ID: 1121235946

View in Genome Browser
Species Human (GRCh38)
Location 14:92391344-92391366
Sequence GTTGGCACAAGGGTTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121235946_1121235957 -4 Left 1121235946 14:92391344-92391366 CCCAGCCCAACCCTTGTGCCAAC 0: 1
1: 0
2: 0
3: 18
4: 149
Right 1121235957 14:92391363-92391385 CAACCCCAGGGTCTCCAGGGTGG 0: 1
1: 0
2: 3
3: 34
4: 288
1121235946_1121235964 20 Left 1121235946 14:92391344-92391366 CCCAGCCCAACCCTTGTGCCAAC 0: 1
1: 0
2: 0
3: 18
4: 149
Right 1121235964 14:92391387-92391409 TTGTTACCACGCTAAACACTGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1121235946_1121235963 19 Left 1121235946 14:92391344-92391366 CCCAGCCCAACCCTTGTGCCAAC 0: 1
1: 0
2: 0
3: 18
4: 149
Right 1121235963 14:92391386-92391408 GTTGTTACCACGCTAAACACTGG 0: 1
1: 0
2: 0
3: 0
4: 39
1121235946_1121235955 -7 Left 1121235946 14:92391344-92391366 CCCAGCCCAACCCTTGTGCCAAC 0: 1
1: 0
2: 0
3: 18
4: 149
Right 1121235955 14:92391360-92391382 TGCCAACCCCAGGGTCTCCAGGG 0: 1
1: 0
2: 4
3: 31
4: 281
1121235946_1121235954 -8 Left 1121235946 14:92391344-92391366 CCCAGCCCAACCCTTGTGCCAAC 0: 1
1: 0
2: 0
3: 18
4: 149
Right 1121235954 14:92391359-92391381 GTGCCAACCCCAGGGTCTCCAGG 0: 1
1: 0
2: 5
3: 23
4: 241
1121235946_1121235958 -3 Left 1121235946 14:92391344-92391366 CCCAGCCCAACCCTTGTGCCAAC 0: 1
1: 0
2: 0
3: 18
4: 149
Right 1121235958 14:92391364-92391386 AACCCCAGGGTCTCCAGGGTGGG 0: 1
1: 0
2: 1
3: 35
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121235946 Original CRISPR GTTGGCACAAGGGTTGGGCT GGG (reversed) Intronic
902286922 1:15413050-15413072 GTTGGCGGCGGGGTTGGGCTCGG - Intronic
903656132 1:24949823-24949845 CTTGGCAGAAGGGTGGGCCTTGG + Intronic
904254853 1:29248351-29248373 GTTGGTTCCAGGCTTGGGCTGGG + Intronic
904358534 1:29957358-29957380 GTGGGTACAAGGTTTGAGCTGGG + Intergenic
904483084 1:30806246-30806268 GCCGGCAGAAGGGTTGGGGTTGG + Intergenic
906460151 1:46030582-46030604 GTGGGCACAGGGGATGCGCTGGG - Intronic
909880839 1:80875790-80875812 GTTGGAAAAGGGGTTGGGGTGGG - Intergenic
920315536 1:205073592-205073614 CTTGCCACAAGGGTGGGGCTAGG + Intronic
921281302 1:213570763-213570785 AGTGGTACAAGGGTAGGGCTGGG - Intergenic
922614150 1:226951283-226951305 GTTGGTCCACGGCTTGGGCTTGG - Intronic
923030636 1:230246700-230246722 GTAGGCACAGGTGTTGGGCTGGG - Intronic
1064024613 10:11837408-11837430 GCTGGCAGACGGGTTGGGATTGG + Intronic
1067847860 10:49737606-49737628 GTTGGCACAATGGCTGACCTGGG - Intronic
1069604434 10:69730760-69730782 GTTGGCACAAAGCTGGGGGTGGG + Intergenic
1070459280 10:76648686-76648708 TTTGACATAAGGTTTGGGCTGGG - Intergenic
1072220605 10:93324695-93324717 GATTGCAAAAGGGTTGGCCTGGG - Intronic
