ID: 1121236429

View in Genome Browser
Species Human (GRCh38)
Location 14:92394488-92394510
Sequence CTCAAACTCTCCTGCGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121236429_1121236431 -6 Left 1121236429 14:92394488-92394510 CCAGCCACGCAGGAGAGTTTGAG 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1121236431 14:92394505-92394527 TTTGAGACTGCAATGAGCTATGG 0: 1
1: 22
2: 180
3: 576
4: 1418
1121236429_1121236432 5 Left 1121236429 14:92394488-92394510 CCAGCCACGCAGGAGAGTTTGAG 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1121236432 14:92394516-92394538 AATGAGCTATGGTTATAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121236429 Original CRISPR CTCAAACTCTCCTGCGTGGC TGG (reversed) Intronic
901957293 1:12795808-12795830 TTCAAACTCTCCTCAGGGGCAGG - Exonic
901965312 1:12861591-12861613 TTCAAACTCTCCTCAGGGGCAGG - Exonic
901973692 1:12928065-12928087 TTCAAACTCTCCTCAGGGGCAGG - Intronic
901980705 1:13031942-13031964 TTCAAACTCTCCTCAGGGGCAGG - Exonic
901988729 1:13095340-13095362 TTCAAACTCTCCTCGGGGGCAGG + Intergenic
901993084 1:13131427-13131449 TTCAAACTCTCCTCGGGGGCAGG - Intergenic
902001384 1:13196989-13197011 TTCAAACTCTCCTCAGGGGCAGG + Exonic
902011486 1:13273702-13273724 TTCAAACTCTCCTCAGGGGCAGG + Intergenic
902020620 1:13342694-13342716 TTCAAACTCTCCTCAGGGGCAGG + Exonic
902374243 1:16022841-16022863 CCCAAAGTCTCCTGGGTGGCAGG + Intronic
902379194 1:16044718-16044740 CCCAAAGTCTCCTGGGTGGCAGG + Intronic
903096950 1:20985741-20985763 GTCAAACTCTCCTGAATGGAAGG + Intronic
904091707 1:27949536-27949558 CTCAAACTGTCCTGGCTGCCAGG + Intronic
904154641 1:28472716-28472738 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
905434564 1:37947624-37947646 CTCAAACAGCCCTGTGTGGCAGG - Intergenic
907472806 1:54685394-54685416 CTCTAACACTCCTGTGGGGCTGG + Intronic
913319963 1:117581404-117581426 CTCAAACTCCCCTGCCTCTCTGG + Intergenic
913705905 1:121422855-121422877 CTCACACTTTCCTGAGTAGCAGG - Intergenic
914811214 1:151029661-151029683 CTCAAACTTTCCAGCTCGGCTGG - Intronic
916249420 1:162723055-162723077 CTAAAACTCTGCTTAGTGGCAGG + Intronic
917422615 1:174880704-174880726 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
917646156 1:177030708-177030730 CCCATTCTCTCATGCGTGGCTGG - Intronic
921731121 1:218579510-218579532 CTGAAACTCTCCTGCATTGCTGG - Intergenic
1063519875 10:6731470-6731492 CTCAGCCTCTCCTGAGTAGCTGG - Intergenic
1063658647 10:8017065-8017087 CTCAGTCTCTACTGGGTGGCTGG + Intergenic
1067108635 10:43382877-43382899 CTCAAACTCCTCAGCTTGGCCGG + Intergenic
1067392694 10:45879116-45879138 CTCAGCCTCTCCTGAGTAGCTGG - Intergenic
1069990222 10:72310607-72310629 CTCAGTCTCTCCTTCTTGGCCGG + Intergenic
1073286574 10:102393391-102393413 CTCTGACTCTCCTGAGTAGCTGG - Intergenic
1074526422 10:114267229-114267251 CTCAGACTCTCCCGAGTAGCTGG + Intronic
1075807680 10:125201942-125201964 CTCAAGCTAGCCTGGGTGGCCGG + Intergenic
