ID: 1121244297

View in Genome Browser
Species Human (GRCh38)
Location 14:92451175-92451197
Sequence CAGAAAGTGTGGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 1, 2: 0, 3: 45, 4: 488}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121244291_1121244297 -3 Left 1121244291 14:92451155-92451177 CCAAGGGAGAAAACAGTCCTCAG 0: 1
1: 0
2: 2
3: 43
4: 576
Right 1121244297 14:92451175-92451197 CAGAAAGTGTGGAGGGAAGTGGG 0: 1
1: 1
2: 0
3: 45
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121244297 Original CRISPR CAGAAAGTGTGGAGGGAAGT GGG Intronic
900816928 1:4854879-4854901 CAGAAAGTTAAGAGGGAAGTGGG - Intergenic
901161913 1:7184218-7184240 CAGAAACTGGGAAGGGTAGTAGG + Intronic
901257145 1:7839711-7839733 CAGAAACTGTGGAGGCCAGAGGG - Intronic
901344357 1:8526104-8526126 AAGCTAGTGTGCAGGGAAGTGGG + Intronic
901882372 1:12201875-12201897 CAGGAGGTGTGGATGGCAGTGGG + Intronic
901911870 1:12465328-12465350 CCAAAAGTGGGGAGAGAAGTAGG + Intronic
902214624 1:14926554-14926576 CAGAAAGGGTGAAGGGCAGTAGG - Intronic
903377413 1:22875616-22875638 GAGAAAGTGAGGAAGGAAGGAGG - Intronic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
904216132 1:28921417-28921439 CAAAAACTGGGGAGGGAAGGGGG - Intronic
904783919 1:32971378-32971400 CACAAAGGATGGAGGGAGGTGGG - Intergenic
904973556 1:34437895-34437917 TAGACAGGGTGGAGGGCAGTGGG + Intergenic
905146499 1:35891257-35891279 TAGAAAGTGTGAAGGTCAGTTGG + Intronic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
906056699 1:42923826-42923848 CAGAGTCTGTGGTGGGAAGTGGG + Intergenic
906149240 1:43578030-43578052 CAGAAAGGGTGGAGGAATCTTGG - Intronic
906260121 1:44380621-44380643 CAGAGAGCCTGGAGGGCAGTGGG - Intergenic
906660425 1:47577938-47577960 CAGAAGCTGGGGAGGGCAGTGGG - Intergenic
907526160 1:55055312-55055334 CAGAGAGTGGCGGGGGAAGTTGG + Intronic
907948483 1:59157357-59157379 CAGAAAGGGATGAGGGCAGTGGG + Intergenic
910700763 1:90071764-90071786 CAGAAAGTGTGAAGTCAAGGGGG + Intergenic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911189519 1:94933648-94933670 AAGTAGGTGTGGAGGTAAGTTGG + Intergenic
911631834 1:100192159-100192181 AAGACAGTGTAGAGGGAAGGGGG + Exonic
912623461 1:111188820-111188842 AAGGAAGTGTGGAGTGAAGGTGG + Intronic
912758823 1:112347821-112347843 CAGAAAGGGTGTAGGGAAATGGG + Intergenic
912840039 1:113031250-113031272 GACACAGTGTGGAGGGAATTTGG - Intergenic
913169836 1:116222015-116222037 GAGGAAGTGAGGAGGGAAGGAGG + Intergenic
913476927 1:119246554-119246576 CAGGAAGTGTGGAGAGAGGGTGG - Intergenic
914260188 1:145992573-145992595 CAGAAAGTGTGGGCTGAAGATGG - Exonic
914801075 1:150962999-150963021 CAGAAAGTGAGGGGGAAAGTGGG + Exonic
915204779 1:154261954-154261976 CCAAAAGTGTGGGTGGAAGTAGG + Intronic
915284023 1:154841643-154841665 CAGAAAGTTTGGAGTGAGGGGGG - Intronic
915291868 1:154889750-154889772 CAGACACTGTGGAGGGGAATGGG - Intergenic
915318820 1:155044815-155044837 CAGGAAGTCTGGAGGGAGGGCGG + Intronic
915432905 1:155880423-155880445 CAAAAAGTGTGCAGAGCAGTGGG - Intronic
915921332 1:159977962-159977984 CAGAAAGAGTGGTTAGAAGTGGG + Intergenic
916078629 1:161218171-161218193 CACAAAGTTTGGAGGGAAGGGGG + Intronic
916651379 1:166837863-166837885 CAGAAAGTGAGGAGGACATTAGG - Intergenic
917010991 1:170470680-170470702 AAAAAAGTGAGGAGGGAAGAAGG + Intergenic
