ID: 1121238301

View in Genome Browser
Species Human (GRCh38)
Location 14:92409579-92409601
Sequence TAATATTTTGTTTCTTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1084
Summary {0: 1, 1: 4, 2: 31, 3: 188, 4: 860}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121238301_1121238308 21 Left 1121238301 14:92409579-92409601 CCAGGTCAAGAAACAAAATATTA 0: 1
1: 4
2: 31
3: 188
4: 860
Right 1121238308 14:92409623-92409645 TCTTCCCTAACATGCTCCCCAGG 0: 1
1: 0
2: 2
3: 10
4: 154
1121238301_1121238312 27 Left 1121238301 14:92409579-92409601 CCAGGTCAAGAAACAAAATATTA 0: 1
1: 4
2: 31
3: 188
4: 860
Right 1121238312 14:92409629-92409651 CTAACATGCTCCCCAGGATAGGG 0: 1
1: 0
2: 0
3: 9
4: 84
1121238301_1121238311 26 Left 1121238301 14:92409579-92409601 CCAGGTCAAGAAACAAAATATTA 0: 1
1: 4
2: 31
3: 188
4: 860
Right 1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG 0: 1
1: 0
2: 1
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121238301 Original CRISPR TAATATTTTGTTTCTTGACC TGG (reversed) Intronic
900770706 1:4541256-4541278 TAACATGTTATTTCTTAACCAGG + Intergenic
901984493 1:13063464-13063486 TAAGATTTTTTTTTTTGACAAGG - Intronic
901997317 1:13163306-13163328 TAAGATTTTTTTTTTTGACAAGG + Intergenic
902263112 1:15241786-15241808 TGATGTTTTGCTTCTTGATCTGG + Intergenic
902737118 1:18408605-18408627 TCAAAATTTATTTCTTGACCAGG - Intergenic
902794180 1:18790120-18790142 TGATGTTCTATTTCTTGACCTGG + Intergenic
903249381 1:22041495-22041517 TAATATTCTGTATTTTGATCTGG - Intergenic
903586900 1:24422973-24422995 TAATGTTCTGTTTCTTGATTAGG - Intronic
903790391 1:25888989-25889011 TTTGCTTTTGTTTCTTGACCAGG - Intronic
904230540 1:29067025-29067047 TATTATTTAGTTTCTGGAACTGG + Intronic
904672091 1:32173647-32173669 TAATATTTTGCTTCATTACATGG - Exonic
904683645 1:32245865-32245887 TAATACTCTGTTGCTTGATCTGG + Intergenic
905039855 1:34947268-34947290 TAATGTTCTGTTTCTTGATCAGG - Intergenic
905073941 1:35253058-35253080 TAATATTTTATTTATTAACCTGG + Intergenic
905818231 1:40968581-40968603 CAATGTTCTGTTTCTTGGCCTGG + Intergenic
905958174 1:42017411-42017433 TCATATTTGGTTTCTTGGTCTGG - Intronic
905966516 1:42102993-42103015 TAACATTATGTTTTTTGACCTGG + Intergenic
906644096 1:47460817-47460839 TAGAAATTTATTTCTTGACCAGG + Intergenic
906769751 1:48473052-48473074 TAATGTTTTATTTCTTAACCGGG - Intergenic
907024937 1:51107692-51107714 TAATGTTCTGTTTCTTGATCTGG - Intronic
907656632 1:56349406-56349428 TAATATATTTTTTATTGTCCAGG + Intergenic
907836855 1:58117864-58117886 TAATATTTTTTTTCTGGGCCAGG + Intronic
908036354 1:60058259-60058281 TACTATTTTGTTTCTTGATCTGG + Intronic
908126184 1:61032427-61032449 TCATGTTCTGTTTCTTGACCTGG - Intronic
908218334 1:61978011-61978033 TAATGTTTTATTTCATTACCTGG - Intronic
908838273 1:68250387-68250409 AAATGTTTTGTATCTTGATCTGG - Intergenic
908905404 1:69003149-69003171 AAATATTTTCTTTCTTTACCAGG - Intergenic
909044764 1:70696432-70696454 AAATGTTCTGTTTCTTGATCTGG - Intergenic
909614725 1:77593626-77593648 CAATATTTTATTTCTTAACCTGG + Intronic
909896659 1:81079254-81079276 TAATATTCTGTGTCTTGATTGGG + Intergenic
910615743 1:89196506-89196528 TAATGTTTTATTTCTTGATCTGG + Intronic
910938381 1:92505784-92505806 TAATTTTTTGTTGTTTGTCCAGG + Intergenic
911134080 1:94420211-94420233 TAATGTTCTGTTTCTTGATCTGG - Intronic
911278384 1:95892987-95893009 TAATTTTTTGTATCTTTAGCAGG + Intergenic
911379570 1:97095816-97095838 TACTATTTTGTTTTTTGACAGGG + Intronic
911528370 1:99013518-99013540 TAAAATGTTGCTTCTTGGCCAGG + Intergenic
911662087 1:100512084-100512106 TGATTTTGTATTTCTTGACCTGG + Intronic
911777650 1:101835256-101835278 ATATATTTTGTTTGTTTACCAGG - Intronic
912023282 1:105135056-105135078 TAATACTTCATTTCTTGAGCTGG - Intergenic
912179774 1:107205735-107205757 TAATGTTCTGATTCTTTACCTGG - Intronic
912339174 1:108894037-108894059 TAATTTTTTTTTTCTTGAGATGG - Intronic
912626194 1:111206145-111206167 TAATGTCCTGTTTCTTAACCAGG + Intronic
912737911 1:112166361-112166383 TAATTTTTTGTTTTTTGAGACGG - Intergenic
912882325 1:113427889-113427911 TAAAATTTTGTTTCTTGAATGGG + Intronic
913261985 1:117007231-117007253 CGATATTCTATTTCTTGACCTGG - Intronic
913262106 1:117008456-117008478 TAATTTTTTTTTTTTTGACACGG - Intronic
913390704 1:118308763-118308785 TAATATTCTATTTTTTGACATGG - Intergenic
913528384 1:119714569-119714591 TAAAAATGTGTTTCTTGGCCGGG + Intronic
913696029 1:121326704-121326726 AAATGTTCTGTTTCTTGATCTGG - Intronic
914141535 1:144953355-144953377 AAATGTTCTGTTTCTTGATCTGG + Intronic
914722474 1:150300761-150300783 TAATACTGTGCTTCTTAACCAGG - Intronic
914881689 1:151551947-151551969 TAATGATTTGTTTCTTGATCTGG - Intronic
915272978 1:154768378-154768400 TAATATATTGTTTCCTAAACAGG - Intronic
915877982 1:159633040-159633062 GAATGTTCTATTTCTTGACCTGG + Intergenic
916067669 1:161149581-161149603 TAAGATTTTGTTTGTAAACCTGG + Intergenic
916480571 1:165210964-165210986 TATTATTTTGTTTCTTTACCTGG - Intronic
916542162 1:165767549-165767571 TCATATGTTATTTCTTTACCTGG + Intronic
916560447 1:165930213-165930235 TAAGATTCTGTTTCTTGATCTGG + Intergenic
916839959 1:168589641-168589663 TGAGATTTTGTTTCTTGATCTGG + Intergenic
916911190 1:169348763-169348785 TCATATTTTGATACTTGACTAGG - Intronic
917174159 1:172213383-172213405 TAATGTTCTGTTTCTTGATCTGG + Intronic
917307942 1:173646319-173646341 TAATGTTCTTTTTCTTAACCTGG - Intronic
917769844 1:178265721-178265743 TAATGTTCTGTTTCTTGAGCAGG - Intronic
917801774 1:178577948-178577970 AAATGTTCTATTTCTTGACCTGG + Intergenic
917999157 1:180475071-180475093 TAATATTCTATTTCTTGATCTGG - Intronic
918019835 1:180676543-180676565 TAATATTTTGGTTCTTCAATAGG - Intronic
918266499 1:182846677-182846699 TAGTATTTTGTGTTGTGACCGGG + Intronic
918282072 1:183016800-183016822 TAATATTTCATTTCTAGACCTGG + Intergenic
918469713 1:184859639-184859661 TGATTTTTTTTTTCTTGACCAGG + Intronic
918722615 1:187873026-187873048 TAATAATTTTTTTCTTGTCTAGG + Intergenic
918783679 1:188734867-188734889 TAATAATTTGTTGCTTAAGCTGG + Intergenic
919138210 1:193537081-193537103 TAATATTCTGTTTCTTTAAATGG + Intergenic
919667758 1:200308866-200308888 TAAGATTCTGGGTCTTGACCAGG - Intergenic
919709743 1:200713955-200713977 TTATATTCTGTCTCTTGATCTGG - Intergenic
920483356 1:206345072-206345094 AAATGTTCTGTTTCTTGATCTGG - Intronic
920592147 1:207230834-207230856 TAATGTTTTGTTTCTTCATCTGG + Intergenic
920913714 1:210241090-210241112 TTATGTTTTGGTTCTCGACCTGG - Intronic
920997272 1:211006588-211006610 TTACATTCTATTTCTTGACCTGG + Intronic
921195373 1:212751565-212751587 TAATGTTTTAGTTCTTTACCAGG - Intronic
921256485 1:213345222-213345244 TAGTGTTTTGTTTCTTGATCTGG - Intergenic
921342049 1:214143927-214143949 CAATGTTTTATTTCTTGACCTGG + Intergenic
921659354 1:217780884-217780906 TAATATTTGGTTTTATGACAAGG - Intronic
922411594 1:225381273-225381295 GAATTTTGTGTGTCTTGACCAGG - Intronic
922453924 1:225758944-225758966 TAATTTTCTGTTTCTTGGCCAGG - Intergenic
922485008 1:225967137-225967159 TAATGTTCTGTTTCTTGATCTGG + Intergenic
923453834 1:234145047-234145069 TAATATTTCCTTTGTTAACCTGG - Intronic
923821225 1:237444671-237444693 TAATGTTTTCTTTCTTGAGCTGG + Intronic
924109682 1:240685805-240685827 TAATATTCTATGTCTTGATCTGG + Intergenic
924499654 1:244625337-244625359 TAATATTTTGTTTTTTGGGGGGG + Intronic
1063151958 10:3345207-3345229 AACTCTTTTGATTCTTGACCGGG - Intergenic
1063254992 10:4317461-4317483 TAGTATTTTGTATCTTAACATGG - Intergenic
1063456085 10:6183595-6183617 TATTTTTTTTTTTTTTGACCAGG - Intronic
1063613329 10:7581562-7581584 AAATGTTCTGTTTCTTGATCTGG + Intronic
1063640972 10:7830255-7830277 TAAAGTTCTGTTTCTTGAACTGG - Intronic
1063856120 10:10256010-10256032 TAATGTTCTATTTCTTGATCTGG - Intergenic
1064260596 10:13782735-13782757 TAATAATGTGATTCCTGACCCGG - Intronic
1064839820 10:19578745-19578767 TGATATTTTGCTTCTTGGACTGG - Intronic
1065177858 10:23095977-23095999 TAATTTTTTTTTTCTTGGCTCGG + Intronic
1065210771 10:23400405-23400427 GAATATTCAGTTTCTTGATCTGG + Intergenic
1065343617 10:24727368-24727390 TAATATTTTATTTTTTGAGATGG - Intergenic
1065991038 10:31010713-31010735 TAATTTTTTTTTTCTGGAGCAGG - Intronic
1066257957 10:33699613-33699635 TTATATTTTTTTTTTTGACAGGG + Intergenic
1066412836 10:35190667-35190689 TAATTTTTTTTTTCTTGAGATGG + Intronic
1066635404 10:37494647-37494669 TAATATTTTTTTTTTAGACAAGG + Intergenic
1067303983 10:45041748-45041770 TAATATTTATTTTCTTTTCCTGG - Intergenic
1068044901 10:51873822-51873844 AAAAATTCTGTTTCTTGGCCGGG - Intronic
1068183491 10:53554203-53554225 TACTATTCTGTTTCTTGATTTGG - Intergenic
1068208524 10:53889987-53890009 TAATGCTCTGTTTCTTGACCTGG + Intronic
1068289401 10:54983378-54983400 TAAAATTTTTTTTCATGACAAGG - Intronic
1068386194 10:56330765-56330787 AAATATTTTATTTTATGACCCGG + Intergenic
1068389077 10:56369747-56369769 TAACATTGTTTTTCTGGACCTGG - Intergenic
1068686970 10:59880548-59880570 TAATATTCTGTTTCGTGATCTGG + Intronic
1069015196 10:63421480-63421502 CAATATTCTAGTTCTTGACCTGG + Intronic
1069326685 10:67239534-67239556 TAATTTTCTATTTCTTGTCCTGG + Intronic
1069357249 10:67601056-67601078 TAATATTCTATTTCTTGACGTGG + Intronic
1069509857 10:69034058-69034080 TAATTTTTTTTTTCTTGAGAAGG - Intergenic
1069760485 10:70807450-70807472 TGACATTCTGTTTCTTGATCTGG + Intergenic
1069996671 10:72346328-72346350 TAATTTTTTTTTTTTTGACACGG + Intronic
1070585141 10:77759351-77759373 TAATGTTATGTTTCTGGCCCAGG + Intergenic
1070851630 10:79567683-79567705 TAGTATTTTTTTTATTGCCCAGG - Intergenic
1071815062 10:89224298-89224320 TAAAATTTTTTTTATTGGCCAGG + Intronic
1071852806 10:89592362-89592384 TAATGTTCTATTTCTTGATCTGG + Intronic
1072036874 10:91570879-91570901 AGATCTTTTGTTTCTTGATCTGG - Intergenic