1073040229 10:100599192-100599214 GCTGGCACCATGGCTGGGCTTGG + Intergenic
1073066914 10:100766533-100766555 ATTGGCATAAGGTTTGGACTAGG + Intronic
1075311745 10:121420161-121420183 GGTGGCACAAGACTGGGGCTGGG - Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078732277 11:13985844-13985866 GATGGCACAAGGGTAGGGCAGGG - Intronic
1081863141 11:46345586-46345608 GTAGGTACAAGGGGTGGCCTGGG + Intronic
1083641628 11:64148826-64148848 GTGGGCACAGGGGCTGGGGTGGG + Intronic
1083741338 11:64713055-64713077 GTTGGCGCAGGGGTTGCGCGCGG + Exonic
1088556731 11:111069369-111069391 GATGGCTCTAGGGTAGGGCTGGG - Intergenic
1089065823 11:115661002-115661024 CTTGGCACAAGGGTTTGCTTCGG - Intergenic
1091322044 11:134658615-134658637 GGTGACACATGGGGTGGGCTGGG - Intergenic
1093194175 12:16110793-16110815 CTAGGCACAAGGCTTGGCCTAGG + Intergenic
1094874885 12:34629139-34629161 GTGGGCACAGGGTTAGGGCTAGG + Intergenic
1098216329 12:68224140-68224162 GATGGTACAAAGGTTGGGTTGGG - Intronic
1100184260 12:92122014-92122036 GTTGGGAGAGGGGTAGGGCTAGG - Intronic
1106270619 13:28149870-28149892 GTTGGCCAAAGTGTTGTGCTGGG + Intronic
1106520662 13:30494806-30494828 GTTGGCACAGGGGTTGGGGGAGG - Intronic
1107963432 13:45578649-45578671 GATGGCTAAAGGGTTGGGTTGGG + Intronic
1108579586 13:51817387-51817409 GTTTGGACAAGGGATTGGCTGGG + Intergenic
1110507101 13:76299551-76299573 GTGGGCAGAAGGGATGGGCCTGG + Intergenic
1110798644 13:79669817-79669839 GTTGGCAGTAGGGTGGGGATGGG - Intergenic
1117187949 14:53260941-53260963 GTTGGCAGAGGGGTGGGGTTGGG + Intergenic
1118568203 14:67165784-67165806 GTTGGGACAAGGGTGGGAGTGGG - Intronic
1121235946 14:92391344-92391366 GTTGGCACAAGGGTTGGGCTGGG - Intronic
1121317864 14:92972920-92972942 CCTGGCACAAGGGTTTGGCTGGG - Intronic
1122136582 14:99636286-99636308 GTTGGCACATGGGTGGGGGTGGG + Intergenic
1122307831 14:100776832-100776854 CTTGGCACAGGGGCTGGGCATGG - Intergenic
1122416298 14:101551232-101551254 GTGGGCAGAAGGGTTGGGGTGGG - Intergenic
1122629385 14:103100349-103100371 GATGGCACAAGGCTGGGCCTGGG + Exonic
1124662760 15:31563591-31563613 GCTGGCACAGGGCTGGGGCTAGG - Intronic
1124949925 15:34308332-34308354 GTTGGATTAAGGGTTGGGCACGG + Intronic
1125721949 15:41849418-41849440 GTTGGAACAAGGGTGGGGCAGGG + Intronic
1126436692 15:48645028-48645050 GGCGGCGCACGGGTTGGGCTTGG - Intronic
1128549825 15:68590928-68590950 ATTTGCACAAGGGTAGGGATGGG - Intronic
1130038650 15:80384899-80384921 GCTGGTAAAAGGTTTGGGCTGGG - Intronic
1130117050 15:81014436-81014458 GCTGGAACAGAGGTTGGGCTGGG - Intronic
1130302359 15:82689480-82689502 GAGGGCACAAGGGTGGGGATGGG + Intronic
1132044033 15:98548896-98548918 GAAGGCAGAAGGGTGGGGCTTGG - Intergenic
