136 9:135164118-135164140 GGGCACTGGCAGCAGGGAGAAGG + Intergenic
1062466349 9:136683298-136683320 TGGCTCAGGCAGCTGGGAGGCGG + Intronic
1062551449 9:137089312-137089334 GGGCAGAGGCAGATGGCACATGG + Intronic
1186872137 X:13783687-13783709 AGGCCCAGGTTGCTGGGACATGG - Intronic
1186935733 X:14448907-14448929 CGGCTCAAGCAGCTGAGACGAGG + Intergenic
1190147707 X:47911438-47911460 GGGCAAAAGCATCTGGGACATGG - Intronic
1190305575 X:49079812-49079834 CGGCACCGACAGCTGGGGCCCGG - Exonic
1195129426 X:101839160-101839182 TGGCCCAGGATGCTGGGACACGG + Intronic
1195176812 X:102320669-102320691 TGGCCCAGGATGCTGGGACACGG - Intronic
1195182052 X:102366424-102366446 TGGCCCAGGATGCTGGGACACGG + Intronic
1195254780 X:103080945-103080967 TGGCCCAGGATGCTGGGACAGGG + Intronic
1196881888 X:120206325-120206347 TGGCTCAAGCAGCTGCGACAGGG + Intergenic