1072250285 10:93576954-93576976 TAATATTCCATTTCTTGACCTGG - Intronic
1072270881 10:93775171-93775193 TAATATTGAGTTTCTTGACCTGG - Intronic
1072304988 10:94098566-94098588 TAATATTTGGTTTTTGGAACAGG + Intronic
1072420608 10:95288078-95288100 CAATATTCTATTTCTTGACTTGG + Intronic
1072426266 10:95333481-95333503 TATTAATTTGCTTCTTGGCCGGG + Intronic
1072534446 10:96351004-96351026 TAATGTTCTGTTTCTTGATCTGG - Intronic
1072700274 10:97635796-97635818 TAAAATGTAGTTTCTTGGCCAGG + Intronic
1072972201 10:100027101-100027123 TAATTTTTTTTTTTTTGACATGG - Intergenic
1073110065 10:101057146-101057168 CAATGTTCTGTTTCTTGACCTGG + Intergenic
1073390591 10:103173320-103173342 TAATAATTTCATTCTTGGCCAGG + Intronic
1073640387 10:105246759-105246781 TTAAACTTTGTATCTTGACCTGG - Intronic
1074148409 10:110737502-110737524 TAGTGTTCTGTTTCTTGATCTGG - Intronic
1074269388 10:111938239-111938261 TAATATTTTACTTCTTAAGCTGG - Intergenic
1074470234 10:113720252-113720274 TCATATTTTGTTTCTTGGTGTGG - Intronic
1074606808 10:114979915-114979937 TGATGTTCTGTTTCTTGACTTGG - Intergenic
1074894954 10:117768073-117768095 AAATATTTTATATCTTAACCTGG - Intergenic
1075419906 10:122293000-122293022 GAATATTTTGTTTCATCTCCTGG + Intronic
1075581526 10:123622284-123622306 TAATATTTTATTTTTTGAAAAGG - Intergenic
1075678717 10:124317004-124317026 GAATATTCTGTCTCTTGATCCGG + Intergenic
1075752863 10:124787803-124787825 TAATATTTTACATCTTGACCAGG + Intronic
1075820646 10:125306114-125306136 TATTATTTTCTTTTTTGACAAGG + Intergenic
1076418755 10:130312824-130312846 TGATGTTCTGTCTCTTGACCTGG + Intergenic
1077598349 11:3554159-3554181 TAATGTTCTGTTTCTTGAATTGG - Intergenic
1078561072 11:12373041-12373063 TAATGTTCTGTTTCCTGATCTGG - Intergenic
1078797030 11:14602381-14602403 TTATATTATCTTCCTTGACCTGG + Intronic
1078815865 11:14822280-14822302 TCTTATTTTGTTTCTGGATCTGG - Intronic
1079350458 11:19687468-19687490 TAATGTTCTATGTCTTGACCTGG - Intronic
1079414186 11:20217698-20217720 TAATGTTCTGATTCTTGATCTGG - Intergenic
1080594943 11:33764373-33764395 TAATATTCTACTTCTTGATCTGG + Intronic
1081035684 11:38142691-38142713 TAGTATTTTGTCTCTTTAACAGG - Intergenic
1082216173 11:49572777-49572799 TATTATTTTTTTTCTTGAGACGG + Intergenic
1083054668 11:59808474-59808496 TAATATCCTGTTTGTTGATCTGG - Intronic
1083473181 11:62898005-62898027 TAATTTTTTGTTTTTTGAGACGG - Intergenic
1083830635 11:65230654-65230676 GAATTTTTTTTTTCTTGGCCAGG + Intergenic
1084254429 11:67930023-67930045 TAATGTTCTGTTTCTTGAATTGG - Intergenic
1084818439 11:71665860-71665882 TAATGTTCTGTTTCTTGAATTGG + Intergenic
1084878295 11:72150408-72150430 TAAGAATCTGTTTCTTGGCCGGG - Intergenic
1085105779 11:73841659-73841681 TAATGTTCTGTTTCTTGTCTAGG + Intronic
1086077145 11:82866724-82866746 TAATTTTTTTTTTTTTGAGCCGG + Intronic
1086288659 11:85279137-85279159 CAATATTCTAGTTCTTGACCTGG - Intronic
1086395012 11:86406509-86406531 AAATATTTTCATTCTTGGCCTGG + Intronic
1086824640 11:91481317-91481339 TAACATTCTGTTTCTTCATCTGG + Intergenic
1086843211 11:91715237-91715259 TAATATTCTCTTTTTTGTCCAGG - Intergenic
1087256665 11:95963733-95963755 TAGTGTTCTGTTTCTTAACCTGG - Intergenic
1087329092 11:96756718-96756740 TAATGTTTTATTTTTTGATCTGG + Intergenic
1087430890 11:98053545-98053567 TAATATTTTCTTTCTTCATATGG + Intergenic
1087693820 11:101352939-101352961 TAAAATTTTGTTTCCTGAATTGG - Intergenic
1087708063 11:101517911-101517933 CAATATGTTGTTTATTGAACTGG - Intronic
1087747346 11:101964335-101964357 TAATATTGTGATTTTTGGCCAGG + Intronic
1087878171 11:103383417-103383439 TAATGTTTTGCTTCTTGATTTGG + Intronic
1088029536 11:105229567-105229589 TAATTTTTTTTTTATTTACCAGG + Intergenic
1088234778 11:107711149-107711171 CAATGATCTGTTTCTTGACCTGG + Intronic
1088383541 11:109223252-109223274 AAATATTTTGCTTCTTGAGAAGG - Intergenic
1089134593 11:116239050-116239072 TAATCTTTTGTTTCTTCAAGTGG - Intergenic
1089427006 11:118386118-118386140 TAGTTTTTTGTTTCTTGGCCTGG + Intronic
1090144434 11:124305579-124305601 TAATATTCTATATCTTTACCTGG + Intergenic
1090156575 11:124444282-124444304 GCATATTTAGTTTCTTGTCCTGG - Intergenic
1090231313 11:125107227-125107249 TAAAATTCTGTTTCTTGATCTGG + Intronic
1090566240 11:127995136-127995158 CAATGGTTTGTTTCTTGAGCTGG - Intergenic
1090988137 11:131791516-131791538 TGATGTTATGTTGCTTGACCTGG - Intronic
1091210782 11:133856753-133856775 TAATAATTTGATTTTTGACAAGG - Intergenic
1091527083 12:1313688-1313710 TAAAATTTTTTTTTTTGCCCGGG + Intronic
1091528495 12:1331105-1331127 GAATATTCTGTTTCTTGATTTGG - Intronic
1091619831 12:2078307-2078329 TAAATTTTTGTTTCTTAAGCCGG + Intronic
1091651625 12:2314453-2314475 TAACGTTCTGTGTCTTGACCCGG - Intronic
1091811667 12:3404469-3404491 TAATGTTCTATTTCTTGACCTGG - Intronic
1091944626 12:4526266-4526288 AAATATTCTATTTCTTGATCTGG + Intronic
1092355680 12:7793071-7793093 TGGTCTTCTGTTTCTTGACCGGG - Exonic
1092368336 12:7895598-7895620 TGGTCTTCTGTTTCTTGACCGGG - Intergenic
1092839108 12:12521887-12521909 AAATATTTTTTTTTTTGTCCTGG - Intronic
1093091137 12:14921719-14921741 CAATATTCTATTTCTTGACTTGG - Intronic
1093381910 12:18503259-18503281 TAATCTTTTTTTTCTCTACCAGG + Exonic
1093429109 12:19064027-19064049 GAAGATTTTATTTCTTGATCTGG + Intergenic
1093546357 12:20353665-20353687 GAAGATTTTATTTCTTGATCTGG + Intergenic
1093704950 12:22264424-22264446 TATTATTTTGTTTGTTTAGCTGG - Intronic
1093803869 12:23408751-23408773 TAATATTTTATTTCTCAAGCTGG + Intergenic
1093980553 12:25470887-25470909 TAATGTTTTGTTTCTTAAGCCGG - Intronic
1094132889 12:27094005-27094027 AAATCTTTAGTTTCTTGATCAGG + Intergenic
1094262374 12:28515836-28515858 TAATATTCTGCTTCTTGGCCTGG - Intronic
1094345747 12:29466644-29466666 CAGTATTTTGTTTCTTGATCTGG + Intronic
1095164616 12:38957127-38957149 TAATATTTTTTTTTTTGAGTTGG + Intergenic
1095271834 12:40227552-40227574 CAATATTTTATTTCTGTACCTGG + Intronic
1095503744 12:42869578-42869600 TAATATTCTATTGCTTCACCTGG - Intergenic
1095693926 12:45122448-45122470 TAACCTTTTGTTTCTTGTGCTGG + Intergenic
1096546776 12:52345555-52345577 TATTATTTTGTTTTTTGAAACGG - Intergenic
1097407226 12:59204031-59204053 TAATATTTTGTCTTTAGAACAGG - Intergenic
1097972863 12:65652919-65652941 TAATATCCTTTTTCTTGTCCAGG - Intergenic
1098141217 12:67451809-67451831 TAATATTCTGCTTCTTTACTGGG - Intergenic
1098387783 12:69936796-69936818 TAATATTGAGTTCCTTGCCCAGG + Intronic
1098482268 12:70977566-70977588 TAATATAGTTTTTCTTTACCTGG - Intergenic
1098493005 12:71104139-71104161 TAATGTTCTGTTTTTTGATCTGG + Intronic
1098578768 12:72074105-72074127 TAATATTTTGTTTCTCTAGTGGG + Intronic
1099337082 12:81376411-81376433 TACTATTTTTTTTTTTGGCCTGG - Intronic
1099396065 12:82141051-82141073 TAATGTTTTATTTCTTGAATTGG + Intergenic
1099638804 12:85255784-85255806 TGATATTTTGTTCCTGAACCCGG + Intronic
1100170883 12:91973822-91973844 TAATATTTTATTTCTAAGCCTGG - Intergenic
1100328071 12:93559660-93559682 TATTATTTTTTTTCTTGAGACGG - Intergenic
1100554242 12:95676407-95676429 GAATATTTTTTTTTTTTACCCGG - Intronic
1100714135 12:97288327-97288349 TAATATTCTTTTTCTTAACCTGG + Intergenic
1100763681 12:97838764-97838786 TAATGTTCTGTTTTTTCACCTGG - Intergenic
1100832501 12:98529568-98529590 TATTATTTTTTTTTTTGACAAGG + Intronic
1101078506 12:101156480-101156502 TAATTTTCTGTTTATTGCCCTGG - Exonic
1101232250 12:102753424-102753446 TAATATTCTATTTCTTAACCTGG + Intergenic
1101713138 12:107287273-107287295 AAAGATTTTCTTTCTTGGCCAGG - Intergenic
1101973631 12:109335685-109335707 TAATATTCAGTCTCTTCACCAGG + Intergenic
1102170359 12:110837756-110837778 AGATATTCTGTTTCTTGATCTGG - Intergenic
1102431483 12:112887517-112887539 GAATGTTTTATATCTTGACCTGG + Intronic
1102443280 12:112979715-112979737 GAATGTTTTGTTTCTGGATCTGG - Intronic
1102679052 12:114678133-114678155 TAATTTTTTTTTTCTTTGCCTGG + Intronic
1102819599 12:115896433-115896455 TGATGTTCTCTTTCTTGACCTGG - Intergenic
1103269767 12:119663448-119663470 GAAAATTCTGTTTCTTGACCTGG - Intergenic
1104007438 12:124903645-124903667 TAATTTTTTTTTTTTTGACACGG - Intergenic
1104020894 12:124991580-124991602 TAATGTTTCGTTTCTTGATTTGG + Intergenic
1105296806 13:19094862-19094884 TATTGTTTTATTTCTTGATCTGG + Intergenic
1105553347 13:21419764-21419786 TAATGTTCTGTTTCTTGAATTGG + Intronic
1105628112 13:22133664-22133686 TAATATTTTATTTCTTTAAAGGG + Intergenic
1106697462 13:32192104-32192126 TAATATTCTGGTTTTTGACCTGG + Intronic
1106728093 13:32506978-32507000 TAATATCGTATTTCCTGACCTGG + Intronic
1106744574 13:32686485-32686507 TAATGTTTGGTTTCTTGAGCTGG + Intronic
1106826668 13:33529908-33529930 TAATATGTGGTTTCTTATCCGGG - Intergenic
1106973335 13:35173214-35173236 TAATGTTTTATTTCTTCAGCTGG + Intronic
1107785286 13:43949816-43949838 AAATATTTTGTATCTTGAACTGG - Intergenic
1107902423 13:45030677-45030699 TAAAAATTTGTGTCTTGGCCAGG - Intronic
1108023064 13:46149217-46149239 TATTATTTTGTTTCTACAACTGG + Intronic
1108077070 13:46692275-46692297 TAAAGTTCTGTTTCTTGAACTGG - Intronic
1108240937 13:48463262-48463284 CAATGTTTTGTTTCTTGATCTGG - Intronic
1108719221 13:53113289-53113311 TAATTTTCTATTTCTTTACCTGG - Intergenic
1108774089 13:53742868-53742890 TAAAAAGTTATTTCTTGACCAGG + Intergenic
1108990042 13:56643805-56643827 TAATTTTTTTTTTCTTCTCCAGG + Intergenic
1109231103 13:59758521-59758543 TTAAATTCTGTTTCTTGATCTGG + Intronic
1109533540 13:63685539-63685561 GAATAATTTGTTTCTTGGCAGGG - Intergenic
1110323361 13:74185550-74185572 TAGAATTCTGTTACTTGACCAGG + Intergenic
1110373922 13:74770483-74770505 TAAAAGTTTATTTCTTGCCCAGG + Intergenic
1110590645 13:77253623-77253645 TAATATGTGGTTTCTTAATCTGG + Intronic
1110674473 13:78224355-78224377 TGGTAATCTGTTTCTTGACCTGG + Intergenic
1110849924 13:80233139-80233161 TAATATATTGGTTCTTGGTCGGG - Intergenic