917312939 1:173695775-173695797 CAGCCAGTGTGGAAAGAAGTTGG - Intergenic
919167618 1:193916057-193916079 GTGAGAGTGTGGAGGGAAGTAGG - Intergenic
919256021 1:195126241-195126263 GAGGAAGTTTAGAGGGAAGTAGG + Intergenic
921062151 1:211594344-211594366 CAAAAAGTGTCCAGGGTAGTGGG - Intergenic
921304570 1:213782883-213782905 CAGACAGGCTGGAGTGAAGTTGG + Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
922381119 1:225027571-225027593 CAGAAGGTGAAGAGGGAAGCAGG + Intronic
922421183 1:225462085-225462107 GAGAAGGTGTTGAGGGAAGGAGG + Intergenic
922951448 1:229561137-229561159 TAGAAAGTGTGGGGTTAAGTCGG + Intergenic
923433938 1:233950606-233950628 GAGAAAGGGTGGAGGGATGGAGG - Intronic
923836804 1:237619768-237619790 TAGAAAGTATGGAGGGCAGAAGG + Intronic
923867458 1:237955222-237955244 CAGAAAGGCAGGAGGAAAGTTGG - Intergenic
924185562 1:241485752-241485774 CAGAAAGAGTGGAGGGCAAGGGG - Intergenic
924286191 1:242489739-242489761 CAGAAAGTATTCAGGGCAGTTGG + Intronic
924300856 1:242636464-242636486 CAGAAGGTGAGCATGGAAGTAGG - Intergenic
924931221 1:248733876-248733898 CAGAAAGTGTGGGTGGCAGCGGG + Intronic
1062882515 10:989670-989692 AAGAAATGGTGGAGAGAAGTGGG - Intronic
1062891579 10:1064911-1064933 CAGAAATTGTGGAGGGCATAAGG + Intronic
1063517308 10:6709600-6709622 CAGAGGGTGAGGAAGGAAGTGGG + Intergenic
1064125994 10:12660617-12660639 CAGAAATGGTAGAGGGAAGTGGG - Intronic
1064812488 10:19216471-19216493 CAGGGAGTGGGGAGGAAAGTAGG - Intronic
1064942426 10:20749719-20749741 GAGAAAGTATCCAGGGAAGTGGG - Intergenic
1064981610 10:21172593-21172615 CAAAAAGAGTGTAGGGAACTGGG + Intronic
1065733822 10:28733134-28733156 AAAAAAAAGTGGAGGGAAGTTGG + Intergenic
1065875711 10:29995646-29995668 CAGAAATTCTTCAGGGAAGTAGG - Intergenic
1066130017 10:32384232-32384254 AAGAAAGGGAGGAGGGATGTTGG - Intergenic
1066731263 10:38439068-38439090 ATGAGAGTGTGGAGGGAAGGGGG + Intergenic
1067438775 10:46296658-46296680 AACACAGTGGGGAGGGAAGTTGG - Intronic
1068027336 10:51662881-51662903 CAGTAAGTGTGGAGTGTATTGGG + Intronic
1068067288 10:52147855-52147877 CAGCAAGTCTGGATGGAAGCTGG + Intronic
1069903291 10:71718212-71718234 CAGGTAGTGGGGAGGGGAGTGGG + Intronic
1072060150 10:91801796-91801818 CAGAATTTGTAGAGGCAAGTTGG + Intronic
1072859808 10:98991503-98991525 CAGACAGTGGGGAGTAAAGTGGG + Intronic
1072909858 10:99490545-99490567 CAGAAATTGTGCTGGCAAGTTGG + Intergenic
1073630290 10:105141404-105141426 CAGAGAGGGTGGAGGGAGATTGG + Intronic
1073993255 10:109287920-109287942 CAGGGAGGGTGGAGGAAAGTGGG - Intergenic
1074104750 10:110380873-110380895 CGGAAAGGGTGTAGGGAAATTGG - Intergenic
1075103580 10:119522769-119522791 CAAAAAGTGTGGAGGAACATAGG - Intronic
1075133404 10:119760275-119760297 CAGAAAGAGGGGAGGAAAGCTGG + Intronic
1075288196 10:121205132-121205154 CAAAAAGTGTGGAGGCCAGCAGG - Intergenic
1076457674 10:130612113-130612135 CAGAAAAAGTCAAGGGAAGTTGG - Intergenic
1076691478 10:132225795-132225817 CAGAAAGTGGGAAGGTGAGTTGG + Intronic
1076802216 10:132835951-132835973 CGGGAAGTGGGGAGGGGAGTGGG - Intronic
1077998012 11:7470503-7470525 GAGAAAGTGGGGATGGGAGTGGG + Intergenic
1078182911 11:9027538-9027560 CAGAAGATGTGGAGGGGAGCTGG - Exonic
1078625773 11:12956334-12956356 CAGGAAGTGTGGAGGGGAGGGGG + Intergenic