1078965121 11:16330438-16330460 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1081695931 11:45109103-45109125 CTCAACCTTTCCTGAGGGGCGGG - Intronic
1083200564 11:61118756-61118778 CTCTAAGCCTCCTGCGAGGCGGG - Intronic
1083291002 11:61690078-61690100 CGCAAACTCTCCTGGGCTGCAGG + Intronic
1084079297 11:66809818-66809840 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
1085146295 11:74200935-74200957 CTCAGTCTCTCCCGAGTGGCAGG + Intronic
1085152032 11:74260023-74260045 CTGGAACTCTCATGCGTTGCTGG - Intronic
1086509074 11:87536580-87536602 CTCAAACTCTTCTTGGTGACTGG + Intergenic
1087904591 11:103680891-103680913 CTGAAAGTCTCCTGCTTAGCAGG - Intergenic
1089560910 11:119342681-119342703 CTTACACCCTCCTGCCTGGCAGG + Exonic
1090003326 11:122980171-122980193 CTCAAACCCTTCTGCTTCGCTGG - Intronic
1091995787 12:4992826-4992848 CTCTTGCTCTCCTGTGTGGCTGG - Intergenic
1098166235 12:67701328-67701350 CTCAACCTCTCCTGAGTCACTGG + Intergenic
1098711758 12:73771730-73771752 GAGAAAGTCTCCTGCGTGGCTGG + Intergenic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1102583629 12:113908102-113908124 CTCAACCCATCCTGCCTGGCTGG + Intronic
1102863365 12:116355320-116355342 CTCCAACTCTCCTGTGCGGTAGG - Intergenic
1102934448 12:116884776-116884798 CTCAAACTCTGGGGCGTGGCAGG - Intergenic
1105547390 13:21360796-21360818 CTCATACCCTCCAGGGTGGCAGG - Intergenic
1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG + Intronic
1112139068 13:96618211-96618233 CTCACAGCCTCCTGAGTGGCTGG + Intronic
1112545119 13:100360416-100360438 CTCTAACTTTCCTGTGTGGTAGG - Intronic
1115352675 14:32412308-32412330 CTCAGACTCTTCTGCATAGCAGG - Intronic
1115510931 14:34137261-34137283 CTCAATCCCTGCTGAGTGGCTGG + Intronic
1115635808 14:35289444-35289466 CTCAACCTCTCCCGAGTAGCTGG + Intronic
1117657618 14:57972737-57972759 CTCTCACTCTCCTGCCTGGCTGG - Intronic
1118516516 14:66534660-66534682 CTCAAACCCTCCTACATTGCTGG - Intronic
1121236429 14:92394488-92394510 CTCAAACTCTCCTGCGTGGCTGG - Intronic
1122907574 14:104808798-104808820 CTCAATCATTCCTGCCTGGCAGG - Intergenic
1127667815 15:61166058-61166080 TTCAAACTCTTCTGAGTGGGGGG + Intronic
1129518330 15:76170540-76170562 CTCTAACTCTCCAGCGGGGCAGG - Intronic
1132652597 16:1028396-1028418 CCCACACTCTCCTGCTTGGATGG + Intergenic
1135172578 16:20199642-20199664 TTCAAGCCCTACTGCGTGGCAGG + Intergenic
1135463787 16:22667937-22667959 CTCAGCCTCTCCTGAGTAGCTGG + Intergenic
1135822192 16:25693590-25693612 CTCAAACGCATTTGCGTGGCTGG + Intronic
1135918356 16:26625988-26626010 CCCAAATTCTGCTGCGTGGATGG - Intergenic
1136399209 16:30008799-30008821 CTCAATATCTCCTGCCTGCCAGG - Intronic
1141407884 16:83809403-83809425 CTTCAACTCTTTTGCGTGGCAGG - Exonic
1142957320 17:3530719-3530741 CTCAAACTCTGCTGCATGTTAGG + Intronic
1143434622 17:6914461-6914483 CACAAACTCTTCTGCGCAGCGGG + Intronic
1145972269 17:28963332-28963354 TTCAAACTGTCTTGCCTGGCTGG + Intronic
1146146833 17:30426315-30426337 CTCCAATTCTCCTGCGTGGCTGG - Intronic