1110932927 13:81245887-81245909 TAACATTTTATTTCTTGACCCGG - Intergenic
1111368064 13:87276404-87276426 TAGTATTCTGTTTCTTGTCCTGG + Intergenic
1111492729 13:89004048-89004070 TAAAATTTTGTTTATAGACATGG + Intergenic
1111553899 13:89854595-89854617 TAATATTATAATTCATGACCTGG + Intergenic
1111586347 13:90288713-90288735 TAAGATTTTGTTGTTGGACCGGG + Intergenic
1111862852 13:93730030-93730052 TAATATTCTGCTTCTTGCCCTGG + Intronic
1112090173 13:96074880-96074902 TAATATTTTATTTCTTGAGCTGG + Intergenic
1112197067 13:97236426-97236448 TAATATTTTATTTCTTCATCTGG + Intronic
1112831199 13:103453889-103453911 TATGATTTTGTTTCTTTATCTGG - Intergenic
1114200185 14:20512849-20512871 TAATCTTTTGTCTCTTTCCCCGG - Intergenic
1114235335 14:20818833-20818855 TAATATGTAATTTCTTAACCTGG + Intergenic
1114429286 14:22646470-22646492 TACCATTCTGTTTCTTCACCAGG - Intergenic
1115381293 14:32743022-32743044 TAATATTTGCTTTATTGATCTGG + Intronic
1115396428 14:32914200-32914222 TAATATTCTGTTTCTTGATTTGG - Intergenic
1115598036 14:34928060-34928082 TGATTTTCTGTTTCTTGAGCTGG + Intergenic
1115612906 14:35065995-35066017 TAATACTTTGTTTCTAGGCAGGG - Intronic
1115927806 14:38456572-38456594 CAATGTTCTGTTTCTTGATCTGG - Intergenic
1115962999 14:38856803-38856825 CAATATTCTATTTCTTGACTGGG - Intergenic
1116269202 14:42739581-42739603 TAATAATTTATTTTTTCACCAGG - Intergenic
1116353327 14:43895300-43895322 TATTATTTTGTTACATAACCAGG - Intergenic
1116359723 14:43978306-43978328 TATTATTTATTTCCTTGACCTGG + Intergenic
1116439438 14:44935337-44935359 TCATACTCTGTTTCTTGAACTGG + Intronic
1116481936 14:45401594-45401616 TGATATTTGGTTCCTCGACCAGG - Intergenic
1116528896 14:45942390-45942412 TAATATTCCATTTCTTGACCTGG - Intergenic
1116857774 14:49968402-49968424 TAATATTTTATTTATTGACTTGG - Intergenic
1117138584 14:52763323-52763345 TATTATTTTTTTTCTTCATCTGG + Intronic
1117284554 14:54274237-54274259 TAATATGTTGTTTGTTGATATGG - Intergenic
1117378802 14:55139451-55139473 AAATATTTTCTTTCTAGTCCTGG - Intronic
1117579638 14:57139298-57139320 TCACATTCTCTTTCTTGACCTGG - Intergenic
1117582897 14:57170700-57170722 CAATATTCTATTTCTTGGCCTGG + Intergenic
1117808957 14:59525079-59525101 TAATGCTTTGTTTCTTGATGTGG + Intronic
1117852277 14:59987106-59987128 CAAAATTTTCTTTCTTGATCTGG - Intronic
1117916028 14:60678873-60678895 AGATATTTTGTTTCTAGACAGGG - Intergenic
1117929617 14:60826688-60826710 TACAACTTTGTTTCTTGGCCAGG + Intronic
1118028450 14:61795037-61795059 TGATATTTTGTGTATTGAACAGG + Exonic
1118438952 14:65795654-65795676 TAATTTTTTTTTTTTTGACAGGG - Intergenic
1118457022 14:65953915-65953937 TCATGTCTTGTTTCTTGATCTGG - Intergenic
1118660514 14:68004699-68004721 TAATTTTTTGTTTCTTCATCTGG - Intronic
1118696312 14:68389214-68389236 TAATGTTATGTTTCTTAATCTGG - Intronic
1119342886 14:73895658-73895680 TAATATTGTGTTTTATGAGCTGG - Intronic
1119445464 14:74659663-74659685 CAATGTTTTATTTCTTGACCTGG + Intronic
1119632440 14:76244896-76244918 TAATGTTCTATTTCTTGATCTGG - Intronic
1119887720 14:78157405-78157427 TAATATATTATTTCTAGACCTGG - Intergenic
1119982285 14:79095554-79095576 TACTATTTTTTTTTTTTACCAGG + Intronic
1120048505 14:79837040-79837062 TGATAATTTGTTTCTTGAAGTGG - Intronic
1120342320 14:83237264-83237286 TAATAAGATGTTTCTGGACCGGG + Intergenic
1120378114 14:83735221-83735243 TAATGTTCTGTTTCTTGATGAGG - Intergenic
1120425746 14:84345736-84345758 TAATATTTTGTTGCTCTACTTGG + Intergenic
1120653718 14:87164706-87164728 TAATATTTTGTTTTTTGACATGG + Intergenic
1120831159 14:88998873-88998895 AAATGTTCTCTTTCTTGACCTGG + Intergenic
1120936464 14:89900391-89900413 GAATATTTTGTTTCGTAACCTGG + Intronic
1121200565 14:92113821-92113843 TTATATTTTATTTTTTGACACGG + Intergenic
1121238301 14:92409579-92409601 TAATATTTTGTTTCTTGACCTGG - Intronic
1121371669 14:93364195-93364217 TAATGTTCTGTTTCTTGCTCTGG - Intronic
1121468455 14:94131694-94131716 TAATTTTTTTTTTCTTGAGATGG + Intergenic
1122485965 14:102080052-102080074 TAATATTCTCTTGCTAGACCTGG + Intergenic
1123907546 15:24935504-24935526 GAATGTTTTGTTTCTTGAGTGGG + Intronic
1123913191 15:24990962-24990984 TAATATTTTTTTTCTTGCTATGG + Intergenic
1123978942 15:25581004-25581026 TTCACTTTTGTTTCTTGACCAGG - Intergenic
1124710216 15:32003474-32003496 CAAAGTTCTGTTTCTTGACCTGG + Intergenic
1125032285 15:35084816-35084838 TGGTCTTCTGTTTCTTGACCGGG + Intergenic
1125148487 15:36502730-36502752 TTATTTTTTGTTTCTTTTCCTGG + Intergenic
1125632750 15:41160858-41160880 TAATGTTTTATTTCTTGAACTGG + Intergenic
1126045798 15:44638652-44638674 TGATGTTTTATTTCTTCACCTGG + Intronic
1126121689 15:45258434-45258456 TAATGTTTTGGTTCTTCATCTGG - Intronic
1126628995 15:50714644-50714666 AAAAATTTTTTTTCTTGGCCGGG + Intronic
1126905803 15:53363456-53363478 TAATCTTCTGTTTCTTAAACAGG + Intergenic
1127022546 15:54764887-54764909 TAATATTTTGTTTATATATCTGG - Intergenic
1127439975 15:58996574-58996596 TAATTTTTTTTTTCTTGAGATGG - Intronic
1127544668 15:59980165-59980187 TAATTTTTTTTTTTTTGACAGGG + Intergenic
1127594354 15:60463956-60463978 CATTATTTTATTTCTTGACCTGG + Intronic
1127680602 15:61293143-61293165 TAATATTTTATGTCTTAAGCTGG + Intergenic
1127832214 15:62760905-62760927 TAACATTCTGTTTCTTAATCTGG - Intronic
1127937544 15:63656659-63656681 CAATGTTCTGTTTCTTGATCTGG - Intronic
1127955011 15:63845836-63845858 AGATATTCTATTTCTTGACCTGG - Intergenic
1128613596 15:69092637-69092659 TAAAATTCTGTTTCCTGATCTGG + Intergenic
1128713435 15:69889121-69889143 TAATCTTTTATTTCATGTCCTGG - Intergenic
1128949157 15:71857430-71857452 TAATATTCTGTTTCTTAATCTGG - Intronic
1129648226 15:77458260-77458282 AAATATTTATTTTCTTGACTTGG - Intronic
1130009603 15:80140448-80140470 TAATTTTTTGTTGCTTGAATGGG - Intergenic
1130212663 15:81939525-81939547 TAATATTTTATTTATTAATCTGG + Intergenic
1130292424 15:82614306-82614328 TAATATTCTATTTCTTGACCTGG + Intronic
1133373756 16:5266501-5266523 TAATGTTCTGTTTCTTGAACTGG + Intergenic
1133888627 16:9856179-9856201 AAATATTATGTTTCTTGCTCAGG + Intronic
1134111927 16:11520745-11520767 TTATATTTTGTTTCTTGCTCTGG + Intronic
1134380225 16:13717576-13717598 CCATATTCTGTTTCTTCACCTGG - Intergenic
1135196534 16:20399457-20399479 TAATACTTTGCTTCTTCTCCAGG - Intronic
1135300026 16:21318734-21318756 TAATTTTTTTTTTCTTGAGACGG + Intergenic
1135530577 16:23249594-23249616 TGATATTCTCTTTCTTGATCTGG - Intergenic
1135555332 16:23431512-23431534 GAATAATTTTTTTCTTGGCCGGG + Intronic
1136143994 16:28304912-28304934 TAATTTTTTTTTTCTTGAGACGG + Intronic
1136460249 16:30406190-30406212 TAATTTTTTTTTTCTTGAGACGG + Intergenic
1136467761 16:30456803-30456825 TAAGACTTTGTTCCTTGGCCGGG - Intergenic
1137325813 16:47435454-47435476 TATAATTTTGTTTCTTGTGCGGG - Intronic
1137994473 16:53195159-53195181 TAATATCTTATTTCTTGGTCTGG - Intronic
1137996389 16:53219066-53219088 TAATGCCTTGTTTCTTGATCTGG + Intronic
1138052570 16:53795602-53795624 TTACATTTTGCTTCTTGGCCAGG - Intronic
1138148218 16:54631283-54631305 TAATATTTTATTTCTTAAGGTGG + Intergenic
1138426406 16:56935589-56935611 TAATATTTTGTTTCTTTCCTAGG + Intronic
1138603129 16:58069411-58069433 TCATGTTCTGTTTCTTGATCTGG + Intergenic
1138779019 16:59760168-59760190 TAATGTTCTGTTTCTTGCTCTGG + Intergenic
1139243028 16:65413385-65413407 TCATATTTAGTTTTTTGACTAGG + Intergenic
1140073348 16:71672732-71672754 TAATGTTCTGTTTCTTGATCCGG - Intronic
1140986217 16:80160244-80160266 CCACATTTTCTTTCTTGACCTGG + Intergenic
1141187930 16:81801683-81801705 TAATTTTTTTTTTCTTGAGGTGG + Intronic
1141223502 16:82093159-82093181 TAATGTTTTATTTTTTGATCTGG - Intronic
1141984060 16:87568294-87568316 TAATGCTCTATTTCTTGACCTGG - Intergenic
1142545581 17:699983-700005 AAATGTTTTATTTCTTGATCTGG + Intronic
1142744903 17:1951258-1951280 TAATATTTTTTTTTTTGAGACGG - Intronic
1142786577 17:2228840-2228862 CAATATTCTATTTCTTAACCTGG + Intronic
1142947322 17:3442047-3442069 CAATGTTCTGTTTCTTAACCTGG + Intronic
1143145959 17:4775690-4775712 TAATGATCTGTTTCTTGACCTGG - Intronic
1143398160 17:6619320-6619342 TAATATTCTATTCCTTGACCTGG + Intronic
1143423381 17:6813722-6813744 TAATGTTTTCTTTCTTGACCTGG + Intronic
1143424682 17:6825577-6825599 TTATATTCTGTTTCTTGAGCTGG - Intronic
1143694549 17:8602271-8602293 TAAGATTCTGTTTCTTGGCCGGG - Intronic
1144424513 17:15129334-15129356 TAATATTGAGTTTCTAAACCTGG + Intergenic
1144533841 17:16067714-16067736 TAAGATTTTATTTCTTGATCTGG + Intronic
1145958988 17:28874942-28874964 GAATGTCCTGTTTCTTGACCTGG - Intergenic
1146090418 17:29872312-29872334 TACTATTTTGATTCTTGAATGGG - Intronic
1146234676 17:31147177-31147199 TATTGTTTTATTTCTTGATCTGG - Intronic
1146358710 17:32157140-32157162 TAATACTTTATTTCTTAAGCTGG - Intronic
1146476398 17:33166177-33166199 TAATCTTTTATTTCTTCATCTGG + Intronic
1147356047 17:39897682-39897704 CAATATTTTATTTCTTCACCTGG - Intergenic
1147474204 17:40694608-40694630 TAGTATTTTGTTCCTTGAGGAGG + Intergenic
1147799374 17:43072405-43072427 TAATATTTTTTTTTTTGAGAAGG + Intronic
1147930859 17:43979997-43980019 TAATGTTCTGTTTCTTAAGCTGG - Intronic
1148039343 17:44694082-44694104 TAATATTTTGTATAATGGCCAGG + Intergenic
1148270966 17:46261414-46261436 TAATTTTTTTTTTCTTGAGATGG + Intergenic
1148418688 17:47528294-47528316 TAATAATTTTTTTTTTGAGCTGG - Intronic
1148825508 17:50390485-50390507 TAATTTTTTTTTTTTTGACATGG - Intronic
1149275831 17:55034674-55034696 TAATATTATGTTTCTTGATCTGG - Intronic
1150063282 17:62087304-62087326 TAATGTTGTGTTTCTTGATCTGG + Intergenic
1150360046 17:64524171-64524193 TAATACTCTGTTTCTTGACCTGG + Intronic
1150371137 17:64639093-64639115 CAATGTTCTGTTTCTTGATCTGG + Intronic
1150634023 17:66899992-66900014 GACTATTATGTTTCTTGACGTGG + Intergenic
