ID: 1121238304

View in Genome Browser
Species Human (GRCh38)
Location 14:92409602-92409624
Sequence GACTGGGGATACTCCCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121238304_1121238311 3 Left 1121238304 14:92409602-92409624 CCAGACTGGGAGTATCCCCAGTC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG 0: 1
1: 0
2: 1
3: 8
4: 81
1121238304_1121238312 4 Left 1121238304 14:92409602-92409624 CCAGACTGGGAGTATCCCCAGTC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1121238312 14:92409629-92409651 CTAACATGCTCCCCAGGATAGGG 0: 1
1: 0
2: 0
3: 9
4: 84
1121238304_1121238308 -2 Left 1121238304 14:92409602-92409624 CCAGACTGGGAGTATCCCCAGTC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1121238308 14:92409623-92409645 TCTTCCCTAACATGCTCCCCAGG 0: 1
1: 0
2: 2
3: 10
4: 154
1121238304_1121238316 23 Left 1121238304 14:92409602-92409624 CCAGACTGGGAGTATCCCCAGTC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1121238316 14:92409648-92409670 AGGGCAACCACTCTCCTGACTGG 0: 1
1: 0
2: 0
3: 16
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121238304 Original CRISPR GACTGGGGATACTCCCAGTC TGG (reversed) Intronic
903668882 1:25024015-25024037 CCCTGGGGACACTCACAGTCTGG - Intergenic
903797434 1:25940336-25940358 GACTGGGGACACAGACAGTCAGG + Intergenic
906319717 1:44808503-44808525 GCCTGGGCAGACTCCCAGCCAGG + Exonic
906346784 1:45020525-45020547 GACTGGGCATAGGCCAAGTCTGG - Intronic
914435756 1:147657876-147657898 AACCTGGGATATTCCCAGTCTGG + Intronic
914984159 1:152441987-152442009 GACTGGGGATGCTGCCAGTGGGG + Intergenic
915304691 1:154970588-154970610 GCCTGGGGATACCCCCTGCCTGG - Exonic
918771441 1:188565838-188565860 TAATGGGAATACTCCCAGTTTGG + Intergenic
922064535 1:222124283-222124305 GATTGTGGATGCTCCCTGTCAGG - Intergenic
1069582125 10:69573309-69573331 GGCTGGGGCAACTCCCAGGCGGG - Intergenic
1071135751 10:82452051-82452073 ATCTGGGGACACTCACAGTCTGG - Intronic
1077120911 11:908031-908053 GACTGTGGCTACCCCCAGGCAGG + Intronic
1082821287 11:57546155-57546177 GGCTGGGGATCCTCCCAGTGGGG + Intronic
1090806920 11:130208660-130208682 GGCTGGGGACACACCCAGTATGG + Exonic
1093789951 12:23237468-23237490 GACTGTTGATACTCCAAGTCTGG - Intergenic
1098665400 12:73155611-73155633 GAGAGGGGATACTCCCAGGGAGG - Intergenic
1108634242 13:52316777-52316799 GACTGGGGAGACACCCATGCTGG - Intergenic
1118718267 14:68575617-68575639 GAATGGGGATTCTCCCAATGAGG + Intronic
1118903699 14:70007647-70007669 GGCTGGGGATCCTGACAGTCAGG - Intronic
1121238304 14:92409602-92409624 GACTGGGGATACTCCCAGTCTGG - Intronic
1126925745 15:53584732-53584754 GAATGGGGATACTCCAAGCTGGG - Intronic
1127373225 15:58359390-58359412 GAATTGGGAAACTCCCAGACAGG + Intronic
1129738116 15:77976863-77976885 GACTGGGGACACCCCCAACCGGG - Intergenic
1129738650 15:77979269-77979291 CACTGGGGACCCTCCCAGTCAGG + Intergenic
1129847306 15:78773911-78773933 CACTGGGGACCCTTCCAGTCAGG - Intronic
1130039536 15:80394522-80394544 GACTGGGGAAACACCTAGTTAGG + Intronic
1133055870 16:3145250-3145272 GACTGGGAATGCTTCAAGTCTGG + Intronic
1139589537 16:67925912-67925934 GACTACTGCTACTCCCAGTCTGG - Intronic
1140740514 16:77937201-77937223 GGCTGGGGCTACTCCCAGGTGGG - Intronic
1142377843 16:89715993-89716015 GCCAGGGGATATTCCCATTCTGG + Intronic
1143332495 17:6148019-6148041 GACTGGAGATACTCAAAGCCAGG + Intergenic
1146928092 17:36758683-36758705 GGCTGGGGAGAATCACAGTCTGG + Intergenic