1146262256 17:31429710-31429732 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1147335767 17:39726217-39726239 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1147898786 17:43769992-43770014 CTGGAACTCTTCTGCGTGGCTGG + Intronic
1149458199 17:56806638-56806660 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
1151025428 17:70671325-70671347 CTCACACACAGCTGCGTGGCTGG - Intergenic
1152714322 17:81891287-81891309 CTCCCACTCTCCGGCGCGGCCGG + Intronic
1153482737 18:5563872-5563894 CTCAACCTCTCCTGAGCTGCAGG - Intronic
1154938611 18:21088379-21088401 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1160561146 18:79756343-79756365 CCCAAACTCTGCTGCCCGGCAGG + Exonic
1160954930 19:1686802-1686824 CTCAGCCGCTCCTGCGTGCCGGG - Intergenic
1163151321 19:15416491-15416513 CTTAAACTCCCATGCCTGGCAGG - Intronic
1163405563 19:17119942-17119964 CTCAAACTCCCGAGCTTGGCCGG - Intronic
1164686528 19:30169758-30169780 CCCAAACCCTGCTGCATGGCAGG + Intergenic
1166456946 19:42949676-42949698 CTCAACCTCTCCTGCCTCACGGG - Intronic
1166486699 19:43220161-43220183 CTCAATGTCTCCTGCCTTGCGGG - Intronic
1166907118 19:46119102-46119124 CTCAAACTCACCTGGAGGGCGGG - Intergenic
925396953 2:3540965-3540987 CTGGAACTCTCCTGCCTGACTGG + Intronic
927920975 2:26971307-26971329 CCCACACGCTCCTGCCTGGCTGG + Intronic
928278414 2:29922177-29922199 CCCAAATTCTCCTGTGTGGACGG - Intergenic
929240816 2:39651461-39651483 CACAAACCCTCCTGTCTGGCAGG + Intergenic
931966773 2:67543978-67544000 CTCAAGGCCTCCTGAGTGGCTGG + Intergenic
938769049 2:134484023-134484045 CTCAACCTCTCCCGAGTAGCTGG - Intronic
939068595 2:137513768-137513790 CACAAACTCTCCTGGTTGTCTGG - Intronic
939240811 2:139557654-139557676 CTCACTCTCTCCTGCATAGCAGG + Intergenic
941275281 2:163483250-163483272 CTCGAATTCTGCTGAGTGGCAGG - Intergenic
942578554 2:177392562-177392584 CTCGAACTCACCTGCTTGGCAGG + Intronic
947798585 2:232910674-232910696 CTAAAACTCTCCTACATGGCTGG - Intronic
948258009 2:236582704-236582726 CTGAAACTCTCCTGTCTGGACGG - Intergenic
1171148142 20:22803624-22803646 TTCAAACCCTACTGCTTGGCTGG + Intergenic
1171314554 20:24177751-24177773 CTGAAACTCTACTGGGTGTCAGG - Intergenic
1172335159 20:34109982-34110004 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1175436591 20:58955943-58955965 CTCAAACTCCCATGAGTAGCTGG - Intergenic
1176060169 20:63169053-63169075 CTCACCCACACCTGCGTGGCGGG + Intergenic
1176064726 20:63188572-63188594 CACAAGCTCTCCTTTGTGGCTGG - Intergenic
1176948953 21:15020930-15020952 CTGAAACTCTCCTCCATTGCTGG + Intronic
1178404600 21:32313757-32313779 TTAAAACTCTCCTGCATGCCTGG - Exonic
1179282740 21:39948664-39948686 CTAAAAATCTCATGCGTTGCTGG - Intergenic
1181669411 22:24419212-24419234 CTCCATCTCTCCTGCCTGACAGG + Intronic
1183412543 22:37663705-37663727 CTCAAACCCTCCACCGTGGAGGG + Intronic
1185154808 22:49186912-49186934 TCCAAACCCTCCCGCGTGGCTGG - Intergenic
1185318263 22:50188357-50188379 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
952920263 3:38279053-38279075 CTCACCTTCTCCTGCATGGCTGG + Intergenic
954917844 3:54164033-54164055 TTCAAACTCCACCGCGTGGCTGG - Intronic