1134413569 16:14023758-14023780 CCTGGCACAAGGGCTGGGCGTGG + Intergenic
1135179231 16:20258475-20258497 GTTGGCATTAGGGCTGGGGTTGG + Intergenic
1137026930 16:35486191-35486213 GTTGGCTCAGTGGATGGGCTCGG - Intergenic
1137867695 16:51917754-51917776 GTAGGGACAGGGATTGGGCTGGG - Intergenic
1138245560 16:55464559-55464581 GTTGGGTCGAGGGTGGGGCTGGG - Intronic
1140939504 16:79708192-79708214 GGTGGCACACAGGTGGGGCTGGG - Intergenic
1141644159 16:85358475-85358497 GTTGGCACCAGGGGCGGGCTGGG - Intronic
1142670644 17:1485991-1486013 GTTGGCACCAGGGTGGAGCCCGG + Intronic
1143558331 17:7676359-7676381 GTAAGGACAAGGGTTGGGCTGGG - Intronic
1148383876 17:47220830-47220852 GTTGGCACGGGGTTTGGGGTGGG + Intronic
1152140624 17:78534375-78534397 GTTGGCCCTAGGGCTGGGCCGGG + Intronic
1152155898 17:78632521-78632543 GGTGGCTCAGGGGCTGGGCTCGG - Intergenic
1154019217 18:10647944-10647966 GTTGGCACAAGGGCAGAGCAGGG - Intergenic
1157311386 18:46555885-46555907 GCTGCCACATGAGTTGGGCTGGG - Intronic
1159653105 18:71000535-71000557 GGTGGCACTATGGTTGGGTTCGG + Intergenic
1160470487 18:79128343-79128365 GTTGGCAAAAGGGATGGGCGTGG - Intronic
1160754525 19:750700-750722 GTTGCCCCAAGGGGTGGGCTGGG + Intergenic
1161399979 19:4062961-4062983 GTGGACCCAAGGGCTGGGCTAGG + Intronic
1164243530 19:23410740-23410762 ATTGGCACAAAGGTGGGGTTGGG - Intergenic
1164916234 19:32054246-32054268 ATTGGCTCACGGGTTGGGATAGG + Intergenic
1165234845 19:34412359-34412381 CTTGGGAGAAGGGTTGGGCAGGG + Intronic
1165445799 19:35856296-35856318 GTGGGGAGAGGGGTTGGGCTGGG + Intronic
1165472328 19:36010691-36010713 GTGGGCACCAGGGCTGGGCAGGG + Intronic
1166177852 19:41087627-41087649 GTTGGCAGAGGGGATTGGCTAGG - Intergenic
1166541241 19:43607573-43607595 CTTGGCAGAAGGGGTGGGGTGGG - Exonic
1167644589 19:50698934-50698956 GTAGGCACAAGGGTTGAACGAGG - Intronic
1167824646 19:51961088-51961110 GTGAGCACAAGGTTGGGGCTAGG + Intergenic
1168203883 19:54835295-54835317 GTGGGGACCAGGGTTGGACTAGG + Intronic
925319673 2:2952438-2952460 GTTGGGGGAAGGGTTGGACTAGG - Intergenic
925719416 2:6813181-6813203 GTTTTCACAAGGGTGGGGCAGGG - Intergenic
927510036 2:23638703-23638725 GGTGGCACAGAGGCTGGGCTGGG + Intronic
930456163 2:51610121-51610143 TTTGGCACAAGGACTGGCCTTGG + Intergenic
930575083 2:53136696-53136718 TCTGGCAGAAGGGTTGGGGTGGG + Intergenic
931981066 2:67694740-67694762 GCTGGCACAAGGGAGGGGGTGGG - Intergenic
934605059 2:95688507-95688529 GTTGGACCCAGGGCTGGGCTGGG - Intergenic
936082105 2:109439296-109439318 GTGGGGACAAGTGCTGGGCTGGG - Intronic
936538513 2:113331049-113331071 GTTGGACCCAGGGCTGGGCTGGG - Intergenic
946190630 2:218006059-218006081 GATGGCACAGGGTTGGGGCTGGG - Intergenic
