ID: 1121240596

View in Genome Browser
Species Human (GRCh38)
Location 14:92427337-92427359
Sequence CAGTGTGGCCAGAGTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 1, 2: 10, 3: 58, 4: 367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121240589_1121240596 14 Left 1121240589 14:92427300-92427322 CCAGGTTTGTGCCAGGACCTGGC 0: 1
1: 0
2: 2
3: 27
4: 298
Right 1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG 0: 1
1: 1
2: 10
3: 58
4: 367
1121240586_1121240596 25 Left 1121240586 14:92427289-92427311 CCTACTTCGTGCCAGGTTTGTGC 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG 0: 1
1: 1
2: 10
3: 58
4: 367
1121240592_1121240596 -3 Left 1121240592 14:92427317-92427339 CCTGGCAGCACAGGCATGACCAG 0: 1
1: 0
2: 1
3: 29
4: 241
Right 1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG 0: 1
1: 1
2: 10
3: 58
4: 367
1121240591_1121240596 3 Left 1121240591 14:92427311-92427333 CCAGGACCTGGCAGCACAGGCAT 0: 1
1: 0
2: 2
3: 44
4: 585
Right 1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG 0: 1
1: 1
2: 10
3: 58
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121240596 Original CRISPR CAGTGTGGCCAGAGTAGAGT GGG Intronic
900623045 1:3596161-3596183 CAGTGTGGCCAGGGCAGCCTTGG + Intronic
900689970 1:3974607-3974629 GGGTGTGGCCAGAGCAGGGTGGG + Intergenic
900729096 1:4240347-4240369 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
901258488 1:7853753-7853775 CAGCTTGGGCAGAGTACAGTTGG - Intergenic
902200462 1:14829763-14829785 TAGTGTGGCCAGAGCATAGAAGG + Intronic
902688225 1:18092846-18092868 CAGTGGGGACAGAGGAGAATGGG - Intergenic
903293504 1:22329303-22329325 CTGAGTGGCTGGAGTAGAGTGGG - Intergenic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
904314417 1:29651051-29651073 TACTGTGGCCAGAGTGGAGCTGG - Intergenic
904910249 1:33929226-33929248 GAGGGTGGCCGGAGTAGAGGTGG - Intronic
905804525 1:40866138-40866160 GAGTGTGGACAGAGTGCAGTGGG + Intergenic
907146712 1:52240754-52240776 GAGGGTGCCAAGAGTAGAGTAGG - Intronic
909032569 1:70559748-70559770 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
910330668 1:86069131-86069153 CAGCTTGGCCACAGTAGGGTAGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
911203884 1:95073598-95073620 CAGTGTGACCAGAGTAGTTGAGG + Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912109132 1:106318487-106318509 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
913369514 1:118082910-118082932 CAGTGAGGCCAGTGTAGATGAGG + Intronic
913496143 1:119429974-119429996 CAGAGAGGTCAGGGTAGAGTGGG + Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915382854 1:155458756-155458778 CAGTGTGGTCAGACTAAAGACGG - Intronic
915532147 1:156508857-156508879 AAGTATGGCCAGAGTCAAGTGGG - Intergenic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
917085030 1:171296590-171296612 CAGAGAGGTCAGGGTAGAGTGGG + Intergenic
919442151 1:197649175-197649197 CAATGTGACCAGAATAGAGGAGG + Intronic
919981908 1:202647073-202647095 CATGGTGGCCAGGGTAGGGTTGG + Intronic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920601631 1:207330743-207330765 CAGTGTAGTCAGAGAAGACTTGG - Intronic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
923104072 1:230840989-230841011 CTGTGTGGGCAGTGGAGAGTAGG - Intronic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923891204 1:238216741-238216763 CAGTGGGGAAGGAGTAGAGTAGG + Intergenic
924306914 1:242698861-242698883 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1065052283 10:21807351-21807373 CAGTGTGGTTAGAGCACAGTGGG - Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065226845 10:23552272-23552294 CAGTGTGGCCAGAATAAAGCAGG + Intergenic
