ID: 1121238311

View in Genome Browser
Species Human (GRCh38)
Location 14:92409628-92409650
Sequence CCTAACATGCTCCCCAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121238301_1121238311 26 Left 1121238301 14:92409579-92409601 CCAGGTCAAGAAACAAAATATTA 0: 1
1: 4
2: 31
3: 188
4: 860
Right 1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG 0: 1
1: 0
2: 1
3: 8
4: 81
1121238304_1121238311 3 Left 1121238304 14:92409602-92409624 CCAGACTGGGAGTATCCCCAGTC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG 0: 1
1: 0
2: 1
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121238311 Original CRISPR CCTAACATGCTCCCCAGGAT AGG Intronic
900656853 1:3762833-3762855 CCTCACCTGCTCCCCTGGAGTGG - Intronic
902630715 1:17702817-17702839 CCCGACATGCCCCCCAGGGTGGG - Intergenic
904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG + Intergenic
909958627 1:81807499-81807521 CCTAAGATGCTCTCAAAGATTGG + Intronic
912945303 1:114079584-114079606 TCTGACAGGCTCCCCATGATGGG + Intergenic
916501956 1:165394991-165395013 CTTAACATCCTACCCAGGACAGG + Intergenic
920083098 1:203391030-203391052 CTCAACATGTTGCCCAGGATAGG + Intergenic
920758715 1:208761085-208761107 TTTAACCTGCTCACCAGGATAGG - Intergenic
922354384 1:224762107-224762129 CCCAACATGCTCCACAGAATCGG - Intergenic
1064221869 10:13447968-13447990 CCTAAGCTGCCCCCCAGGAGTGG - Intronic
1070130033 10:73649315-73649337 CCTAACATGGTCCCTATGATGGG - Intronic
1071704809 10:87986245-87986267 CCCCACATGCTCACCAGCATTGG - Intergenic
1076022705 10:127087461-127087483 CCCAATATTCTCCCCAAGATAGG - Intronic
1076118060 10:127914407-127914429 ACTATCATACTTCCCAGGATAGG + Intronic
1079403057 11:20121781-20121803 TCTAACAAGCTCCACAGGAGTGG - Intergenic
1080076470 11:28156130-28156152 CCTAAAATATACCCCAGGATGGG + Intronic
1083016763 11:59462204-59462226 CCTAACATGTGCCCCAGACTAGG + Intergenic
1084444827 11:69197395-69197417 CCTAACATGCTCCCTTGGCTAGG - Intergenic
1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG + Intronic
1097937842 12:65273349-65273371 CCTAACCTGGCCTCCAGGATGGG + Intergenic
1099498287 12:83379202-83379224 CCTCACAAGTTCCCCAGGCTTGG - Intergenic
1101579900 12:106033147-106033169 CCTCACATCCTACCCAGGTTGGG + Intergenic
1102299465 12:111760463-111760485 CCTAACCTGATCCCCAGGGGAGG + Intronic
1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG + Intergenic
1107023780 13:35778684-35778706 CTTCACATGGTTCCCAGGATGGG - Intronic
1108910625 13:55546622-55546644 CCTAACATGTTTCCCAAAATAGG - Intergenic
1109811490 13:67519009-67519031 CCTACCGTTCTCCCCAGGAGGGG - Intergenic
1117242526 14:53849135-53849157 CCAACTATGCTCCCCAGGGTAGG - Intergenic
1118594991 14:67428356-67428378 TCTATCCTGCTCCCCAAGATTGG + Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1125525358 15:40370696-40370718 CCTGACAAGATCCCTAGGATGGG - Exonic
1127178629 15:56389909-56389931 CCCAAGATGCTCCCTAGGATAGG + Intronic
1129704859 15:77788270-77788292 TCTATCATACTCCCCTGGATGGG + Intronic
1130531405 15:84749529-84749551 CCAAACATGCTTCCCTGGGTGGG - Intronic
1134537254 16:15035824-15035846 ACCAACATGCTCCCCAGGCCGGG - Intronic
1135252320 16:20911497-20911519 TCTAACAGGCTCATCAGGATCGG - Intronic
1139956585 16:70696160-70696182 CCTGACATGTAACCCAGGATTGG - Intronic
1142482839 17:229374-229396 CTGAAAATGCTCCCCAGGACAGG + Intronic
1151416822 17:73972021-73972043 CCTCCTATGCTCCTCAGGATAGG + Intergenic
1154171615 18:12056844-12056866 CAGAACCCGCTCCCCAGGATTGG + Intergenic