947269185 2:228314556-228314578 GAAGGAACAAGGTTTGGGCTGGG + Intergenic
948325789 2:237119677-237119699 GTTGGCATAAGGGAATGGCTAGG + Intergenic
1170212469 20:13859114-13859136 ATTGGCACAAGGGATGGATTTGG + Intronic
1171335163 20:24378919-24378941 GATGGCACCAGAGTTGGGATGGG - Intergenic
1174405265 20:50298819-50298841 GATTGCACAAGGGCTGGGCCTGG + Intergenic
1175485528 20:59343183-59343205 GTTGGCACTAGGGCTGGGGTTGG - Intergenic
1176154644 20:63612458-63612480 GTGGCCACAAGGGGTGAGCTGGG + Intronic
1178701052 21:34834459-34834481 GGAGGCACGAGGGTTGGGCGTGG + Exonic
1180213129 21:46307709-46307731 GTCAGCACAGGGGTTGGGATAGG + Intronic
1182431152 22:30299601-30299623 ATTGGCAGAGGGGCTGGGCTAGG - Intronic
1183544678 22:38449110-38449132 GTTGGCACCAGGGCTGGTCAGGG + Intronic
1185277879 22:49957586-49957608 GATGGCTCAGGGGCTGGGCTGGG + Intergenic
950506691 3:13399543-13399565 GCTGGCACAAGGCTTGGGATGGG + Intronic
952944869 3:38472576-38472598 GTGCCCACAAGGGTGGGGCTGGG + Intronic
953829443 3:46282832-46282854 GTTGGGACTAGGGATGGGATAGG + Intergenic
953964050 3:47288824-47288846 GTTGGCATAAGGCTTGGCCTAGG + Intronic
954116457 3:48469385-48469407 GTGGGCCCATGGGCTGGGCTGGG + Exonic
955348208 3:58176282-58176304 GGTGGCTCTAAGGTTGGGCTGGG + Intergenic
961431101 3:126883716-126883738 CATGGCACACGGGTTGTGCTGGG - Intronic
961477660 3:127158722-127158744 GTTGGCAGCTGGGGTGGGCTGGG + Intergenic
961754937 3:129121876-129121898 GTGGGCCCGAGGGTTGGGCTGGG - Intronic
965054605 3:163697252-163697274 ACTGGCTCAAGTGTTGGGCTTGG + Intergenic
969532170 4:7736147-7736169 GCTTGCTCAAGGGCTGGGCTGGG + Intronic
976740620 4:88352891-88352913 GGTGGCATAACGGATGGGCTAGG + Intergenic
978307703 4:107349840-107349862 GATGGAAAAAGGGTTGGGGTGGG + Intergenic
983335023 4:166379681-166379703 CTTGGCACTGGGGTTGGCCTAGG + Intergenic
984864710 4:184271788-184271810 GTGGGGACAAGGGAGGGGCTAGG + Intergenic
985962849 5:3316030-3316052 ACTGGCCCAGGGGTTGGGCTGGG + Intergenic
989563010 5:42872612-42872634 TGTGGCACATGGGTTGGGCATGG + Intronic
990194054 5:53293038-53293060 GTTAGCATAAGGGTAGGGGTAGG - Intergenic
990207211 5:53442368-53442390 TGTGGCACAAGGTTTGGGTTGGG - Intergenic
992979035 5:82147830-82147852 GTTGGCACAAGGACTGGGGGAGG - Intronic
997709989 5:135996200-135996222 GTGCGCACAAGTGTTGGGCTGGG + Intergenic
998395675 5:141816436-141816458 GTTGTCCAAAGGGTTGGGTTGGG - Intergenic
1000525906 5:162357139-162357161 ATTGGGACAAGGGCTGGGCAAGG - Intergenic
1003143872 6:3493582-3493604 GTGGGCACAGGGGTTGGGGGAGG + Intergenic
1005025788 6:21461727-21461749 GTTGTCACAAGTGTGGGGGTAGG - Intergenic
1006447944 6:34090443-34090465 GGTGGCCCAAGGGAGGGGCTGGG + Intronic