1065411398 10:25433252-25433274 CAATGGGGCCAGAGTTGACTGGG - Intronic
1066284844 10:33955527-33955549 CCCTGTGGCCAAAGTAGGGTGGG - Intergenic
1067220790 10:44342922-44342944 CAGTCTGGGCAGTGCAGAGTAGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1068461676 10:57337185-57337207 GAGCGTGGCCAGAGCAGAGGTGG + Intergenic
1071147833 10:82596270-82596292 AAGTTGGGCCAGAGTAGAATTGG + Intronic
1071562728 10:86656216-86656238 CACTGTGCCCAGGGTATAGTGGG - Exonic
1071959264 10:90793952-90793974 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1074884865 10:117685551-117685573 GTCTGTGGACAGAGTAGAGTGGG - Intergenic
1075830582 10:125407596-125407618 CAGTTTAGCCACAGTAGAATAGG - Intergenic
1075838864 10:125479927-125479949 TAGTGTGGCCCAAGTAGAGGAGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076869224 10:133185174-133185196 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869226 10:133185197-133185219 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869229 10:133185243-133185265 CAGTGTGTGCAGTGTAGAGTAGG + Intronic
1076869232 10:133185289-133185311 CAGTGTGTGCAGTGTAGAGTAGG + Intronic
1076869234 10:133185312-133185334 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869236 10:133185335-133185357 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869238 10:133185358-133185380 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869240 10:133185381-133185403 CAGTGTGTACAGTGTGGAGTAGG + Intronic
1076869242 10:133185404-133185426 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869245 10:133185450-133185472 CAGTGTGTGCAGTGTAGAGTAGG + Intronic
1076869247 10:133185473-133185495 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078480802 11:11673602-11673624 CAGTGTGGTCAGAGCTGTGTGGG - Intergenic
1081390874 11:42527181-42527203 CAGTATGGACAGAGCAGAGAAGG + Intergenic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1081962804 11:47150767-47150789 TAGTGTGGCCAGAATGCAGTGGG + Intronic
1083479415 11:62934056-62934078 CAGAGTGGCCAGAGTGGGGTGGG - Intergenic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1089846286 11:121461011-121461033 GAGTGGGGACAGAGCAGAGTGGG + Intronic
1090886490 11:130881444-130881466 CAGCCTTGCCAGAGGAGAGTTGG - Intronic
1091041567 11:132285754-132285776 AAATATGGCCAGAGCAGAGTCGG - Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1093647885 12:21609870-21609892 CAGTGTGTCTAGACTAGAGAAGG + Intergenic
1093666236 12:21816582-21816604 TAGTGTGGCCAGAGTAAAAGTGG + Intronic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094206768 12:27848661-27848683 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1095590310 12:43895960-43895982 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1096985183 12:55751402-55751424 CAGTGAGTCCAGAGGAGAATGGG - Exonic
1099701227 12:86084903-86084925 CAGTGTAACCTGAGTAGAATAGG + Intronic
1099888564 12:88561743-88561765 CAGTGTGGCTAGAGCATGGTGGG - Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101382213 12:104223912-104223934 GGGTGTGGGCAGAGTAGTGTGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102141982 12:110622663-110622685 CAGTGTGGCCAGAAGAGGGGTGG + Intronic
1102146428 12:110658330-110658352 CAGTGAGGCCACACTGGAGTAGG - Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1104261052 12:127182385-127182407 CAGTGTGGCTAGAATACAGCAGG - Intergenic