1150693466 17:67384253-67384275 TATTATTTTCTTTTTTGCCCTGG + Intronic
1150754602 17:67899979-67900001 TAAAGTTCTGTTTCTTAACCTGG + Intronic
1150787912 17:68177652-68177674 TAATGTTCTATTTCTTGATCTGG - Intergenic
1150902861 17:69301043-69301065 TAAGATTTTTTTTCCTAACCAGG - Intronic
1151282353 17:73086185-73086207 TACTGTTTTGTTTCTTGATCTGG + Intronic
1151565852 17:74897728-74897750 AAATGTTTTGTTTCTTAAACTGG + Intergenic
1151609466 17:75162611-75162633 TAATATTTGTTTTCTTGGCCGGG - Intronic
1152027361 17:77819763-77819785 TAACGTTCTGTTTCTTGATCTGG + Intergenic
1152262841 17:79276388-79276410 AAAAATAATGTTTCTTGACCAGG + Intronic
1153026108 18:674521-674543 TAATTTTTTTTTTTTTGACATGG + Intronic
1153063862 18:1022758-1022780 TAATGTTCTGTTTCTTGATCTGG + Intergenic
1153737643 18:8088470-8088492 TAATATTCTGTTTCTTGATTTGG - Intronic
1153756043 18:8284325-8284347 TAATATCTGGTTTCTTGAACTGG + Intronic
1154153270 18:11924235-11924257 AAATATTTTCTTTCTTGGCCAGG - Intergenic
1154352421 18:13595784-13595806 AATTATTTTGTTTCATGGCCTGG + Intronic
1155051880 18:22155516-22155538 TAATGTTTTATTTCTTAAGCTGG + Intergenic
1155451834 18:25971581-25971603 TATTATTTTGTTTTTTGAGATGG - Intergenic
1155702432 18:28763819-28763841 TCATATTTTGTTACTAAACCTGG + Intergenic
1155974527 18:32114480-32114502 AAAAATGTTCTTTCTTGACCTGG - Intronic
1156541452 18:37915705-37915727 TAATATTTTGTTCCTTCAGTTGG - Intergenic
1156922590 18:42540973-42540995 TGATATTTTGTTTCCTGATCTGG + Intergenic
1156955091 18:42952799-42952821 TAATATTTTATTTCTAAAGCTGG - Intronic
1157006007 18:43585778-43585800 TCATTTTTTTTTTCTTGAGCTGG + Intergenic
1157206718 18:45707040-45707062 TAAAATTTTGTTCCCTGGCCAGG + Intergenic
1157587275 18:48811965-48811987 TACTATTTTGTTTTTTGAGATGG + Intronic
1158064605 18:53391109-53391131 TATTTATTTGTTTCTTGCCCAGG + Intronic
1158420897 18:57292872-57292894 TGGTATTCTGTTTCTTGATCTGG + Intergenic
1158637314 18:59171898-59171920 TAATATTTGTTTTCTGTACCTGG - Intergenic
1158813155 18:61061076-61061098 TAAACTTTTGATTCTTGATCTGG - Intergenic
1159419863 18:68204346-68204368 TAATATTTGGTTTATTGAAAGGG - Intergenic
1159549381 18:69878815-69878837 TTTGCTTTTGTTTCTTGACCAGG - Intronic
1160032583 18:75275653-75275675 TAATATTGGGTTTGTAGACCCGG + Intronic
1161150650 19:2706670-2706692 TAATGTTTCTTTTTTTGACCAGG - Intergenic
1161783539 19:6309515-6309537 TATTATTTTTTTTCTTGAGACGG - Intronic
1162216800 19:9141334-9141356 TAATAATCTCTTTCTTGGCCTGG - Intronic
1162579875 19:11522545-11522567 TAATTTTTTTTTTTTTTACCGGG - Intronic
1163092588 19:15031181-15031203 TAAAGTAGTGTTTCTTGACCAGG + Intergenic
1164847452 19:31446128-31446150 AATTTTTTTATTTCTTGACCTGG + Intergenic
1165874199 19:38994190-38994212 TGATTTTTTTTTTCTTGAGCTGG - Intronic
1165986709 19:39775975-39775997 AAATATTCTGTTTCTGGATCTGG + Intergenic
1166397760 19:42454562-42454584 TAATGTTCTTTTTCTGGACCAGG - Intergenic
1166402207 19:42490984-42491006 TAAGATTTTTTTTTTTGGCCAGG - Intergenic
1166785823 19:45366145-45366167 TAATATTTTATTTTTTGAGACGG + Intronic
1167480796 19:49729740-49729762 TATTATTTTTTTTCTAGACAGGG + Intergenic
1167827228 19:51985076-51985098 CCATATTCTATTTCTTGACCTGG + Intronic
1168441415 19:56370942-56370964 TAATATTCAGTTTCTTGATCGGG + Intergenic
925794545 2:7527993-7528015 TTCTATTTTATTTCTTGAGCTGG - Intergenic
925843109 2:8010898-8010920 CAATATTTTGTTTCTTCAGCTGG - Intergenic
926089212 2:10039271-10039293 TAATATTCTGTTTCTAAATCTGG + Intergenic
926821878 2:16860707-16860729 AAATATTTCATATCTTGACCAGG + Intergenic
927042409 2:19242643-19242665 TATTATTTTTTTTCGTGCCCTGG - Intergenic
927548076 2:23972526-23972548 ATAAATTTTGTTTCTTGACCGGG + Intronic
927608316 2:24509847-24509869 TAATATTTTATCTCTTTAGCTGG + Intronic
928340154 2:30435801-30435823 TAATTTTTTTTTTTTTGACACGG - Intergenic
928346776 2:30505626-30505648 TAATACTCTGTTTCTTTAACTGG - Intronic
928525248 2:32133342-32133364 TAACAATTTATTTCTTGACCTGG - Intronic
928589427 2:32798698-32798720 TATTATTTTTTTTTTTGAGCTGG - Intronic
929253610 2:39785587-39785609 TAAAATTATTTTTCTTAACCTGG - Intergenic
929732326 2:44509089-44509111 TAATTTTTTTTTTTTTGACATGG - Intronic
929841399 2:45467989-45468011 TAATATCTTATTTCTTAAACTGG - Intronic
929901816 2:46011223-46011245 TAGTATTTTGCTTCTTGAGAAGG + Intronic
930639094 2:53837163-53837185 TAGTATTTTTTTTTTTGACAGGG + Intergenic
930680383 2:54251506-54251528 TGATGTTTTGTGTCTTGATCTGG - Intronic
930733594 2:54752397-54752419 TAATGTTCTATTTCTTGATCTGG - Intronic
930854215 2:55995000-55995022 TAATGTTCCCTTTCTTGACCTGG - Intergenic
931061009 2:58529974-58529996 TAATGTTCTGTTTCTTGATCTGG + Intergenic
931166929 2:59758374-59758396 TAATTCTTTCTTTCTTCACCTGG + Intergenic
931324291 2:61202289-61202311 CAATATTTTATTTCTTGATCTGG + Intronic
931477006 2:62598513-62598535 TAATTTTTTTTTTCTTGAGATGG + Intergenic
931518135 2:63064753-63064775 TAATATTCTATTTCTTGACGTGG - Intergenic
931554605 2:63488567-63488589 TGATATTTTATTTGTTGTCCTGG + Intronic
931573467 2:63695729-63695751 TAACATTTTGGGTTTTGACCTGG - Intronic
931688286 2:64813386-64813408 CAATATTCTGTTTCTTGACCTGG + Intergenic
931807337 2:65819825-65819847 TAAGATTTTATTTCTTGCTCTGG - Intergenic
931959507 2:67466431-67466453 TAATTTTTTTTTTCTTGAGATGG - Intergenic
931960598 2:67478133-67478155 TTTTATTTTGTTTTTTAACCTGG - Intergenic
931968714 2:67562328-67562350 TAATGTTCTGTTTTGTGACCTGG + Intergenic
931995581 2:67836390-67836412 TCATGTTCTATTTCTTGACCTGG + Intergenic
932072333 2:68633938-68633960 AAATATTCTGTTTTTTGATCTGG - Intergenic
932093276 2:68825402-68825424 TAATGTTTTGTATCTTCAACCGG - Intronic
932187097 2:69707382-69707404 CAATTTTGTATTTCTTGACCTGG - Intronic
932452795 2:71826147-71826169 TAATGTTCTGTTTCTTGAGATGG + Intergenic
932538308 2:72623036-72623058 TAATATTCGGTATCTTGATCTGG + Intronic
932650810 2:73554225-73554247 TAATTTTTTTTTTTTTGTCCTGG - Intronic
932953394 2:76320645-76320667 AAATGTTCTGTATCTTGACCGGG - Intergenic
933174667 2:79161770-79161792 AAATATTATATTTCTTGAGCTGG + Intergenic
933180798 2:79224681-79224703 TAATATTCTGTATCTTGACAAGG - Intronic
933434422 2:82228490-82228512 TAATTTTTTTTTTCTTGACACGG + Intergenic
933446460 2:82386277-82386299 TAATATTGTGTTTCAACACCAGG - Intergenic
933641443 2:84765302-84765324 TAATGTTTTATTTCTTAAGCTGG + Intronic
933650823 2:84848865-84848887 TAATATATAGTTTCAGGACCAGG - Intronic
933717781 2:85374344-85374366 TAATTTTTTTTTTCTTGAGATGG + Intronic
934770567 2:96905139-96905161 TCATGTTTCATTTCTTGACCTGG + Intronic
934909986 2:98243336-98243358 TAATTTTTTTTTTCTTGAGATGG + Intronic
935320414 2:101882584-101882606 AAGTATTTTATTTCTTAACCAGG - Exonic
935756035 2:106276656-106276678 TAATTTTTTGTATTTTTACCAGG - Intergenic
936855745 2:116955380-116955402 TAGTATTATGTTTCTTCACTTGG + Intergenic
937540317 2:122942661-122942683 TAATATAATGTGTCTTGACATGG - Intergenic
937630574 2:124097019-124097041 TACTATTTTCTTTGTTGAACTGG + Intronic
937659527 2:124414641-124414663 TAAAGATTTGTTTCATGACCTGG - Intronic
937730984 2:125228891-125228913 TAAAATTCTGTTTCTTGATATGG - Intergenic
938021301 2:127907881-127907903 TAATGTTCTGTTTCTTGATCTGG + Intergenic
938033963 2:128020260-128020282 TAATGTTTTCTATCTTGAGCTGG - Intronic
938402982 2:131008451-131008473 TAATGTTCTATTTCTTGATCTGG - Intronic
938554207 2:132409153-132409175 CAATATTCTATTTCTTAACCAGG - Intergenic
939064033 2:137460801-137460823 TGATATGTTACTTCTTGACCTGG - Intronic
939226533 2:139371637-139371659 AAATATTTTGTTTTTAGACATGG + Intergenic
939245005 2:139612252-139612274 TAGAATTTTGTATATTGACCTGG + Intergenic
939514243 2:143146523-143146545 TAATATTGTGTTTCTTGGTTTGG + Intronic
939551248 2:143618648-143618670 GAAGATTTTCTTTCTTGACTTGG + Intronic
939695546 2:145319210-145319232 TTTTATTTATTTTCTTGACCTGG - Intergenic
940097687 2:149996378-149996400 TAATATTCTGTTTCTTGATTTGG + Intergenic
940152971 2:150623306-150623328 TAAAATTTTCTTTCTTGGCTGGG + Intergenic
940560889 2:155295254-155295276 TAATATTATGTTTCTAAACCTGG + Intergenic
940932757 2:159454222-159454244 TAATAATTTGAGTATTGACCTGG - Intronic
941970790 2:171348686-171348708 TAATATTCTGTTTCTTGATATGG + Intronic
942069348 2:172301782-172301804 TACTCTTTTATTTCTTGAACAGG - Intergenic
942237058 2:173921008-173921030 TAATATCCTATTTCTTGATCTGG + Intronic
942571161 2:177315781-177315803 TAATGTTCTGTTTCTTGATCTGG + Intronic
942590588 2:177542037-177542059 TAATATTTTTTTTCTTCAAAGGG + Exonic
942784116 2:179680531-179680553 TAATGTTCTATTTCTTGACCTGG + Intronic
943002778 2:182349997-182350019 TAATATTTTCTTTCTTAATCTGG - Intronic
943209641 2:184947110-184947132 TAATGTTTTTGTTCCTGACCTGG + Intergenic
943668377 2:190634213-190634235 TAATGTTTTGTTTCTTAATATGG - Intergenic
944186961 2:196959606-196959628 GAATATTTTTTTTCATGAACAGG - Intergenic
944190764 2:197001031-197001053 TTATATTTTGTTTTTTGAGACGG - Intronic
944243399 2:197507643-197507665 TAATTTTTTATTTTTTGACAGGG + Intronic
944423344 2:199554575-199554597 TAACATTTTGTTCCTTGACTTGG + Intergenic
944518927 2:200543941-200543963 TAATATTCTGTTTCTTGTTCTGG - Intronic
944522177 2:200583080-200583102 TAATATTTTGTTTCTTAACCTGG + Intronic
944846105 2:203669529-203669551 TAATACTCTCTTTCTTGATCTGG - Intergenic
944854209 2:203750916-203750938 CAATATTCAGTTTCTTGAACTGG + Intergenic
945634092 2:212324986-212325008 TAATATTTTACTTATTGGCCTGG - Intronic
945722950 2:213441530-213441552 TAATGTTCTATTTTTTGACCTGG + Intronic
948129070 2:235586931-235586953 TAATATTCTGCCTCTTGATCTGG - Intronic
948631613 2:239306549-239306571 TTATGTTTTGTATCATGACCGGG - Intronic
1169281453 20:4270763-4270785 AAATATTCTGTTTCTTGATTTGG - Intergenic
1169591766 20:7150796-7150818 TAATATTTCCTTTTTTGGCCAGG - Intergenic
1169725090 20:8719695-8719717 TTATATTTTGTTTCTTGATCTGG + Intronic