1154416528 18:14178517-14178539 CCCAACCCGCTCCCCACGATGGG - Intergenic
1156223336 18:35076560-35076582 CCTGACAGACTCCCCAGGCTAGG + Intronic
1156444470 18:37225002-37225024 CCAAACCTGATCCCCATGATGGG + Exonic
1160241074 18:77123710-77123732 CCTGACCTGCTCACCAGGAGAGG - Intronic
1164651110 19:29891603-29891625 TTTAATATGCTCCCCAGGCTTGG - Intergenic
1165316645 19:35060223-35060245 CCCCTCAAGCTCCCCAGGATGGG + Intronic
1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG + Exonic
1167561341 19:50227644-50227666 CCTGAGATGCTCCCCTGGAAAGG - Intronic
925091889 2:1163016-1163038 CCTGTCATGCTCCACAGGCTGGG - Intronic
935085208 2:99838157-99838179 CTTAAAATGCTCCCCAGAGTCGG - Intronic
944141837 2:196465077-196465099 CCTAATATGCTCTCCTGGAGAGG + Intronic
948072954 2:235142215-235142237 GCTAACATGTTCCACAGGTTTGG + Intergenic
1172032607 20:31992439-31992461 GCTCACACGCTCCCCAGGACAGG - Intronic
1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG + Intergenic
1176857371 21:13983898-13983920 CATAACATGGTCCCCACCATGGG - Intergenic
1176867780 21:14063472-14063494 CCCAACCCGCTCCCCACGATGGG - Intergenic
1177319868 21:19508029-19508051 CCTGACATGCACCCCAAGACAGG - Intergenic
1182685736 22:32120862-32120884 CCTAACATGCCCCCCATCACTGG + Intergenic
1184441697 22:44520899-44520921 CCTAAGATGCCCCCAAGCATGGG - Intergenic
1185346154 22:50311736-50311758 CCCAACAGGCTGCCCAGGACAGG - Exonic
950880153 3:16316879-16316901 CCTGGCATCCTCTCCAGGATTGG + Exonic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
956730653 3:72193777-72193799 CCTACCATGCTGACCAGCATTGG + Intergenic
959101615 3:102016796-102016818 CATAACATTCTCCCAAGGAGAGG + Intergenic
961402804 3:126658907-126658929 CCTCTCATGCTGCACAGGATAGG - Intergenic
969398470 4:6938335-6938357 CCTCACATGCTCCTCTGGAGAGG + Intronic
978371240 4:108031385-108031407 CCTCACAGGCTCCTCAGGCTTGG - Intronic
985481042 5:111105-111127 CCAAAGGTGCTCCCCAGAATCGG + Intergenic
986081408 5:4398624-4398646 CCTCACAGGCCCCCCAGGGTAGG + Intergenic
987128007 5:14833425-14833447 CCTAACAAGCTCTGCAGGGTAGG - Intronic
988996637 5:36721652-36721674 CCTCCCAAGCTCCCCAGGGTGGG - Intergenic
991632597 5:68671391-68671413 CCTAAGATGCTACCCAGGCAGGG - Intergenic
998092220 5:139378233-139378255 CAGAACATGCCCCCCAGGATGGG + Exonic
998169494 5:139864149-139864171 CCTAGCCTGCTCTGCAGGATGGG + Intronic
998176334 5:139904302-139904324 CCTACCTTTCTCCCCGGGATCGG + Intronic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
1001880903 5:175243332-175243354 CCTGTCATGTTCCCCAGGATTGG + Intergenic
1003148309 6:3527384-3527406 CCTTACATGGTCCCCAGGCAAGG - Intergenic
1005505049 6:26462380-26462402 GCTAACATGTTGCCCAGGCTGGG - Intronic
1006880182 6:37332311-37332333 CCTAGCAGCCTCCCCAGGAAGGG + Exonic
1018786185 6:167109810-167109832 CCTGGCATGCTCCGCAGGATGGG - Intergenic
1021957955 7:25845211-25845233 TCAAACATGCACCCCAGGTTAGG + Intergenic
1022106601 7:27201341-27201363 CCTACCATGCTCCCAAGAAAAGG - Intergenic
1023020221 7:36005239-36005261 CCTTACATCCTCCCTATGATAGG - Intergenic
1033524645 7:142198515-142198537 TCTAACATGCTTCCCAGGAAAGG + Intronic
1038080832 8:24134274-24134296 TCTCACATGCTGCCCAGAATTGG - Intergenic
1040839633 8:51771540-51771562 CCTTACTTGCCCCCAAGGATAGG - Intronic
1048936136 8:139358708-139358730 CTTAAGGTGCTTCCCAGGATTGG - Intergenic
1049377691 8:142296799-142296821 CCCCACAGGCTCCCCAGGACGGG + Intronic
1060559298 9:124529709-124529731 CCTGACATCCTCCCAAGGTTGGG - Intronic
1061291983 9:129655587-129655609 CCTAACAGCCCCCACAGGATTGG + Intergenic