1104615517 12:130264997-130265019 CAGTGTGCCCAGCAGAGAGTAGG + Intergenic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104850786 12:131872566-131872588 CAGTGTGGCCTGAAGACAGTGGG - Intergenic
1104908786 12:132229640-132229662 CCGTGTGGCCCGAGAAGGGTGGG - Intronic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1108070909 13:46627685-46627707 CAGTGTTGCCAGACTCCAGTGGG - Intronic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1109961698 13:69639553-69639575 CAGCTCGGCCACAGTAGAGTAGG - Intergenic
1110423769 13:75341953-75341975 CAGTGTGGCCACAGTATGGCAGG + Intronic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1112378537 13:98866099-98866121 CAGGGTGGCCAGATAACAGTTGG - Intronic
1112378708 13:98868142-98868164 CAGGGTGACTAGAATAGAGTAGG - Intronic
1114812266 14:25914695-25914717 AAGTGTGGGCAGAGTATAGTGGG - Intergenic
1116443038 14:44976475-44976497 CAATGTGCTCAGAGTATAGTGGG - Intronic
1117090757 14:52247736-52247758 CAGTGTGGCCAGAGAAGTCAGGG + Intergenic
1117934778 14:60890770-60890792 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1118016346 14:61664936-61664958 GACTGTGGGAAGAGTAGAGTAGG - Intergenic
1119532807 14:75374721-75374743 CAGCGTGGCTAGAATAAAGTAGG + Intergenic
1119714191 14:76846978-76847000 GAGTGTAGACAGAGTTGAGTAGG + Intronic
1120100952 14:80445207-80445229 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121337043 14:93083835-93083857 CAGTGGGGCCTGAGGAGGGTGGG - Intronic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122595089 14:102885023-102885045 CACTGTGGCCAGGGAAGAGAAGG - Intronic
1122941302 14:104982600-104982622 CAGTGTGGTCAGGCAAGAGTGGG - Intergenic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1128112057 15:65082660-65082682 CAATGAGGCCAGAGAGGAGTGGG - Intergenic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128706404 15:69840311-69840333 GAGTGTGGGAAGAGTAGAGAGGG - Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1128942936 15:71803015-71803037 CAGTGGAGACAGAGTAGGGTGGG + Intronic
1129832783 15:78681615-78681637 CAGTGAGGCCACAGGAGAGAGGG + Intronic
1130159722 15:81386506-81386528 CAGTGTGGCCAGAGCAGGGTAGG - Intergenic
1130861501 15:87894825-87894847 CAGTGAGGAGAGAGTAGAGCAGG - Intronic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1131724317 15:95205321-95205343 CAGTATGGCCAGAATAAAGCAGG + Intergenic
1132554106 16:565118-565140 TGGTGTGGCCAGAGAAGGGTTGG - Exonic
1133662501 16:7932968-7932990 CAGTGTGGCCAGAATAAAAGCGG - Intergenic
1133696075 16:8264208-8264230 CAGAGTGGCCAGCATAGAGGTGG + Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1134052239 16:11145214-11145236 GTGTGTGGTCGGAGTAGAGTGGG - Intronic
1134693797 16:16208290-16208312 CAGTGCCGCCAGAGTAGCGTTGG + Intronic
1134978044 16:18586353-18586375 CAGTGCAGCCAGAGTAGCGTTGG - Intergenic
1135056688 16:19237868-19237890 CACTATGGCCAGAGCAGGGTTGG + Intronic
1136251314 16:29007380-29007402 CAGTGTGGCTAGGATAAAGTAGG + Intergenic
1136515012 16:30762722-30762744 CAGTTTGGCCAGAGAACAGAGGG - Intronic
1136543433 16:30942005-30942027 CTGTGTGGCCAGAAGAGAGCTGG + Intronic
1137295882 16:47092973-47092995 CAGTGAGGACAAAGAAGAGTGGG - Intronic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137574660 16:49590849-49590871 CAGAGTGGCCAGAGTGGTGGTGG - Intronic
1138206000 16:55125493-55125515 CAGTGTGGCCAGAACAGGGTAGG + Intergenic
1138606026 16:58089230-58089252 CAGTGTGCCCAGAGTAGCCTGGG - Intergenic
1140496415 16:75393158-75393180 CAGTGAGGGCTGAGGAGAGTGGG - Intronic
1140902364 16:79381050-79381072 CAGGGAGGCCAGAGCAGAGGTGG - Intergenic