1169861040 20:10152733-10152755 TGATATTCTATTTCTTAACCTGG + Intergenic
1170071754 20:12376656-12376678 TAATATTCAGTTTCTTGACTGGG - Intergenic
1170222947 20:13960786-13960808 TAATATTTTCTTCCTGTACCCGG - Intronic
1170328172 20:15179171-15179193 AAATATTTTGTATCTTGCCTAGG + Intronic
1170386760 20:15827381-15827403 GAATATTTTGTTTCTTTAACAGG - Intronic
1170525434 20:17231405-17231427 TAATATTTTATTTCTTGATTTGG - Intronic
1170934693 20:20799450-20799472 TAATATGTTGTTGCTTGTACTGG - Intergenic
1172102297 20:32492460-32492482 TGATGTTTTGTTTCTTGATCTGG + Intronic
1172403671 20:34671623-34671645 TAAAAATTTATTTCTTGGCCGGG + Intronic
1172453344 20:35045543-35045565 TAATATTTTTTTTTTTGAGATGG + Intronic
1172729296 20:37072171-37072193 AAAAATTTTGTTTTTTGGCCGGG + Intronic
1172984529 20:38973408-38973430 TAATGTTCTGCTTCTTGATCTGG - Intronic
1173030637 20:39356393-39356415 CTATATTTTGTTTCTTGATCTGG + Intergenic
1173098702 20:40063386-40063408 TTTTATTTTGTTTTTTGACAGGG + Intergenic
1173125712 20:40334188-40334210 TAATTTTTTCTTTCTTTATCTGG + Intergenic
1173446214 20:43120947-43120969 TAGCATGTTATTTCTTGACCTGG - Intronic
1173487209 20:43449878-43449900 TCACATTTTGTTTCTTGAGCTGG - Intergenic
1173668380 20:44779345-44779367 TAATGTTCTGCTTCTTGATCTGG - Intronic
1173678371 20:44857983-44858005 TAATAATGTGTTTCTGGACATGG + Intergenic
1173812489 20:45964597-45964619 TAATGTTCTGCTTCTTGACTGGG + Intronic
1174476130 20:50796835-50796857 TAATTTTTTTTTTTTTGACAGGG + Intronic
1174595742 20:51682026-51682048 TAATATCCTGTTTCTTGATCTGG + Intronic
1174637406 20:52013632-52013654 TAAAATTTTTATTCTTGGCCAGG + Intergenic
1175194209 20:57231059-57231081 TAATGTTCTGTCTCTTGACCTGG - Intronic
1175536199 20:59715792-59715814 TAACATTTTTTTTCTTAACTTGG - Intronic
1175649411 20:60705143-60705165 TAATTTTTTTTTTTTTGACTGGG + Intergenic
1175750351 20:61492767-61492789 TAATATTTTGATTCTGTACATGG - Intronic
1177309604 21:19372447-19372469 TAATTTTTTGTTTCTTTGACAGG + Intergenic
1177560136 21:22740272-22740294 GAACATTCTGTTTCTTGACTAGG + Intergenic
1177629830 21:23711979-23712001 TAATTTTTTGTTTTTTGAGATGG - Intergenic
1177930466 21:27276722-27276744 TCATATTTTCTTTCTTGAGGAGG - Intergenic
1178543525 21:33475227-33475249 AAACATTTTGTTTCTTAATCTGG + Intronic
1178607342 21:34050926-34050948 TAATATTTTATTTCTTGAATAGG + Intergenic
1178614784 21:34122805-34122827 GAAAATGCTGTTTCTTGACCTGG - Intronic
1181258793 22:21582527-21582549 TAGTTTTTTGTTTTTTGAGCCGG + Intronic
1182210333 22:28671338-28671360 AAATATTTTCTTCCTTGGCCGGG + Intronic
1182243027 22:28932305-28932327 TAAGATTTTTTTTTTTAACCTGG - Intronic
1182382124 22:29899802-29899824 TAATGTTCTGTGTCTTGATCTGG + Intronic
1182841815 22:33397031-33397053 TGATATTCTGTTTCTTGGTCTGG - Intronic
1183495087 22:38138672-38138694 TAGTATTTTTTTTCTTGAGATGG + Intronic
1183549815 22:38475471-38475493 TAATTTTTTTTTTCTTGAGACGG - Intronic
1183679785 22:39321115-39321137 TAATTTTTTTTTTTTTGAGCTGG - Intergenic
1183905926 22:41040114-41040136 TTTTTTTTTTTTTCTTGACCTGG - Intergenic
1184316902 22:43701037-43701059 TCATATTTTGTTGATTTACCAGG - Intronic
1184934458 22:47710555-47710577 TAATATTCCATTTCATGACCTGG - Intergenic
949221621 3:1641244-1641266 CAATTTTTTATTTCTTGACTTGG - Intergenic
949375245 3:3381878-3381900 TAACATTTTGTTTCTTGATCTGG + Intergenic
950078435 3:10204185-10204207 TAATGGTCTGTTTCTTGTCCAGG - Intronic
950150045 3:10679921-10679943 TAATGTTTTCTTTCTTAAGCTGG + Intronic
950232181 3:11285574-11285596 AAATATTCTGTATCTTGAGCTGG - Intronic
950752099 3:15137688-15137710 TAATGTTCTGTTTCTTGAATTGG + Intergenic
951107618 3:18763389-18763411 TAATGTTCTGTTACTTGATCTGG + Intergenic
951976241 3:28513002-28513024 AAATGTTTTGCTTCTTGATCTGG - Intronic
952312989 3:32207174-32207196 AAATGTTTTGGTTCTTGACTTGG + Intergenic
952690522 3:36199867-36199889 CAATATTCTGTTTCTTGATCTGG + Intergenic
952746463 3:36786497-36786519 TAATATTCCGTTTCTTGGTCTGG + Intergenic
952762915 3:36931241-36931263 TAATATTTTGTTTTTTGGGGGGG - Intronic
952894635 3:38069969-38069991 TAATGTTTTATTTCTTAAGCTGG + Intronic
953314051 3:41909254-41909276 TAATTTTTTTTTTCTTGAGATGG - Intronic
953522765 3:43658910-43658932 GAATAGTCTATTTCTTGACCTGG + Intronic
954731170 3:52663507-52663529 AAATGATTTGTTTCTTGTCCAGG - Intronic
954815360 3:53276305-53276327 TAATATTTTTTTTTTTGAGATGG + Intergenic
955615467 3:60802460-60802482 TAATATTTTGGGTCTTGCCAGGG - Intronic
955640841 3:61082182-61082204 TAATATTATATTTCTTGATTTGG - Intronic
955646443 3:61142965-61142987 TAAAATTGTGTTTCTTTACCAGG + Intronic
955773656 3:62411335-62411357 TAACATTTTGTTTGTTGGCAAGG + Intronic
955813336 3:62815480-62815502 TAACATTCTGTTCCTTGATCTGG + Intronic
956712994 3:72054663-72054685 AAATATTTTCTTTCTTGGCAAGG - Intergenic
957068508 3:75546597-75546619 CAATATTTTGTTTCTTGAATTGG - Intergenic
957137043 3:76301976-76301998 TTCTATTTTGTTTCTTCATCAGG - Intronic
957404602 3:79761469-79761491 TAATCTTTTATTACTTAACCTGG + Intronic
958010048 3:87865407-87865429 TAATATTCTATTTCCTGATCTGG - Intergenic
958059432 3:88460681-88460703 TAATATTCTGTTTCCTGATCTGG - Intergenic
958075440 3:88670704-88670726 TAATATTTTATTTTTTGATTTGG + Intergenic
958584168 3:96064660-96064682 TATTATCTTGTTTATTTACCTGG - Intergenic
959270134 3:104196687-104196709 TTAAATTTTGTGTTTTGACCTGG - Intergenic
959850908 3:111085513-111085535 TAATGTTTTATTTTTTGACCAGG - Intronic
960296206 3:115947561-115947583 TAATGTTTTATTTCTTGACATGG + Intronic
960629887 3:119719336-119719358 TAATATTCTATTCCTTGATCTGG + Intronic
960694189 3:120379933-120379955 TAATATTCTGTTTCTTGATCTGG + Intergenic
961016067 3:123469309-123469331 TCATGTTCTGTTTCTTGATCTGG + Intergenic
961860352 3:129912353-129912375 AAATGTTTTGTGTCTTGATCTGG + Intergenic
961926367 3:130485897-130485919 TAATGTTTTATTTCTTAAGCTGG + Intergenic
961937022 3:130595414-130595436 TAATGTTCTATTTCTTTACCTGG - Intronic
962003535 3:131325500-131325522 TAATGTTTTATTTCTTAAACTGG + Intronic
962222570 3:133575582-133575604 TAATACTCAGTTTCTTGACCTGG - Intronic
962231913 3:133673723-133673745 TAACGTTTTGTTTCTTGATGTGG + Intergenic
962430564 3:135315158-135315180 TAATGTTATGCTTCTTGATCTGG + Intergenic
963192881 3:142492940-142492962 TAATATTCTATTTCTTGATGTGG + Intronic
963255578 3:143141393-143141415 TAATATCTTTTTTCTGGTCCAGG + Intergenic
963295879 3:143545942-143545964 TAATATTCTTTTACTTGACATGG - Intronic
963397756 3:144755498-144755520 TAATGTTTCATTTCTTGACCTGG + Intergenic
963398358 3:144762764-144762786 TTTTATATTGTTTCTTCACCTGG - Intergenic
963732708 3:148988040-148988062 CAATATTTCATTTCTTGGCCAGG - Intergenic
963750348 3:149171672-149171694 TAACATTTTGTTACCTGAACTGG + Intronic
964022069 3:152024410-152024432 TAATATTTTCTTTATATACCTGG - Intergenic
965360466 3:167733956-167733978 TAAAAAGTTGTTTCTTGAACCGG - Intronic
965448878 3:168811883-168811905 TAATATTATGTACCTTGATCTGG + Intergenic
965591367 3:170362951-170362973 AAATATTTAGTTTCTTGATCGGG + Intronic
966328615 3:178785648-178785670 TACAATTCTGTTTCTTGACTTGG + Intronic
966374371 3:179280497-179280519 AGCTATTTTGTTACTTGACCAGG - Intergenic
966514858 3:180808111-180808133 TAAGATCTTGTTTCTTGGCTTGG - Intronic
966598247 3:181747258-181747280 TAGTATTTTGTTCCTAGATCTGG + Intergenic
966905437 3:184520857-184520879 CAATATTTTATTTCTCTACCTGG + Intronic
966990781 3:185227820-185227842 TAATAATTTCTTTCTTGAGATGG - Intronic
967116163 3:186341022-186341044 TGATAGTTTAGTTCTTGACCTGG - Intronic
967269044 3:187717932-187717954 TAACATTTTGTTTCTTACCTTGG + Intronic
967629321 3:191725475-191725497 TAATAAATTATTTCTTCACCAGG + Intergenic
967654963 3:192036358-192036380 GAATATTTTATTTCTTAACAGGG - Intergenic
968807007 4:2780452-2780474 TATTATTTTTTTTCTTGAGACGG - Intergenic
969012850 4:4081148-4081170 TAATATTTTGTTTCTTGAATTGG - Intergenic
969741009 4:9026619-9026641 TAATATTTTGTTTCTTGAATTGG + Intergenic
969800349 4:9559490-9559512 TAATATTTTGTTTCTTGAATTGG + Intergenic
970062334 4:12049366-12049388 TAATATATTTTTTCTTGCACAGG - Intergenic
970130805 4:12868387-12868409 TAAAGTTTTATTTCTTAACCTGG - Intergenic
970189291 4:13496169-13496191 TAACATTCTATTTCTTGACTTGG + Intergenic
970339575 4:15091133-15091155 CAATATTTTATTTTGTGACCTGG - Intergenic
971002268 4:22336956-22336978 TAATATTTTATTTCTGTAGCAGG + Intergenic
971232411 4:24810402-24810424 TAATATTTTGTTTCTCATCCTGG - Intronic
971492269 4:27225722-27225744 AAAAATATTGTTTCTTGGCCGGG + Intergenic
971988136 4:33854423-33854445 TAATATTTTTATTCTTCACAGGG - Intergenic
972167142 4:36301042-36301064 TAATATTTTGTTTCTCTAACTGG - Intronic
972305261 4:37824708-37824730 GACTGTTCTGTTTCTTGACCTGG - Intergenic
972433202 4:39004468-39004490 TAATATTCTGTTTCTTAATCTGG - Intronic
972434377 4:39017940-39017962 TAATTTTTTGTCTTTTTACCTGG + Intronic
973222453 4:47744247-47744269 TAATATTCTATTCCTTGATCTGG + Intronic
973243283 4:47982004-47982026 TCCTATTTTATTTCTTGACTAGG - Intronic
973588455 4:52415555-52415577 TACTGTTCTTTTTCTTGACCAGG - Intergenic
973612777 4:52652820-52652842 TAGTATTTTATTTCTTCACTGGG + Intronic
973677092 4:53275488-53275510 TAATACTTTGTTTCTTTATCAGG + Intronic
974046802 4:56905310-56905332 TATTATTTTTTTTTTTGACATGG - Intergenic
974131762 4:57765285-57765307 TAAGATTCTGTCTCTTGTCCTGG + Intergenic
974210253 4:58763813-58763835 AAATATTTTGTCTCTAGACCAGG + Intergenic
974243605 4:59284394-59284416 TAATATTTTGTTTTGAGACAGGG + Intergenic
974560528 4:63510874-63510896 TAATTTTTTTTTTCTTGAGATGG - Intergenic
974755305 4:66198181-66198203 AAATATTTTATTTATTGATCAGG - Intergenic
974811243 4:66949009-66949031 TAATGTTCTGTTTCTTGATCTGG - Intergenic
975051305 4:69867961-69867983 TAATTTTTTTTCACTTGACCTGG - Intergenic