1006622904 6:35379055-35379077 GTGGGCACAGGGTTAGGGCTTGG + Intronic
1007011805 6:38425403-38425425 GTTAGAACTAGGGCTGGGCTCGG - Intronic
1007500755 6:42295011-42295033 GTGGGAACAAGGGGTGGGGTGGG + Intronic
1007599983 6:43075643-43075665 CCTGGAACAAGGGTTGTGCTGGG + Intergenic
1009502098 6:64426662-64426684 GTTGGCAGAGGGGTTGGCTTTGG + Intronic
1012349074 6:98229121-98229143 GTGGGCAAGAGGTTTGGGCTGGG + Intergenic
1019132695 6:169888966-169888988 GCTGGCCCAAGGCATGGGCTGGG + Intergenic
1019132721 6:169889126-169889148 GCTGGCCCAAGGCATGGGCTGGG + Intergenic
1021020799 7:15596141-15596163 GTTGGCACAAAGGTTGAAATTGG - Intergenic
1022344358 7:29499820-29499842 TTTGACAAAAGGGCTGGGCTAGG + Intronic
1022515615 7:30973441-30973463 AGTGGCACACGGGTGGGGCTGGG + Intronic
1022801425 7:33780697-33780719 GTAGGCACCAGGGGTGGGATGGG - Intergenic
1027392778 7:77722214-77722236 TTTGGCAGAGGGGTTGGGTTGGG + Intronic
1033506467 7:142007433-142007455 GTTGTAACAAGGGATGGGGTAGG - Intronic
1046104476 8:109649295-109649317 ATTAAGACAAGGGTTGGGCTGGG - Intronic
1048288343 8:133160407-133160429 GTGGGTTCAAGGGTTGGGGTGGG + Intergenic
1048306068 8:133285618-133285640 GTTGGCACAAGGGATGGACCCGG - Intronic
1049027394 8:140004168-140004190 GTTGCCACAACGGTGGGGCCGGG + Intronic
1050700935 9:8337995-8338017 GTTAGCAGGAGGGTTGGCCTAGG - Intronic
1053634353 9:39981446-39981468 GGTGGCACAAGTGTTAGGTTGGG + Intergenic
1053771395 9:41482039-41482061 GATGGCACAAGTGTTAGGTTGGG - Intergenic
1054209534 9:62269251-62269273 GGTGGCACAAGTGTTAGGTTGGG - Intergenic
1055662858 9:78523657-78523679 ATGGGCAAAAGGGTTGGGCATGG + Intergenic
1056948894 9:91026084-91026106 CCTGACACAGGGGTTGGGCTGGG + Intergenic
1057225180 9:93289297-93289319 GTGGGCCCCAGGGGTGGGCTTGG - Exonic
1057773147 9:97984423-97984445 GTCGCCACAACGGTTGGCCTTGG - Intronic
1057917977 9:99072160-99072182 GTTGGCAGAAGGGCCAGGCTAGG - Intergenic
1058682913 9:107455672-107455694 GTTGGCACAGGGTTGGGGGTGGG + Intergenic
1061130655 9:128706084-128706106 GTTGGGACTGGGGCTGGGCTAGG - Intronic
1061320241 9:129823779-129823801 GATGGCACCAGGGCCGGGCTAGG - Intronic
1061653492 9:132069762-132069784 GTAGGATGAAGGGTTGGGCTGGG - Intronic
1062121844 9:134838147-134838169 GATGTCAGAAGGCTTGGGCTGGG - Intronic
1062668552 9:137692952-137692974 GTGGCCACAAGGGTTGTCCTTGG + Intronic
1188928078 X:36070399-36070421 CTTGACACCAGGGTGGGGCTTGG + Intronic
1189260285 X:39673616-39673638 GTGGGGACGAGGGCTGGGCTGGG - Intergenic
1192316081 X:70052954-70052976 TTTGGCAGAAGGGTTGGAGTTGG + Intergenic
1198391781 X:136182577-136182599 CTTGGCCCAGGGGTTTGGCTGGG + Intronic
1200017862 X:153179786-153179808 GGTGGCAGAAGGGTTGGGGCTGG - Intronic