1142110556 16:88328869-88328891 CAGTTTGGCCACAGCAGAGGAGG + Intergenic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143401542 17:6648200-6648222 AGGTGTGGTCAGAGTACAGTGGG - Intronic
1143517883 17:7429115-7429137 GGGTGTGGCCAGATAAGAGTTGG + Intergenic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144167582 17:12627238-12627260 CCGTGAGGCGACAGTAGAGTAGG - Intergenic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144743861 17:17600125-17600147 CACTGTTGCTTGAGTAGAGTTGG + Intergenic
1146515724 17:33487715-33487737 CAGCGTGGCCAGAATAAAGAAGG + Intronic
1147057601 17:37846250-37846272 CAATGTGGCCAGAGCAGGATGGG + Intergenic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1149316314 17:55442252-55442274 CAGTGTGCCCAGAGTAGCTGTGG + Intergenic
1150292217 17:63988469-63988491 CAGAGTGGCCTGAGTGGAGTTGG - Intergenic
1150866476 17:68855922-68855944 CACTGTGCCCAGCCTAGAGTTGG - Intergenic
1151487554 17:74410744-74410766 CAGGGTGGCTGGGGTAGAGTGGG + Intergenic
1151804326 17:76396308-76396330 CAATGTGGCCATTGTAGAGGAGG - Exonic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1153101161 18:1471244-1471266 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1153118468 18:1690376-1690398 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1155180521 18:23341522-23341544 CAGTGGTGCCAGAGGAGAATCGG - Intronic
1156169861 18:34469613-34469635 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1157870618 18:51227078-51227100 CAGCATGGCCAGAATAGAGCAGG - Intergenic
1158253439 18:55516782-55516804 GAGTGTGGCTGGTGTAGAGTGGG + Intronic
1160059990 18:75521081-75521103 AAGTGTGTCCAGGGTAGAGCAGG + Intergenic
1161445817 19:4318573-4318595 CAGTGTGGTCAGAGTTGGGGTGG + Intronic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1161960301 19:7519605-7519627 CAGTGAGGCCAGAGGAGATGGGG - Exonic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1163068353 19:14816406-14816428 CAGTGTGGCTAGAATAGAGCAGG + Intronic
1164716257 19:30392415-30392437 CAGGGTAGCCAGAGAAGGGTTGG + Intronic
1164759124 19:30715063-30715085 CAGAGTGGCGAGAGGAGAGTTGG + Intergenic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166326873 19:42056472-42056494 TGGTGTGGCCAGAGTGGTGTGGG + Intronic
1167211777 19:48138022-48138044 GAGTGTGGACAGAGCAGAGAAGG + Intronic
1167708578 19:51096859-51096881 CAGTGTGGCGGGAACAGAGTGGG - Intergenic
1168073562 19:53965980-53966002 CAGCGTGGCCGGGGCAGAGTGGG + Intronic
925847562 2:8047516-8047538 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
927028578 2:19096386-19096408 CAGTGCGGCTAGAGTAAAGCAGG + Intergenic
927355660 2:22170184-22170206 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
927377458 2:22434978-22435000 CAGGGTGGCCTGTTTAGAGTAGG + Intergenic
928124177 2:28604579-28604601 CAGTGAGGCAAGAGTAGGGGTGG - Intronic
928214744 2:29351941-29351963 CACTGTGGCCAGAGCTGAGAAGG - Intronic
929349265 2:40928990-40929012 CAGTGTGGTCAGAGCAGAAATGG + Intergenic
930312180 2:49755747-49755769 CAGTCAGGCTAGAGTACAGTAGG - Intergenic
930480857 2:51946737-51946759 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
931110122 2:59101269-59101291 CAGTGTGGCTAGAGTAAAACAGG - Intergenic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931621204 2:64211477-64211499 CAGTGTGGCAAGGGTAGAAGTGG - Intergenic
932723495 2:74157730-74157752 CTGTGTGGTGAGAGTATAGTAGG + Intronic
932904992 2:75739448-75739470 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