975386096 4:73762128-73762150 TAATGTTCTGTTTCTTGATATGG + Intergenic
975515987 4:75248918-75248940 TGGTGTTTTGTTTCCTGACCAGG + Intergenic
975540696 4:75507955-75507977 GAATGTTGTGTTTCTTGATCTGG + Intronic
975713384 4:77182374-77182396 TAACATATTGTTTATTTACCAGG - Intronic
975785399 4:77882264-77882286 TATTACGTTGTTTCTTTACCTGG + Intronic
976251947 4:83061294-83061316 CAATATTTTGTTTCTTGTTCTGG - Intronic
976333943 4:83864079-83864101 AAATATTTTGTTTCAGGAGCTGG + Intergenic
976554811 4:86438145-86438167 TAATATTCTAATTCTTGATCTGG + Intronic
976683424 4:87783859-87783881 TGATTTTTTTTTTCTTGACTAGG - Intergenic
976733431 4:88286425-88286447 TAATGTTTTGTTCCTTGATCTGG - Intergenic
976917613 4:90397371-90397393 AAATATTTTATTTTTTGAACAGG - Intronic
976967984 4:91068885-91068907 TAAAATTTTGATTTTTGGCCAGG + Intronic
977122574 4:93121272-93121294 TTATGTTCTGTTTCTTGATCTGG - Intronic
977196394 4:94066326-94066348 TAATATTTTATTTCTAGTCTTGG - Intergenic
977298970 4:95245642-95245664 TAAGATTTTATTTTTTAACCAGG - Intronic
977342754 4:95780091-95780113 CAATATTATCTTTCTTAACCTGG + Intergenic
977513230 4:97988609-97988631 TTATATTTTGTTTTTTGATATGG + Intronic
978091068 4:104715685-104715707 GAATATGTTGTTTCTAGTCCTGG + Intergenic
978738444 4:112110651-112110673 TAATATTCTGTGTCTTGGTCTGG + Intergenic
978738516 4:112111724-112111746 TAATATTCTGTATCTTGATCTGG - Intergenic
978946105 4:114498841-114498863 TGATATTCTGCTTCTTGATCAGG - Intergenic
979069849 4:116188189-116188211 GAATATTCTTTTTCTTGATCTGG + Intergenic
979579500 4:122340101-122340123 TAAAATATTGGTTCTTAACCAGG + Intronic
979893243 4:126126917-126126939 CAATATTCTGCTTCTTGACCTGG - Intergenic
980205331 4:129712188-129712210 TAATATCTTTTTTCTTCCCCTGG - Intergenic
980674643 4:136060294-136060316 TAATGTTTATTTTTTTGACCCGG - Intergenic
980764302 4:137279568-137279590 TAACATTTTTTTTCTTTTCCGGG - Intergenic
981112342 4:140949990-140950012 TGATATATTATTTCTTGACATGG - Intronic
981455239 4:144945884-144945906 TAATTTTTTTTTTCTTGAGATGG + Intergenic
981807426 4:148732845-148732867 GATTATGTTGTTTCCTGACCTGG - Intergenic
982157822 4:152538696-152538718 AAATATTCCATTTCTTGACCTGG - Intergenic
982589296 4:157284522-157284544 TAATGTTTTATGTCTTGAACTGG - Intronic
983034437 4:162845376-162845398 CAATGTTCTGTTTCTTGAGCTGG - Intergenic
983225254 4:165080500-165080522 TAACATTTTATTTCTTGAATAGG - Intronic
983587704 4:169373872-169373894 CAACATTTTGTTTCTTAAGCTGG + Intergenic
983846316 4:172523926-172523948 TAATATCCCATTTCTTGACCTGG - Intronic
984028926 4:174579289-174579311 TAATGTTTCATTTCTTGACTTGG + Intergenic
984223658 4:177008029-177008051 TGTTATTTTCTTTCCTGACCAGG + Intergenic
985143376 4:186866273-186866295 TAATTTTTTTTTTCTTGAGATGG + Intergenic
985234087 4:187853582-187853604 TCATAATTTCTTTCTTGAGCAGG - Intergenic
985340876 4:188952559-188952581 TAATGTTTTATTTCTTGACCTGG + Intergenic
985847431 5:2360991-2361013 TAATCTTTTATTTTTTGATCAGG + Intergenic
986712191 5:10496058-10496080 TAATATTCTGTTCCTTGATCTGG - Intergenic
987634423 5:20521229-20521251 AAATGTTTTATTTCTTGACTAGG + Intronic
987805188 5:22755955-22755977 TATAATTTTATTTATTGACCTGG + Intronic
987880071 5:23732129-23732151 TAATATTCTACTTCTTGATCTGG + Intergenic
987968819 5:24914784-24914806 TAACATTTTGTTTTATTACCAGG - Intergenic
988232381 5:28496754-28496776 TACTAGTCAGTTTCTTGACCAGG - Intergenic
988239324 5:28589270-28589292 TAATTTTTTCTTCCTTGAGCTGG + Intergenic
988634086 5:32962734-32962756 TAGTATTCTGTTTCTTGATCTGG + Intergenic
989007562 5:36831511-36831533 TAATATTTTTTTTTTTGAGATGG - Intergenic
989146344 5:38254159-38254181 TATTGTTTTATTTCTTGATCTGG + Intergenic
989228529 5:39059411-39059433 CAATATTATGTTTCTTGATCTGG + Intronic
990407175 5:55503478-55503500 TAAAATGTTGTTTCTTGGCTGGG + Intronic
990929327 5:61070174-61070196 TAAAATTTTGATGCTTGAGCAGG + Intronic
990931902 5:61101227-61101249 CAAAGTTGTGTTTCTTGACCTGG - Intronic
991150774 5:63366132-63366154 TAATAATTTGTTTCTTACCTTGG - Intergenic
991273062 5:64809038-64809060 CAATTTTTTGTTTCTTGATCTGG - Intronic
991273503 5:64815244-64815266 TAATATTTGTTTTCTTGCTCTGG + Intronic
991293092 5:65051625-65051647 TAATGTTCTGTTTCTTATCCTGG - Intergenic
991713405 5:69430070-69430092 TAATTTTTTATTTTTTGGCCAGG + Intronic
991722513 5:69506990-69507012 AAGTGTTCTGTTTCTTGACCTGG - Intronic
992252613 5:74890401-74890423 TCATATTTTCTTTCTTGAGACGG + Intergenic
992351883 5:75938687-75938709 TAATATTCTGTTTCTTGATCTGG + Intergenic
992367556 5:76108720-76108742 TTATCTTTTGCTGCTTGACCTGG + Intronic
992462709 5:76976855-76976877 TACTATTTTTTTTCTTGAAATGG + Intronic
992526973 5:77621117-77621139 TTTTTTTTTTTTTCTTGACCTGG - Intergenic
992828564 5:80572018-80572040 TAATGTTCTGCTTCTTGATCTGG - Intergenic
992831797 5:80600041-80600063 TAATATTTTTTTTTTTGAGAGGG - Intergenic
992983881 5:82206741-82206763 AAATGTTCTGTTTCTTGACTGGG - Intronic
993054142 5:82961700-82961722 TGATATTTTGTTTCTTGATCTGG + Intergenic
993322130 5:86484482-86484504 TAATATTTTATTTCTTGTTCTGG + Intergenic
993615611 5:90108023-90108045 GAAAATTTTGTTTCTTGAATGGG - Intergenic
993898329 5:93565564-93565586 TAATATTTTATTTCTCGAACTGG + Intergenic
994076961 5:95663401-95663423 TAATGTTTTGTTTCTTGACCTGG + Intronic
994677218 5:102839106-102839128 TAATGTTCTATTTCTTGACCTGG - Intronic
995458561 5:112378006-112378028 TCTTATTTTGTTTTTGGACCTGG - Intronic
995503659 5:112835866-112835888 TAATATTATGATTATTGGCCGGG - Intronic
996048141 5:118899623-118899645 TTATATTTTGCTTCTTGACTTGG - Intronic
996077446 5:119213634-119213656 TAATGTTTTATTTCTTAAGCTGG - Intronic
996357117 5:122607717-122607739 TTATATTTTATTTGTTTACCTGG - Intergenic
996687460 5:126299382-126299404 TAATATTCTGTTTCTAGATCTGG - Intergenic
997185913 5:131881735-131881757 AAATATTTTGTATCTTGATCTGG - Intronic
997868553 5:137486668-137486690 GAATATTTTGTTTCTTTGCATGG - Intronic
998086606 5:139331084-139331106 TAAAACTTTGTTTCTTGGCCAGG - Exonic
998346918 5:141472533-141472555 TAATTTTTTTTTTCTTGAGATGG - Intronic
998361239 5:141589700-141589722 TGATATTCTGTATCTTGACATGG + Intronic
998577979 5:143337957-143337979 CAATATTCTATTTCTTGCCCTGG + Intronic
998649031 5:144096886-144096908 CAATGTTTTATTTCTTGATCTGG - Intergenic
998725298 5:145005987-145006009 CAATATTTTATTTCCTAACCTGG + Intergenic
998925208 5:147115719-147115741 TAATGTTCTGTATCTTGACAGGG - Intergenic
999055328 5:148569154-148569176 TAATATTTTATATCTTAAGCTGG + Intronic
999130537 5:149279785-149279807 GAATATTTTGTGCCTTCACCTGG + Intronic
999332009 5:150680323-150680345 AAAAATTCTGTTTCTAGACCTGG + Intergenic
999555121 5:152732563-152732585 TAATTTTCTGTTTCTTGATCAGG - Intergenic
999992120 5:157059378-157059400 TAAAAATTCATTTCTTGACCGGG + Intergenic
1000025490 5:157355349-157355371 TATTATTTTGTTTGATGACTTGG - Intronic
1000213215 5:159129395-159129417 TACTATTCTGTTTTTTGACTTGG + Intergenic
1000550906 5:162663088-162663110 ACATTTTTTGTTTCTAGACCAGG + Intergenic
1001075569 5:168625211-168625233 TAATGTTCTCTTTCTTGACATGG + Intergenic
1001347233 5:170915392-170915414 CAATATTTTCTTTGTTGCCCTGG - Intronic
1002241311 5:177843510-177843532 TATTATTTTTTTTTTTGACGTGG + Intergenic
1002392335 5:178924894-178924916 CAATGTTCTGTTTCTTGATCTGG - Intronic
1002536210 5:179877212-179877234 TAATATTTTTTTTTTAGACATGG - Intronic
1002539870 5:179899486-179899508 TAATTTTTTGTTTTTTTACCAGG - Intronic
1002788624 6:423109-423131 CAATGTTTTGTATCATGACCTGG - Intergenic
1003310745 6:4967921-4967943 TAATATTCTCTTTCTTGATTTGG + Intergenic
1003311207 6:4971293-4971315 TAATATTCTCTTTCTTGATTCGG + Intergenic
1003601490 6:7521472-7521494 TAATGTTTTGTTTCTTGACCTGG - Intergenic
1003701629 6:8472379-8472401 CTATATTTTATGTCTTGACCCGG - Intergenic
1003762987 6:9202474-9202496 AAATATTTTGTATTTTGACGTGG + Intergenic
1004093266 6:12526933-12526955 TAATATTTTGGATCTTGACAGGG - Intergenic
1004196265 6:13508419-13508441 TAATGTTCCATTTCTTGACCCGG - Intergenic
1004277288 6:14249489-14249511 CAATATTTTTTATCTTGACTGGG + Intergenic
1004578831 6:16927150-16927172 CAATGTTCTTTTTCTTGACCTGG + Intergenic
1004592242 6:17063851-17063873 AAATATTTTATATCTTGATCTGG + Intergenic
1004675296 6:17836157-17836179 AAAGATTTTGTTTCTTGTCAGGG + Intronic
1004865609 6:19851147-19851169 TAATCTTTTTTTATTTGACCTGG - Intergenic
1005139586 6:22612874-22612896 TGGTATTTTGATTCTTCACCTGG - Intergenic
1005199896 6:23332878-23332900 CAATATTTTGATTCTAGAGCAGG + Intergenic
1005369475 6:25115919-25115941 TAATATTTTATGTCTTAAGCTGG + Intergenic
1005444805 6:25911158-25911180 AAATATTTTATTTCTTGACTTGG - Intergenic
1005677922 6:28174904-28174926 GAAAATATTATTTCTTGACCTGG - Intergenic
1006172582 6:32103029-32103051 AAATATTTTGTATCTTAATCTGG + Intronic
1006862764 6:37184046-37184068 TAATATTCTGTTTTTTGAGCTGG - Intergenic
1006902208 6:37510523-37510545 TAATGTTTTCTTTCTTAAGCTGG + Intergenic
1006925137 6:37649868-37649890 TAATTTTTTTTTTGTTCACCGGG + Intronic
1006949090 6:37806668-37806690 TAATATTGTATTTCTTGACCTGG - Intergenic
1007034395 6:38659983-38660005 TCATGTTCTATTTCTTGACCTGG - Intergenic
1007299851 6:40858884-40858906 TAATATTTTATTTCTTAAGTTGG - Intergenic
1007497628 6:42271453-42271475 CAATATTTTATTTCTAGACCTGG + Intronic
1007523491 6:42470231-42470253 TAATATTTTTTTTTTTGAGATGG - Intergenic
1007796586 6:44353550-44353572 TAACGTTTTGTTTCTTGACCAGG + Intronic
1007959998 6:45949997-45950019 TAATAGTTTGTTTATTTTCCTGG - Intronic
1008120559 6:47611437-47611459 TAATATTTTATTTCTTTACTTGG + Intronic
1008125303 6:47661258-47661280 TTACAATTTGTTTCTTGAGCAGG - Intronic
1008177349 6:48285331-48285353 TAATATTTTCTTTCTATATCTGG + Intergenic
1008274803 6:49530465-49530487 TAATATTCTGATTCTTGACTTGG + Intergenic