1147745314 17:42691187-42691209 TACTGGGGAGGCTCCCAGCCTGG + Exonic
1148281168 17:46348379-46348401 GAATGTGGAAACTCCCAGTAGGG + Intronic
1148303396 17:46566314-46566336 GAATGTGGAAACTCCCAGTAGGG + Intronic
1151817184 17:76477119-76477141 GTCTGGGGATGCCCCCAGGCTGG + Intronic
1156468048 18:37360435-37360457 AACTGGGGATCCCCCCACTCAGG - Intronic
1157719999 18:49916369-49916391 GACTGGGGCCAGTCCCAGCCTGG + Intronic
1158489306 18:57895415-57895437 GCCTGGGATGACTCCCAGTCAGG - Intergenic
1162411733 19:10510323-10510345 GACTTGGGGTCCCCCCAGTCTGG + Intergenic
1162716965 19:12640350-12640372 GACTGGGGAAAGTGCCTGTCTGG - Intergenic
1162911051 19:13847868-13847890 GACGGCGGATCCTCCCAGCCTGG + Intergenic
1165007136 19:32816541-32816563 GACTGGGGAAATTTCCAGTTTGG + Intronic
1167679990 19:50913181-50913203 CACTTGGGATGCTTCCAGTCTGG - Intergenic
926282114 2:11458250-11458272 TACTAGGGATACACCCAGACAGG + Intronic
930066051 2:47328554-47328576 AACTGGGGAGAATCCCATTCAGG + Intergenic
932414910 2:71567819-71567841 CACAGGGGACACTCCCAGTGAGG + Intronic
935435849 2:103031291-103031313 GAATGGGAGTACTACCAGTCTGG - Intergenic
937879879 2:126857220-126857242 GACTGGGGACACCCCCAGGGAGG + Intergenic
942539553 2:177001450-177001472 GTTTGGGGAGACTCCCAGCCTGG + Intergenic
943077158 2:183209454-183209476 GACTGGGGACCATCCCAGACTGG - Intergenic
1170554165 20:17502443-17502465 GACTGGGGACCATCCCAGTATGG + Intronic
1175987066 20:62769534-62769556 CACTGGGGACACCCCCAGCCAGG + Intergenic
1176017708 20:62944581-62944603 GCCTGGGGAAGCTCACAGTCTGG - Intronic
1181562283 22:23712614-23712636 TACTGGGGAAACTCCCTTTCTGG - Intergenic
1182773452 22:32812817-32812839 CACTGGGGTTTCTCCCTGTCAGG - Intronic
1183739077 22:39660149-39660171 CTCTGGGGATACTTGCAGTCAGG + Intronic
951292150 3:20884406-20884428 GTCTAGGGCTACTCCCAGACTGG + Intergenic
955352854 3:58206750-58206772 GACTGGGGACACTCCAAGGAAGG + Intronic
961606261 3:128097626-128097648 GAGTGGGGACACACCCTGTCTGG - Intronic
962490171 3:135885875-135885897 GATTGGGGCCACTCTCAGTCCGG + Intergenic
963877166 3:150489346-150489368 GACGGGGGAGACAGCCAGTCAGG - Intergenic
967057433 3:185841863-185841885 GATTGGAGACACTCCCAGTGAGG + Intergenic
967106631 3:186259731-186259753 GCCTGGGCTTCCTCCCAGTCCGG - Intronic
976955135 4:90887205-90887227 GGCTGAGGATACTACCAGTAGGG + Intronic
979018709 4:115467716-115467738 GATTTGGGAAACTCTCAGTCTGG + Intergenic
981878519 4:149578799-149578821 GACTGGGGAGACCCCCAAGCGGG + Intergenic
987247908 5:16067824-16067846 GACTGGTGATAATCCAAGGCTGG + Intronic
996920625 5:128763745-128763767 CACTGGGAATACTCCCATTTGGG - Intronic
1001168443 5:169393076-169393098 GCATGTGGATACCCCCAGTCTGG - Intergenic
1001282410 5:170396271-170396293 GAGAGGGGATGCTCCCAGCCTGG + Intronic
1004099123 6:12591062-12591084 GTCTGGTTTTACTCCCAGTCTGG - Intergenic
1025928439 7:65977080-65977102 TACTGGGGAAACTCCCTTTCTGG - Intronic
1027282554 7:76619424-76619446 GAGTGGGGATACTGCCAGAGAGG - Intronic
1038395415 8:27242491-27242513 GGCTGCGGAAACACCCAGTCAGG + Exonic
1041121547 8:54591343-54591365 GACTGGGGATACTCAAAGGACGG - Intergenic
1190535512 X:51422412-51422434 TACTGGGGAAACTCCCTTTCTGG - Intergenic
1191712940 X:64171820-64171842 CACTGGGAAAACTCCGAGTCAGG - Intergenic
1198440294 X:136656734-136656756 GAGGAGGGATGCTCCCAGTCAGG - Intronic
1201397817 Y:13567531-13567553 CATAGGGGATACTCCCATTCAGG + Intergenic