933008767 2:77029541-77029563 CAGTGTGGCTAGAATAAAGCAGG - Intronic
933699454 2:85244148-85244170 CAGAGTGGCTGGAGCAGAGTGGG + Intronic
935210640 2:100937075-100937097 CAGTGTGCCCAGCATAGAGTAGG + Intronic
937149058 2:119673469-119673491 CAGTGGGGACAGAGTAGGGAGGG - Intergenic
938769425 2:134488343-134488365 CAGTGTGGCTAGAATAAAGCAGG + Intronic
938997198 2:136692700-136692722 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
939204988 2:139090154-139090176 CAGTGTGCCCAGAGTAGCCAAGG - Intergenic
939769213 2:146293737-146293759 CAGAGTGGGCAGAGTAGAGTGGG + Intergenic
940427385 2:153545761-153545783 TAGTGTGGCCAGACCAGAGTTGG - Intergenic
941631017 2:167884280-167884302 CAGTATGGCCAGAGCACAGAGGG - Intergenic
941790003 2:169541860-169541882 CAGTGTGGCAGGAGTAGATGAGG - Intronic
945566500 2:211407037-211407059 CACTCAGGCCAGAGTACAGTGGG - Intronic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
947277426 2:228408496-228408518 CAGTGTATCCAGAGTAAATTAGG + Intergenic
947921049 2:233874569-233874591 CAGCGTGGCCAGAATAAAGCAGG + Intergenic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1169745947 20:8942989-8943011 CATTGTGGTCAGAGGAGAGAAGG - Intronic
1170370119 20:15639455-15639477 CAGTGGGGGCTGAGGAGAGTAGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170815708 20:19712468-19712490 CAGGATGGGCAGAGTAGAGGTGG + Intronic
1171050056 20:21849455-21849477 CTGTGTGGCTAGAGTGGATTGGG + Intergenic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1173456909 20:43210088-43210110 CACTGTGGCCAAAGTACAGCAGG + Intergenic
1174126308 20:48309445-48309467 CAGTGTGGCCACAGCAGAGTGGG - Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1175597057 20:60243687-60243709 CAATGAGGTCAGAGTAGAGTGGG - Intergenic
1175743339 20:61435969-61435991 AAGTGTGGCCAGACTGGAGAAGG - Intronic
1176992654 21:15517422-15517444 TAGTGGGGGCAGAGTGGAGTGGG + Intergenic
1177229346 21:18299553-18299575 CACTGCTGCCAGAGTAAAGTTGG + Intronic
1177378232 21:20302107-20302129 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1180156746 21:45981805-45981827 CAGCGCGGCCAGGGCAGAGTGGG - Exonic
1181311313 22:21946384-21946406 CAGCGTGGCCAGAGACGAGCAGG + Intronic
1181409722 22:22710451-22710473 CAGTCTTGCCAGGATAGAGTGGG + Intergenic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1183954734 22:41372700-41372722 CAGGGGAGCAAGAGTAGAGTTGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184238813 22:43200825-43200847 CAGTGTGCCCAGGGCAAAGTTGG - Exonic
1184963839 22:47951944-47951966 CAGTGTGGCCAGGATAAAGCAGG + Intergenic
949366058 3:3281927-3281949 CACTGGGGCCAGAGCATAGTAGG + Intergenic
950004072 3:9680137-9680159 CAAGCTGTCCAGAGTAGAGTTGG + Intronic
950247664 3:11436475-11436497 CAGGGTGTCCAGAGTAGCCTTGG - Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
950988273 3:17400722-17400744 CAGTGTGGCTAGAATAAAGCAGG + Intronic
951396245 3:22171033-22171055 CTGAGTGGCAAGATTAGAGTTGG + Intronic
951993518 3:28702012-28702034 CAGTGTGGCTAGAATATAGCAGG - Intergenic
952684633 3:36133853-36133875 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
952726814 3:36595210-36595232 CTCTGTGGGCAGAGTAGAGTGGG - Intergenic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
954962079 3:54575637-54575659 CAGTGTGGCCAGTGCAGTCTTGG + Intronic
955044185 3:55344345-55344367 GAGTGTGGCAAGAGAAGGGTGGG + Intergenic
955926610 3:64012376-64012398 GAGGGTGGTGAGAGTAGAGTTGG - Intronic
956392463 3:68788238-68788260 TAGTGTGGCCAGGGTAGTGAGGG - Intronic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