1008285860 6:49649275-49649297 ACATATTGTGTTTCTTGAACTGG + Intergenic
1008460917 6:51770531-51770553 AAATATTTTGTTTCTGTAACTGG + Intronic
1008545979 6:52583772-52583794 TAATATCTTTTTTCTTTTCCAGG - Intergenic
1008583504 6:52927999-52928021 TAAAATATTGTTTCTTTAACTGG + Intergenic
1008819853 6:55618214-55618236 TAATGTTCTATTGCTTGACCTGG + Intergenic
1009310389 6:62143966-62143988 TTATATTTTGTTTTTTCAACTGG - Intronic
1009800968 6:68535651-68535673 TATTTTTTTGTTTCTTGAGATGG - Intergenic
1010025885 6:71216144-71216166 TAATATTTTGTTTCTTAATATGG + Intergenic
1010138958 6:72590444-72590466 TAATATTGTGTTTCTTAAACTGG - Intergenic
1010238528 6:73595618-73595640 TAATATTCTGTTTCTTGATTGGG + Intronic
1010820073 6:80404500-80404522 TAATACTTTGTTTTTTGAAAAGG - Intergenic
1010850240 6:80766446-80766468 TAATATTCTGTTTCTTGATCAGG - Intergenic
1010977934 6:82337625-82337647 TAATATTTTCTTTCCACACCTGG + Intergenic
1011176975 6:84574282-84574304 TAATGTCCTGTTTCTTGACCTGG + Intergenic
1011932752 6:92734981-92735003 TAATTTTTTTTTTCTTAAACTGG - Intergenic
1011960166 6:93078916-93078938 TAATATTCTTTTTCTCCACCTGG + Intergenic
1011996939 6:93602191-93602213 TTATACTTTGTTTCTTGAAAAGG + Intergenic
1012050625 6:94338540-94338562 TTATCTTTTGATTCTTTACCTGG - Intergenic
1012370288 6:98497151-98497173 TTATTTTTTGTTTTTTGACAGGG + Intergenic
1012803418 6:103864846-103864868 TAATGTTCTATTTCTTGACCTGG + Intergenic
1012846644 6:104397656-104397678 TAAAATTTTGTTTTTCGGCCAGG - Intergenic
1013434863 6:110093393-110093415 CAATATTCTATTTATTGACCTGG + Intergenic
1013490266 6:110640019-110640041 TACTATTTTGTGTTTTGCCCAGG - Intronic
1013527942 6:110992304-110992326 AAATATTTTTTTTTTTGAGCCGG - Intronic
1013624783 6:111926366-111926388 TAAGCTTTTGTTTCCTTACCTGG - Intergenic
1014038899 6:116800600-116800622 TCATTTTTTGTTTCCTGATCTGG + Exonic
1014392966 6:120886988-120887010 TAATTTCTTCTTTCTTAACCTGG - Intergenic
1014461159 6:121697421-121697443 CAATAGTTTGGTTCCTGACCAGG + Intergenic
1014509087 6:122298449-122298471 TAAGATTTGATTTCTAGACCAGG + Intergenic
1014589146 6:123241857-123241879 TAATTTTTTTTTTCTTGAATAGG - Intronic
1014669055 6:124277073-124277095 TAAAATTTTGTTCCTTCAGCAGG - Intronic
1014861419 6:126471816-126471838 TAATGTTCTGTTGCTTGATCTGG + Intergenic
1015301497 6:131657769-131657791 TAATATTCTGTTTCTTCATCTGG + Intronic
1015780506 6:136860833-136860855 GAACATTCTGTTTCTTCACCTGG - Intronic
1016120123 6:140334250-140334272 TAGTCTTTTTTTACTTGACCTGG + Intergenic
1016239735 6:141916181-141916203 TAATATTTTGTTAATTGTTCTGG + Intergenic
1016347832 6:143134180-143134202 TAATATTTTATTTCTTAAGTTGG - Intronic
1016664765 6:146624687-146624709 TATTATTTTGATACTTGACTAGG + Intronic
1016731059 6:147428733-147428755 TAATATTTTGTTTCCTGCATTGG + Intergenic
1016913883 6:149226535-149226557 TAATATTTTCTTCCTTTCCCTGG + Intronic
1017136218 6:151149901-151149923 TAATGTTCTCTTTCTTGACATGG - Intergenic
1017560369 6:155621180-155621202 TAATAATCTGTCTCTTGATCGGG - Intergenic
1019305098 7:330363-330385 TATTTTTTTGTTTTTTGACAGGG - Intergenic
1019792640 7:3026936-3026958 TCATGTTCTGTTTCTTGATCTGG + Intronic
1020041659 7:5007911-5007933 CAATTTTGTATTTCTTGACCTGG - Intronic
1020063776 7:5171957-5171979 TAATATTTTGTATTTCGACTAGG + Intergenic
1020412109 7:7903776-7903798 TAATATTTTATTCCTTAAACTGG - Intronic
1020821521 7:12973999-12974021 CAATGTTCTGTTTCTTAACCTGG - Intergenic
1020950927 7:14676200-14676222 TAATATTTTGTTTCCTGATCAGG + Intronic
1021147311 7:17105095-17105117 TAATAGTCTGTTTCTTCATCTGG - Intergenic
1021401235 7:20212164-20212186 TAATATTTTATTTCTTAAACTGG + Intronic
1021421613 7:20451223-20451245 TAATATTTTGTCTCTGATCCTGG - Intergenic
1021669577 7:23021729-23021751 CAATATTCTTTTTCTTGACCTGG - Intergenic
1021812207 7:24414070-24414092 TGGTATTTTGTTTCTTGTACAGG - Intergenic
1022311764 7:29203169-29203191 TAATATTTTGGATCTAGGCCTGG + Intronic
1022356938 7:29624777-29624799 TTATATTTATTTTCTTGAGCTGG + Intergenic
1022786224 7:33640217-33640239 CATTGTTCTGTTTCTTGACCTGG - Intergenic
1022982410 7:35616887-35616909 TAATATTCTATTTCTTAAACTGG - Intergenic
1023264144 7:38388642-38388664 TAATTTTTTGTTTTTTGAGACGG + Intronic
1023326317 7:39061956-39061978 TAATATTTTGTGTGATGAACTGG - Intronic
1024451241 7:49545760-49545782 GAATTTTTTGTTTCTTGGCATGG - Intergenic
1024918545 7:54531641-54531663 TCATATTCTATTTCTTGACCTGG - Intergenic
1025073249 7:55919788-55919810 TAATGTTCTGTTTCTTGATCTGG - Intronic
1025147765 7:56519587-56519609 AAACATTTTGTTATTTGACCTGG - Intergenic
1026283747 7:68944890-68944912 TAACGTTCTGTTTCTTGATCAGG + Intergenic
1026318631 7:69249728-69249750 AAACATTTTGTTATTTGACCTGG + Intergenic
1026744700 7:73002200-73002222 TAATGTTTCATTTCTTGAGCTGG + Intergenic
1026811328 7:73468633-73468655 TAATATTCTTTCTCTTGATCTGG - Intronic
1026907299 7:74069655-74069677 AAATATTTTATTTTTTGTCCTGG + Intronic
1026922934 7:74169796-74169818 TAATAATTTGTTCCCTGGCCGGG - Intergenic
1027030806 7:74886868-74886890 TAATGTTTCATTTCTTGAGCTGG + Intergenic
1027099038 7:75362890-75362912 TAATGTTTCATTTCTTGAGCTGG - Intergenic
1027217097 7:76190869-76190891 GAATGTTCTGTTTCTTGAGCTGG - Intergenic
1027341326 7:77211128-77211150 TAATGTTTTATTTTTTGACCTGG - Intronic
1027695644 7:81406660-81406682 TTATATTCTATTTCTTGATCTGG - Intergenic
1027956920 7:84891221-84891243 TAAAAATTAGTTTCTTTACCTGG + Intergenic
1028437655 7:90822861-90822883 GAATCTTTAATTTCTTGACCAGG + Intronic
1028493049 7:91434767-91434789 TGATAATTGGTTTCTTGATCTGG + Intergenic
1028598067 7:92568056-92568078 TAAAATTTAGTTTCTGGGCCAGG - Intronic
1028927593 7:96376166-96376188 TAATATTATATTTCTTAAGCTGG + Intergenic
1029071499 7:97902775-97902797 TAATATTTTGTTTCTTGAATTGG - Intergenic
1029376904 7:100183601-100183623 TAATGTTTCATTTCTTGAGCTGG - Intronic
1029400138 7:100339676-100339698 TAATGTTTCATTTCTTGAGCTGG - Intronic
1030425066 7:109366069-109366091 TAATATTTTGTTTATAAATCGGG + Intergenic
1030863947 7:114675046-114675068 TAATATTTTGTTTCTCCACTTGG - Intronic
1031055693 7:116990965-116990987 TAATGTTCTGTTTCTTGATCTGG - Intronic
1031307648 7:120152008-120152030 TAATATTTTATTTCTTAAGCTGG + Intergenic
1031743379 7:125463740-125463762 TCATATTCTATTTCTTGATCTGG - Intergenic
1031932109 7:127695818-127695840 TATTTTTTTGTTTTTTGACCAGG - Intronic
1032173220 7:129602832-129602854 TAATTTTTTTTTTCTTGAGATGG - Intergenic
1032226736 7:130038087-130038109 AAATATTTTGTTCTTTGGCCAGG - Intronic
1032234197 7:130105733-130105755 CTGTATTCTGTTTCTTGACCTGG + Intronic
1032234202 7:130105803-130105825 CAGTATTGTGTTTCTTGAGCTGG + Intronic
1032256418 7:130300627-130300649 TAAAATTTTATTTCTTGGCTGGG - Intronic
1032679573 7:134168060-134168082 GAATATTTGTTTTCTTGGCCAGG + Intronic
1032689607 7:134270423-134270445 TAATGTTTTGTTTCTTAAAGTGG - Intergenic
1032961891 7:137045044-137045066 ATAAATTTTGTTTCTTGAACGGG + Intergenic
1033063624 7:138130890-138130912 AAATATTTTATCTCTTGATCTGG - Intergenic
1033507077 7:142014535-142014557 TAATATTTTATTTCTTAAGCTGG - Intronic
1033908009 7:146230495-146230517 TAATATTTTCTTTCTTTGCATGG + Intronic
1034058216 7:148058928-148058950 TAATGTTCTGTTTCTTGATGTGG + Intronic
1034231861 7:149536075-149536097 TAATGTTCTATTTCTTGATCTGG + Intergenic
1034669155 7:152844573-152844595 TAAAACTTTGTTTCTTGAAATGG - Intronic
1036079506 8:5539693-5539715 TCTTATTTTCTTTCTTGATCAGG + Intergenic
1036246210 8:7119210-7119232 TAATGTTCTGTTTCTTGAATTGG + Intergenic
1036362903 8:8092269-8092291 GAATATTTTGTTTCTTGAATTGG + Intergenic
1036529411 8:9569346-9569368 TAATGTTCTGATTCTTGAGCAGG - Intronic
1036717721 8:11141902-11141924 TGATGTTTTCTTTCTTGATCTGG + Intronic
1036888057 8:12574804-12574826 TAATATTTTGTTTCTTGAATTGG - Intergenic
1036895659 8:12632919-12632941 GAATATTTTGTTTCTTGAATTGG - Intergenic
1036935335 8:12996800-12996822 TAATGTTCTGTTTCTTGATCTGG - Intronic
1036955077 8:13179313-13179335 TAATGTTTTGTTTCTTGATGCGG + Intronic
1037252010 8:16906495-16906517 GAATATTTTTTTTCTTTACTGGG + Intergenic
1037693455 8:21203762-21203784 TAATGGTTTTTTTCTTGGCCTGG + Intergenic
1038036963 8:23694404-23694426 TAATGTTCTGTTTCATGATCTGG + Intergenic
1038306781 8:26410963-26410985 AAATATTTTTTTTATTGCCCAGG - Exonic
1038431275 8:27502043-27502065 GAATGTTTTATTTCTTGATCTGG - Intronic
1038457738 8:27688850-27688872 CAATATTTTATTTCTTGACCTGG + Intergenic
1039262802 8:35790690-35790712 TAAAATTTAGTTTCTTCAACAGG - Intronic
1039619488 8:38983519-38983541 TAATATTTTTTTTTTTGAGGTGG - Intronic
1039649286 8:39323799-39323821 TAATATTATGGTTTTAGACCGGG + Intergenic
1040028858 8:42806005-42806027 TAATATTTTATTTCTTGGCCAGG - Intergenic
1040096113 8:43444753-43444775 TAGTATTTTCTGTCTTGGCCAGG + Intergenic
1040690255 8:49928751-49928773 TATTATTTTTTTTCTTGCACTGG - Intronic
1041070332 8:54122247-54122269 TAATATTTTATTTCATAAGCTGG + Intergenic
1041438490 8:57867894-57867916 TAATGGTTTCTTTCCTGACCTGG - Intergenic
1041448573 8:57982244-57982266 TAAAACTTTGTTTCCTGACCAGG + Intergenic
1042332661 8:67596712-67596734 TAATGTTCTTTTTCTTGTCCAGG + Intronic
1042534174 8:69842114-69842136 TAGTATTTTGATACTTGTCCAGG - Intergenic
1042668882 8:71237905-71237927 TCATATTTTGTTTCTTCATCTGG - Intronic
1042880333 8:73481080-73481102 TAATGTTCTATTTCTTAACCTGG - Intronic
1043068190 8:75603341-75603363 TAATATTTTATTTCTTAGTCTGG + Intergenic
1044072133 8:87775182-87775204 TAATGCTCTATTTCTTGACCTGG + Intergenic
1044185263 8:89243188-89243210 TAATAATTTATATCTTGGCCAGG - Intergenic
1044255514 8:90055956-90055978 TAATGTTCTGTTTCTTGACCTGG - Intergenic
1044876409 8:96672194-96672216 AAATACTTTGTTCCTTGACAGGG + Intronic
1045082248 8:98639813-98639835 AAATATTTTGGTTCCTGGCCAGG + Intronic