955074961 3:55604873-55604895 CTCAAACTTTCCTGTGTATCAGG + Intronic
955488332 3:59457383-59457405 CTCAAACTCCCCTTCATAGCAGG - Intergenic
955707119 3:61739056-61739078 CTCAAGCTCTCCTCCCTGGTTGG + Intronic
961719414 3:128882865-128882887 TGCAATCTCTCCTGTGTGGCAGG + Intronic
962542127 3:136393388-136393410 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
964256585 3:154781431-154781453 CTAAAACTCATCTGCGTGGTGGG - Intergenic
965653393 3:170957379-170957401 CTCGAACTCTTCTGCATTGCTGG - Intergenic
966563207 3:181346571-181346593 CTCAGCCTCTCCTGAGTAGCTGG + Intergenic
967229001 3:187319872-187319894 CTGAAACTCTCCTGCAGGGGAGG + Intergenic
967294678 3:187953511-187953533 CTCTAACTCTCCTTCCTGCCTGG + Intergenic
967707484 3:192668403-192668425 CTCAGACTCTCCTACTAGGCAGG - Intronic
968621416 4:1604965-1604987 CTCCACATCTCCTGCTTGGCAGG + Intergenic
969487638 4:7481175-7481197 CACAGACTTTCCTGAGTGGCAGG + Intronic
969699440 4:8759876-8759898 CCAGAACTCTCCTGCGTTGCTGG + Intergenic
969891036 4:10260298-10260320 GTGAATCTCTCCTGCCTGGCTGG + Intergenic
971414910 4:26416147-26416169 CTCAAATTTTAGTGCGTGGCAGG + Intronic
972393610 4:38636585-38636607 CTCACACTATCCTGTGTGGAAGG + Intergenic
972510913 4:39768328-39768350 CTCAGAGCCTCCTGGGTGGCTGG - Intronic
975555760 4:75663380-75663402 CGCTAAATCTCCTGAGTGGCTGG + Intronic
980031497 4:127837055-127837077 CTCAACCTCTCCTGAGTAGCTGG + Exonic
982149178 4:152433322-152433344 CTGAAACTCTCTTACATGGCTGG - Intronic
982384293 4:154782598-154782620 CTCAAACTCTCGGGAGTAGCTGG + Intronic
986543235 5:8869361-8869383 CACAAAGTCTCCTACCTGGCTGG - Intergenic
986976240 5:13397701-13397723 TTGAAACCCTCCTACGTGGCTGG + Intergenic
988904321 5:35770711-35770733 CTCCACCTCTCCTCTGTGGCTGG - Intronic
993893255 5:93500752-93500774 CTCAAAGCCTCCTGAGTAGCTGG + Intergenic
994165305 5:96602005-96602027 TTCAAACTCTCTTGAGTGGCAGG + Intronic
996813865 5:127551895-127551917 CTCACACTGTCCTGGGTGGCAGG - Intronic
997059649 5:130486267-130486289 CTTAAACACTTCTGCATGGCTGG - Intergenic
1001308230 5:170591271-170591293 CTCAAACTCTACTGGGAGGAAGG - Intronic
1001645061 5:173274277-173274299 CTCAGACTCTCCTGAGTAGCTGG - Intergenic
1001913509 5:175540656-175540678 CTCCAAGCCTCCTGCCTGGCTGG - Intergenic
1004399115 6:15272006-15272028 CTCAACCTCTCCTGAGTAGGTGG - Intronic
1006484155 6:34324236-34324258 CTCACAGTCTCCTGAGTAGCTGG - Intronic
1006531007 6:34653852-34653874 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1007390944 6:41549096-41549118 CTGAATCTCTCCTGCGGGACGGG + Intronic
1007558739 6:42788009-42788031 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
1011052802 6:83172283-83172305 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1013146731 6:107401223-107401245 CTCAAGGTCTCCTGAGTAGCCGG - Intronic
1013188168 6:107779841-107779863 CTCAAACTCTCCTGCTTTGGAGG + Intronic
1013231233 6:108164083-108164105 CTCGAACGCTCCTGCCAGGCTGG - Intronic
1016388968 6:143556308-143556330 CTCCAATGCTCCTGCGTGCCAGG + Intronic