957888151 3:86317643-86317665 CAGTGTGGCTAGAACAGATTAGG - Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961829420 3:129615853-129615875 CCGTGTGGGCAGAGCAGAGGAGG + Intergenic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
962288380 3:134107412-134107434 CAGTGTTGCCAGAGAAAAGGAGG - Intronic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
962978546 3:140467395-140467417 CTGTGTAGCAAGACTAGAGTTGG + Intronic
963618931 3:147579866-147579888 CAGTGTAGCCACAGAAGAGAAGG + Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
963792913 3:149602617-149602639 CAGTGTGGCCAGTGTAAACAAGG - Intronic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964523650 3:157594151-157594173 CAGTTTTGTTAGAGTAGAGTAGG + Intronic
965707379 3:171522631-171522653 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
966828690 3:183987569-183987591 CAGTGTTGCCAGAGAAGAAATGG - Intronic
966974223 3:185070732-185070754 GAGTCTGCCCAGAGTAGAGATGG + Intergenic
967745215 3:193047479-193047501 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
967912316 3:194552516-194552538 CAGAGTGGCCGCAGCAGAGTGGG - Intergenic
968782885 4:2596481-2596503 CAGTGTGGCCAGGGAAGACCAGG - Intronic
968800626 4:2741257-2741279 CAGCGTGGCCAGAATAAAGCAGG + Intergenic
969546026 4:7828466-7828488 CAGTTTGGCCAAAGGAGTGTGGG + Intronic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
970173014 4:13308050-13308072 CAGTGTGGCTAGAGTGCGGTGGG - Intergenic
970213091 4:13731244-13731266 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
970287909 4:14538937-14538959 CACAGTGGCCAGAATAGAATAGG + Intergenic
970301539 4:14686227-14686249 CAGTATGGCAGGAGTAGAGCAGG + Intergenic
971126759 4:23762883-23762905 CAGTGTGGCTAGAATAAAGCAGG + Intronic
973832616 4:54776916-54776938 GAGTGTGGCTGGAATAGAGTGGG + Intergenic
975804504 4:78098105-78098127 TAGTGTGGAAAGAGTAGAGCTGG + Intronic
977192612 4:94019583-94019605 CAGTGTGGCCAAAATAGGGGTGG - Intergenic
977203960 4:94148991-94149013 CAGAGTGGCAAGAATAGAGCAGG + Intergenic
977213688 4:94252286-94252308 CAGTGTTGGCATAGTTGAGTGGG + Intronic
977449055 4:97171218-97171240 CAGTGTGGCTAGAATAAAGTAGG - Intergenic
978690659 4:111505444-111505466 CAGTGGGGCCAGAATATATTTGG - Intergenic
979980384 4:127247707-127247729 TAGAGTGGCCATAGTAGAGCAGG - Intergenic
979994589 4:127415464-127415486 CTGTGGTTCCAGAGTAGAGTTGG - Intergenic
980880826 4:138708564-138708586 CAGTGGGGCCAGGTGAGAGTGGG + Intergenic
981003119 4:139847269-139847291 CAGTTTGTCCAGAATAGTGTGGG + Intronic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981415665 4:144490270-144490292 GAGAGTGGCCAGAGTAGGCTTGG - Intergenic
981619137 4:146673885-146673907 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
982194453 4:152896199-152896221 CAGTGAGGCCAGAGCATAATGGG + Intronic
984888075 4:184468699-184468721 GTGTGTGGCCAGAGTAGAAATGG - Intronic
985004020 4:185514672-185514694 CACTGTGGCCAGAACAGAGCCGG + Intronic
985789080 5:1915767-1915789 CAGTGGGGGCAGAGTGGGGTGGG + Intergenic
985938104 5:3112011-3112033 CAGGCTGGCCAGAGCAGAGGTGG - Intergenic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
989419496 5:41219954-41219976 GAGTGTGGCCAAAGTAAAGAGGG + Intronic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
995647498 5:114329385-114329407 CAGTGCGGCTAGAATAAAGTAGG + Intergenic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996273465 5:121636853-121636875 CAGTGTGGCTAGAACACAGTAGG - Intergenic
996313095 5:122129056-122129078 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