1045582179 8:103493924-103493946 CAACATGTTATTTCTTGACCAGG - Intergenic
1045599661 8:103698227-103698249 TATGATTTTTTTTCTTGACTAGG + Intronic
1045603393 8:103745296-103745318 TAATATTTTGTTTCTTTTTATGG + Intronic
1045793185 8:106010852-106010874 AAATATTTTGTATCTTGATTCGG - Intergenic
1045835573 8:106517140-106517162 TAATGTTTTGTTTCCTGATCTGG - Intronic
1046063135 8:109163197-109163219 TAAAATTCTGTTTCTTGATGTGG + Intergenic
1046450900 8:114387994-114388016 TAATATTTTATGTATTGTCCTGG - Intergenic
1046790598 8:118317659-118317681 TAATGTTCTATTTCTTGATCTGG + Intronic
1046921193 8:119731029-119731051 TTATATATTGTTTATTAACCTGG - Exonic
1047125511 8:121955261-121955283 TAATATCCTATTTCTTGATCTGG - Intergenic
1047303151 8:123632319-123632341 TAATGTCTGGTGTCTTGACCTGG + Intergenic
1047984472 8:130218389-130218411 TAATATTTTATTTATTAAGCTGG - Intronic
1048476612 8:134748157-134748179 TAATGTTCTGTTTCTTGGCCTGG - Intergenic
1048594911 8:135856078-135856100 TAATGCTTTGTTTCTTGATCTGG - Intergenic
1048825985 8:138427205-138427227 TGATATTCTGTTTCTTGATCTGG + Intronic
1050304609 9:4295668-4295690 TAATGCTCTGTTTCTTGATCTGG + Intronic
1050375160 9:4964056-4964078 TAATTTTTTTTTTCTTGAATTGG + Intergenic
1050896850 9:10893646-10893668 TAATACTTTATTTCATGAACTGG + Intergenic
1051119238 9:13733843-13733865 TAAGATTTTGCTTATTGGCCAGG - Intergenic
1051128916 9:13836791-13836813 TAATGTTCTGTATCTTGACAGGG - Intergenic
1051274093 9:15382404-15382426 TCATATTTTGTTCATTGAGCAGG - Intergenic
1051608693 9:18940987-18941009 TAATGTTTTATCTCTTGATCTGG + Intronic
1051999754 9:23264059-23264081 TAAAATTTTGTTGCTGGGCCTGG + Intergenic
1052101513 9:24451967-24451989 TAATATTCTGTTTCCTCATCTGG - Intergenic
1052764601 9:32628291-32628313 TAATGTTTTATTTCTTAAGCTGG - Intergenic
1054829843 9:69611365-69611387 CTATATTTTGTTTGTTGATCTGG - Intronic
1054852062 9:69857527-69857549 TTTTGTTTTGTTTTTTGACCTGG + Intronic
1054945119 9:70787923-70787945 TAATATTCTATTTCTTGATATGG - Intronic
1055195057 9:73580752-73580774 TAATATTTTTTTTCCTGAAATGG - Intergenic
1055304959 9:74919947-74919969 TAATTTTTTTTTTCTTGAGACGG - Intergenic
1055387470 9:75778024-75778046 TAATATTTTCTTTATTTATCTGG - Intergenic
1055951262 9:81732008-81732030 GAATGTTTTGTTTCTTGTTCTGG - Intergenic
1056871603 9:90286800-90286822 TAATATTTTCATTCTTGGCCGGG - Intergenic
1057289921 9:93799086-93799108 TGATATTTTGTTACTGGAGCTGG + Intergenic
1057495617 9:95558535-95558557 TAAAGTTCTGTTTCTTGACAAGG - Intergenic
1057600598 9:96453705-96453727 TTGTATTCTGTTTCTTTACCTGG + Intronic
1057788485 9:98106345-98106367 TAAAAATATGTTTCTTGATCAGG + Intronic
1057838519 9:98466382-98466404 AAATAGTTTTTTTCTTGACCTGG + Intronic
1057928858 9:99176230-99176252 TAGTATTTTGTTTTCTGGCCGGG - Intergenic
1057943798 9:99307143-99307165 CAATATTCTGTTTCTTGATCTGG + Intergenic
1058580636 9:106452783-106452805 TAATATTTTATATCTTTATCTGG - Intergenic
1059184057 9:112249261-112249283 AAATATTTTATTTCTTAACCTGG + Intronic
1059196029 9:112371938-112371960 TCATGTTCTGTTGCTTGACCTGG + Intergenic
1059235351 9:112756120-112756142 TAATATTCTGTATCTTAATCTGG - Intronic
1059336283 9:113570561-113570583 GAATGTTCTATTTCTTGACCTGG - Intronic
1059347311 9:113637889-113637911 TAATGTTCTATATCTTGACCTGG - Intergenic
1059661361 9:116405066-116405088 TAATGTTCTGTTTCTTGATTTGG + Intergenic
1059709152 9:116851350-116851372 CAATATTCTATTTCTTGACATGG + Intronic
1059855241 9:118389330-118389352 TAATTTTCTGTCTCTTGATCTGG - Intergenic
1060129825 9:121085295-121085317 AAATATTCTGTTTCTTTACCTGG + Intronic
1060133286 9:121126582-121126604 TAATGTTTTATTTCTTAAGCTGG - Intronic
1060435870 9:123592568-123592590 TAATATTTTGTTTCAATATCTGG + Intronic
1060459221 9:123833244-123833266 TAATGTTCTATGTCTTGACCTGG + Intronic
1060462983 9:123875946-123875968 TAACATTATATTTCTTAACCTGG + Intronic
1060656972 9:125378644-125378666 TAATATTTTATTTCCTGGCTGGG - Intergenic
1060805811 9:126575651-126575673 TAAAATTCTGTTCCTTGGCCGGG + Intergenic
1061329383 9:129882786-129882808 TAATTTTTTGTTTTTTGAGATGG + Intergenic
1061341676 9:129986783-129986805 TAAAATTTTTTTTCTTGAGACGG - Intronic
1061524525 9:131147873-131147895 TAAAATTCTGTTTCTTGATCTGG - Intronic
1061526297 9:131166646-131166668 CAATATTCTGTTTCTTGACCTGG - Intronic
1185715876 X:2341744-2341766 TAATATTTTATTTCTTATCAGGG - Intronic
1186536344 X:10353090-10353112 TAATGTCTTAATTCTTGACCTGG + Intergenic
1186814012 X:13217568-13217590 TAGTATTTTTTTTCTTGAAGAGG - Intergenic
1186951170 X:14627026-14627048 TAATGTTCTATCTCTTGACCTGG + Intronic
1187025150 X:15427259-15427281 TAATGTTCTGTTTCTTAACCTGG + Intronic
1187087602 X:16057713-16057735 TAATGTTCTATTTCTTGACCTGG - Intergenic
1187170993 X:16851929-16851951 TAATATTAGGTTTCTTGAAGGGG + Intronic
1187199614 X:17122153-17122175 TAATATTCTGTTTCTTGATTTGG - Intronic
1187387023 X:18858239-18858261 TAATATTTTATGTCTTGATCTGG - Intergenic
1187731704 X:22262161-22262183 TAATGTTGGGTTTCTTGATCTGG + Intergenic
1188066593 X:25669009-25669031 AAATGTTTTACTTCTTGACCTGG + Intergenic
1188157833 X:26762887-26762909 TAATGTTTTATTTCTTAAACTGG + Intergenic
1188484325 X:30666516-30666538 AAATATTTTGTATCTTGACTGGG + Intronic
1188508076 X:30905079-30905101 AAATATTCTCTTTCTTGATCTGG - Intronic
1188579751 X:31696533-31696555 TTATATTATGTTTCTTGATTTGG + Intronic
1188621016 X:32223961-32223983 CAATATTCTGTATCTTGACCTGG - Intronic
1188625657 X:32281533-32281555 TAATGTTTTGTTTCTTGATGTGG - Intronic
1188965800 X:36549395-36549417 TCATATTCTGTTTCTTGATGTGG - Intergenic
1189224548 X:39401751-39401773 AAATATTTGCTTTCTTGACATGG - Intergenic
1189263202 X:39692783-39692805 TCATGTTCTGTTTCTTGATCTGG - Intergenic
1189526603 X:41829223-41829245 TCATGTTCTGTTTCTTGATCTGG - Intronic
1189528550 X:41853873-41853895 ATATATTTTGGTTCTTGACTTGG - Intronic
1189585300 X:42454814-42454836 TAATGTTCTGTTTCTTGATCTGG - Intergenic
1189670966 X:43408266-43408288 TGGTCTTCTGTTTCTTGACCAGG + Intergenic
1189899057 X:45687123-45687145 TAAAATTTTGTTTCTTGACCTGG - Intergenic
1190178330 X:48169769-48169791 TAATATTTTGTTACCTGTCTGGG + Intergenic
1190179855 X:48182977-48182999 TAATATTTTGTTACCTGTCTGGG - Intergenic
1190190224 X:48270879-48270901 TAATATTTTGTTACCTGTCTGGG + Intronic
1190197292 X:48330343-48330365 TAATATTTTGTTACCTGTCTGGG + Intergenic
1190205415 X:48398917-48398939 TAATATTTTGTTACCTGTCTGGG - Intergenic
1190386423 X:49886033-49886055 GAATGTTTTGTTTCTTGATCTGG - Intergenic
1190402064 X:50047014-50047036 TAAGATTTTTTTTCTTCTCCTGG - Intronic
1190578155 X:51862412-51862434 TAATGTTCTATTTCTTGTCCTGG - Intronic
1190658958 X:52637355-52637377 TAATATTTTGTTACCTGTCTGGG + Intergenic
1190665553 X:52693145-52693167 TAATATTTTGTTACCTGTCTGGG - Intronic
1190673869 X:52765273-52765295 TAATATTTTGTTACCTGTCTGGG + Intronic
1190677345 X:52793582-52793604 TAATATTTTGTTACCTGTCTGGG + Intergenic
1190772825 X:53529263-53529285 TGATGTTTTGTTTCTTAAGCTGG - Intergenic
1191084733 X:56552528-56552550 GAATATTCTGTTTCTTCATCTGG + Intergenic
1191883587 X:65866045-65866067 TATTGTTTTATTTCTTGACCTGG + Intergenic
1191894427 X:65976727-65976749 AAATATTCTATATCTTGACCTGG + Intergenic
1191991953 X:67047601-67047623 TAATATTTTGTCCTTTGACAAGG - Intergenic
1192254662 X:69445407-69445429 TAATGCTCTGTTTCTTGATCTGG - Intergenic
1192275131 X:69621451-69621473 TAATGTTCTATTTCTTGACCTGG - Intronic
1192328840 X:70157806-70157828 AAATATTTTGTATCTTCATCTGG + Intronic
1192346828 X:70316672-70316694 TAGAATATTGTTTCTTCACCTGG - Intronic
1192868893 X:75166690-75166712 TAATGCTCTGTTTCTTCACCTGG - Intergenic
1193149937 X:78114335-78114357 TAATATTCTATTCCTTGACCTGG - Intronic
1193280103 X:79638459-79638481 TAATATTTGGTTTCTATATCTGG + Intergenic
1193745868 X:85280491-85280513 TAATGTTCTGTTTCTTTATCTGG - Intronic
1193800902 X:85934801-85934823 TAATGTTTGGTTTCTTGAGTAGG + Intronic
1193879214 X:86900989-86901011 TAATATTCTGTTCCTCGGCCGGG + Intergenic
1194007065 X:88507725-88507747 TAATATTTTGTTTGTATATCTGG - Intergenic
1194146428 X:90270915-90270937 GAATATTTTTTTTCTTTAACAGG + Intergenic
1194908097 X:99604149-99604171 TAATATATGTTTTCTTGGCCAGG - Intergenic
1194913091 X:99671312-99671334 TAGTTTTTTGTTGCTTCACCTGG - Intergenic
1195021826 X:100836240-100836262 TGATATTTCCTTTCTTGAACAGG + Intronic
1195034644 X:100961340-100961362 CAACATTCTATTTCTTGACCTGG + Intergenic
1195541991 X:106072930-106072952 AAATATTTTGTTTGTGGACAAGG + Intergenic
1195599936 X:106734705-106734727 TACTATTTTATTCCTTGAGCAGG - Intronic
1195752931 X:108175582-108175604 ATATATTTTGTTTGTTGACTTGG - Intronic
1195806578 X:108778207-108778229 TAATATTCTGTTCCTTGGACAGG - Intergenic
1196064305 X:111446019-111446041 TAATGTTCTGTTTCATGAGCAGG - Intergenic
1196478581 X:116119048-116119070 TAATATTTTCTTTCTATATCTGG + Intergenic
1196889939 X:120282201-120282223 GAAAATGTTTTTTCTTGACCTGG - Intronic
1197850242 X:130851030-130851052 AATTATATTGTTTCTTGAACAGG - Intronic
1197899094 X:131349687-131349709 TTATCTTTTGTTTCTTGATATGG - Intronic
1198503938 X:137282158-137282180 TCATGTTCTGTTTCTTGATCTGG + Intergenic
1198597969 X:138257760-138257782 TCATACTTTGTTTCTAGACTAGG - Intergenic
1199148778 X:144404245-144404267 TAAAATTGTGTTTCTTCATCTGG + Intergenic
1199557578 X:149125721-149125743 TAATGTTCTATTTCTTGACCTGG - Intergenic
1199669246 X:150128381-150128403 CAATGTTATGTTTCTTGATCTGG - Intergenic
1199943385 X:152646731-152646753 TAATATTCTGTTTCTTAACCTGG + Intronic
1200335549 X:155347549-155347571 TAATGATCTGTTTATTGACCTGG + Intergenic
1200350919 X:155493676-155493698 TAATGATCTGTTTATTGACCTGG - Intronic
1200351842 X:155504918-155504940 TAATATTTTATATCTTGATAAGG + Intronic
1200809572 Y:7469357-7469379 TAATTTTTTGTTTTTTGAGATGG + Intergenic