1019702658 7:2481485-2481507 CCCAATCTCTGCTGCCTGGCTGG + Intergenic
1021587864 7:22228910-22228932 CTGAAACTCTCCTATGTGCCGGG + Intronic
1022511818 7:30939999-30940021 CTAAAACTCTCTTACGTTGCTGG - Intronic
1023279386 7:38554073-38554095 CTCCAATTCCCCTGCCTGGCTGG + Intronic
1023872753 7:44271690-44271712 CTCTGACTCTCCTCCCTGGCTGG + Intronic
1024201161 7:47107062-47107084 CTGGAACTCTCCTGTATGGCTGG - Intergenic
1024491090 7:49986427-49986449 CCCAAAGGGTCCTGCGTGGCAGG + Intronic
1025914644 7:65855847-65855869 CTCAAACTCTCCCGAGTAGGTGG - Intergenic
1030717290 7:112824475-112824497 CTCAGACTCTCCTGAGTAGCTGG + Intronic
1033336901 7:140461516-140461538 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1035431461 7:158826131-158826153 CTGAAATTCTGCTGCGCGGCAGG - Intronic
1036712042 8:11086008-11086030 ATCAAAGTCTCCTCCTTGGCAGG + Intronic
1037543087 8:19890577-19890599 CTCAGCCTCTCCTGAGTAGCTGG - Intergenic
1040017241 8:42709524-42709546 CGCACACTCACCTGCCTGGCTGG + Intronic
1040536509 8:48315652-48315674 CTCTCAGTCTCCTGAGTGGCTGG + Intergenic
1040605732 8:48929266-48929288 CCCAAACTCTACTGAGTGGGTGG + Intergenic
1042040916 8:64587412-64587434 CTCAAACTGTCCTTCGAGGGTGG + Intergenic
1042271809 8:66962604-66962626 ATCAAACCCTCCGGCGGGGCGGG + Intergenic
1042397194 8:68306430-68306452 CTCCACCTCCCCAGCGTGGCAGG + Intronic
1043424531 8:80135427-80135449 CTCTAACTCTCCTGGGGGGCAGG - Intronic
1043974021 8:86564753-86564775 CTCACAGCCTCCTGCGTAGCTGG - Intronic
1048867677 8:138772744-138772766 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1049544555 8:143223870-143223892 TTTAAAATCCCCTGCGTGGCAGG + Intergenic
1049741352 8:144242533-144242555 CCCCAGCTCCCCTGCGTGGCAGG - Intronic
1050703107 9:8363740-8363762 TTCAAACTCTCCTAAGTTGCTGG - Intronic
1052535233 9:29737836-29737858 CTCAACCTCTCCTGAGTAGCTGG - Intergenic
1059269204 9:113061463-113061485 CTCTAACTCTCCTGCCTCCCTGG + Intergenic
1059270339 9:113066912-113066934 CTCTAACTCTCCTGCCTCCCTGG + Intergenic
1059271475 9:113072362-113072384 CTCTAACTCTCCTGCCTCCCTGG + Intergenic
1059272606 9:113077806-113077828 CTCTAACTCTCCTGCCTCCCTGG + Intergenic
1059273741 9:113083248-113083270 CTCTAACTCTCCTGCCTCCCTGG + Intergenic
1059274875 9:113088694-113088716 CTCTAACTCTCCTGCCTCCCTGG + Intergenic
1059378076 9:113901263-113901285 CTCAAGTTCTCCTGCGTCGTTGG + Intronic
1059452478 9:114379106-114379128 AGCAAACTCACCTGCATGGCTGG - Intronic
1061419225 9:130464264-130464286 CACAGAATCTCCTCCGTGGCAGG + Intronic
1186393369 X:9183085-9183107 CTCAAAGTCTCCTGGGTGCCAGG + Intergenic
1190011035 X:46784869-46784891 CTCAAAGCCTCCTGAGTAGCTGG - Intergenic
1190776826 X:53559343-53559365 CACAAACTTGCCTGCTTGGCTGG + Exonic
1190791950 X:53708700-53708722 CTCAGCCTCTCCTGAGTAGCTGG + Intergenic
1193308195 X:79974561-79974583 CTCACTCTCTCCTGTGTGGTTGG - Intergenic
1198000828 X:132433803-132433825 CTCAAGATCCCCAGCGTGGCTGG - Intronic
1201303823 Y:12533850-12533872 GTCAATCTCTTCTGCATGGCAGG - Intergenic