997459895 5:134044899-134044921 CAGGATGGCCAGAGTTGAGGGGG - Intergenic
998016492 5:138736263-138736285 CAGTGTTTACAGAGTAGTGTGGG - Intronic
998091549 5:139373813-139373835 CACAGTGGGCACAGTAGAGTGGG + Intronic
998167821 5:139854554-139854576 CAGTGAGCCCAGAGGAGACTGGG - Intronic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
1000040254 5:157479976-157479998 GAGTGTGACCAGAGTAGACTTGG - Exonic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1000790961 5:165606741-165606763 CAGTGTGGTAATAGTAGAGGCGG - Intergenic
1001961647 5:175883497-175883519 CCTTGTGGCTAGAGTACAGTGGG + Exonic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002843346 6:924493-924515 CAGAGTTGTCAGAGAAGAGTCGG + Intergenic
1003308579 6:4949456-4949478 TAGTTTGGCCAGAGTACAGCAGG - Intronic
1003443837 6:6167108-6167130 CAGTGTCTCCAGAATAAAGTGGG - Intronic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005019342 6:21402529-21402551 CAGTGTGGGGAGAGCAGACTGGG + Intergenic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1008438034 6:51498949-51498971 CTGTGAAGCCAGAGTAGTGTGGG + Intergenic
1009690873 6:67030962-67030984 CAGTGTGGCCAGAGCGGACGAGG - Intergenic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1012132840 6:95518910-95518932 CAGTGTGGCGAGAGGCGGGTGGG + Intergenic
1012997035 6:105984479-105984501 CAGTGTAGCCAGACAGGAGTGGG + Intergenic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1016151169 6:140744938-140744960 CAGTGTGGCTAGAATAAAGCTGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017970725 6:159310432-159310454 CAGTGTAGCCAGAATAAAGCAGG + Intergenic
1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG + Intergenic
1021423307 7:20470022-20470044 CAGTGTAGCCAGAGGAGGCTGGG - Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023942541 7:44779142-44779164 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1027807859 7:82852392-82852414 CAGTGTGGCTAGAATAAAGCAGG + Intronic
1027823180 7:83075316-83075338 CAGTCAGGCAAGAGTATAGTTGG + Intronic
1027828299 7:83145204-83145226 CAGAGTGGCCTGCTTAGAGTAGG + Intronic
1028228137 7:88273784-88273806 CCTTGTGGCCAGACTAGAGTGGG + Intergenic
1029015490 7:97311625-97311647 CAGAGTGGCTAGAGAAGGGTAGG + Intergenic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029809728 7:103035101-103035123 CAGTGTGGTCTGAGTAAAGTTGG + Intronic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1030468074 7:109927635-109927657 CAGTGTAGCCAACGTGGAGTAGG - Intergenic
1031185487 7:118474630-118474652 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032825730 7:135565997-135566019 CAGTGTATCCAGAGTTGATTAGG + Intronic
1033468129 7:141616038-141616060 CAGTGTAGACAAAGTAGACTGGG + Intronic
1033985365 7:147219538-147219560 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1034064865 7:148126607-148126629 CTGGGAGGCCAGAGTAGTGTTGG + Intronic
1034083051 7:148298471-148298493 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1035987884 8:4454427-4454449 CGGTGTAGCCAGACTAGGGTAGG - Intronic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1039026040 8:33259118-33259140 CAGAGTGGCCAAAGCAGACTGGG - Intergenic
1039158025 8:34584640-34584662 AAGTCTTGGCAGAGTAGAGTCGG + Intergenic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042519961 8:69701042-69701064 CATTGTGTCCAGATGAGAGTAGG + Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043614023 8:82103355-82103377 CAGTGTGGCTAGAATAAAGTGGG + Intergenic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045543821 8:103110816-103110838 CAGGGCCACCAGAGTAGAGTGGG - Intergenic
1047056490 8:121170379-121170401 CAGTACAGCCAGAGTGGAGTGGG - Intergenic
1047800189 8:128301221-128301243 CAGTGTAGCCAGACTGTAGTTGG + Intergenic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048295335 8:133209718-133209740 CACTGTGCCCAGAACAGAGTTGG - Intronic
1048521271 8:135157645-135157667 AAGTGTAGTCAGAGCAGAGTGGG - Intergenic
1048787262 8:138063470-138063492 GAGTGAGACCAGAGTGGAGTGGG + Intergenic
1050636278 9:7616373-7616395 CAGCGTGGCTAGAATAAAGTGGG - Intergenic
1050658223 9:7852964-7852986 CAGCGTGGCCAGAATAAAGTAGG - Intronic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1052883737 9:33623415-33623437 CAGTGTGGACAGAGTTGATGCGG + Intergenic
1054870192 9:70042342-70042364 TAGTGTGTTCAGAATAGAGTAGG + Intergenic
1054968300 9:71055019-71055041 CAGTGGGTTCAGAGTAGATTTGG + Intronic
1055800103 9:80025308-80025330 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
1056105294 9:83341266-83341288 CACTGTGGAGAAAGTAGAGTGGG - Intronic
1056252679 9:84766282-84766304 TAAGGTGGCCAGAGCAGAGTGGG + Intronic
1056568317 9:87794228-87794250 CAGTGTGGCCAGAGCATCCTGGG + Intergenic
1056570186 9:87808056-87808078 CAGTGTGGCCAGAGCATCCTGGG + Intergenic
1056846203 9:90040211-90040233 CAGGAAGGCCTGAGTAGAGTTGG + Intergenic
1057721106 9:97532458-97532480 CAGTGTTGCCAGGGTGGAGCAGG - Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1059476559 9:114552173-114552195 CAGAGTGGCCAGACTAGGGAAGG - Intergenic
1060391712 9:123283237-123283259 GTGAGTGGGCAGAGTAGAGTGGG - Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061923895 9:133796730-133796752 CAGTGTGGCCAGTGCAGACACGG - Intronic
1187485886 X:19703043-19703065 CAGTGTGGGCATAGTGGAGTTGG - Intronic
1187927617 X:24264327-24264349 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1188012589 X:25073592-25073614 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1189422234 X:40866443-40866465 CCATGTGGCCAAAGTAGAGATGG - Intergenic
1190212565 X:48459875-48459897 ATCTGTGGCCAGAGTAGGGTGGG + Exonic
1190763381 X:53455134-53455156 CAGTGTGCCCAGAGTAGCCTGGG - Intergenic
1190929065 X:54933306-54933328 CAGTGAGGCCAAGGCAGAGTAGG + Exonic
1191095427 X:56668685-56668707 CAGTGTGGCCAGGATAAAGCAGG - Intergenic
1191258464 X:58290072-58290094 CAGTGAGGCCAGAGGAGTCTGGG + Intergenic
1191940355 X:66473313-66473335 CAGTCTGTCCAGAGTAGCATGGG - Intergenic
1192246179 X:69373526-69373548 CATTGTAGCCAGAGTGGAGTGGG - Intergenic
1193295280 X:79825991-79826013 CAGAGAGGTCAGGGTAGAGTGGG + Intergenic
1193438692 X:81512474-81512496 CAGTTTAGCCAGAGCAGAATTGG + Intergenic
1193940644 X:87677549-87677571 CAGAGTGGCTAGAATAAAGTGGG - Intergenic
1194016200 X:88624640-88624662 CAGTGTGGCTAGAGGAGTGCAGG + Intergenic
1194198511 X:90926508-90926530 CAGTATGGCTAGAATAGAGCAGG - Intergenic
1195017289 X:100791995-100792017 CAGATTGGTCAGGGTAGAGTAGG - Intergenic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196408222 X:115388290-115388312 TAGTGAGCCCAGAGTAGAATAGG + Intergenic
1197375946 X:125682205-125682227 CAATGCGGCCACAGTAGAATAGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198270989 X:135055872-135055894 CAGAGTGGTTAGAGAAGAGTTGG + Intergenic
1200098323 X:153674414-153674436 CAGTGTGGCCGGGGAAGAGGTGG - Intronic
1200543229 Y:4486320-4486342 CAGTATGGCTAGAATAGAGCAGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic
1201469810 Y:14320469-14320491 AAATGTAGCCAGAGGAGAGTAGG - Intergenic