1079862315 11:25688746-25688768 CAGAAAGTGAGGAGGGAAAAGGG + Intergenic
1079966351 11:26984828-26984850 CAGAAAGTGGAAAGGGAAGCAGG - Intergenic
1081354991 11:42101755-42101777 CAGAATTTCAGGAGGGAAGTTGG + Intergenic
1081842279 11:46211372-46211394 CAGCCAGTGTGGGGTGAAGTGGG + Intergenic
1082807874 11:57461567-57461589 GGAAAAGCGTGGAGGGAAGTGGG + Intronic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1083854154 11:65384120-65384142 CAGCAAGGCTGTAGGGAAGTGGG - Intergenic
1084162406 11:67356914-67356936 AAGAAGGTGTGGAGGGTGGTAGG - Intronic
1084289322 11:68151717-68151739 AAGCAAGTGTGGAGGGCAGGCGG - Intergenic
1084358518 11:68654540-68654562 CAGAGGGTGTAGTGGGAAGTGGG - Intergenic
1084699752 11:70778802-70778824 CTGCCAGTGTGGAGGGCAGTAGG - Intronic
1085004618 11:73074925-73074947 CAGACAGTGGGGAGGGAGGGAGG + Intronic
1085143619 11:74171861-74171883 CAGGGAAGGTGGAGGGAAGTGGG + Intronic
1085823603 11:79819207-79819229 CAGAAAGCATGGAAGGAAGTGGG - Intergenic
1086434247 11:86765554-86765576 AACAAAGTGTGGAGGCAAATGGG + Intergenic
1087820384 11:102704906-102704928 GAGAAAGTGAGGAGTGAAGGAGG + Intronic
1087857470 11:103109549-103109571 TGGAAGGGGTGGAGGGAAGTTGG - Intronic
1088454982 11:110024061-110024083 AGGGAAGTGGGGAGGGAAGTGGG + Intergenic
1088454987 11:110024073-110024095 AGGGAAGTGGGGAGGGAAGTGGG + Intergenic
1089396624 11:118140335-118140357 TAGAAAGAGGGGATGGAAGTTGG - Intronic
1090267371 11:125361787-125361809 GAGGAAGTCTGAAGGGAAGTTGG + Intronic
1091170961 11:133519195-133519217 CAGAAAGTTAGGAAGAAAGTGGG - Intronic
1091459198 12:631040-631062 CAGAAAGGTTGGTGGGGAGTGGG + Intronic
1092159356 12:6307575-6307597 CAGTAAATGTGGAAGGAAGGGGG + Intergenic
1092531600 12:9349719-9349741 CAGGAGGTGTGGAGGGGAATGGG + Intergenic
1092702908 12:11252909-11252931 CAGAAAGTCAGGAGGGAGATTGG - Intergenic
1093618789 12:21262621-21262643 CAGAAACTTTGGAGGCAAGAAGG - Intergenic
1094532229 12:31287485-31287507 CAGGAATTGAGCAGGGAAGTGGG - Intronic
1094668613 12:32546646-32546668 CATAGAGCATGGAGGGAAGTAGG + Intronic
1095122211 12:38433159-38433181 GAGAAAGTGAGGAGGGGATTAGG - Intergenic
1095407601 12:41884749-41884771 CAGAGAGTGTGGATTTAAGTGGG - Intergenic
1096104174 12:48986875-48986897 CAGAGAGTGGGGAGGTGAGTGGG - Intergenic
1096625488 12:52892880-52892902 AAGGCAGGGTGGAGGGAAGTGGG + Intergenic
1097087659 12:56480399-56480421 CAGAGAATGGGGAGGAAAGTGGG + Intronic
1097187040 12:57201641-57201663 CAGACACTGGGGAGGGAAGCTGG - Intronic
1097335747 12:58381259-58381281 CAGAGAATGTGGAGGAAATTGGG + Intergenic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1098664452 12:73143880-73143902 TAGACACTGTGGTGGGAAGTAGG + Intergenic
1099485468 12:83224134-83224156 CAGAATGTGTGGCGGGGAGGGGG + Intergenic
1100470478 12:94888400-94888422 GAGAAGGGGTGGAGGTAAGTGGG - Intergenic
1100493525 12:95103531-95103553 CAGAAAGAATGGAGGGAGGGCGG - Intronic
1101036131 12:100708476-100708498 AAGAAAGTAAGGAGGGAAGAAGG - Intergenic
1101158787 12:101952966-101952988 CAGAAAGCTTTGAAGGAAGTTGG + Intronic
1101421047 12:104551358-104551380 CAGGTAGTGTGCAGGGAAGTTGG + Intronic
1101590296 12:106119534-106119556 CAGAAAATCTGTAGGGAAGCTGG + Intronic
1103192570 12:119014678-119014700 CAGGAAGTGAGGAGGTAAGAAGG + Intronic
1103484046 12:121270826-121270848 CAGATACTGTGGAGGGAACGGGG - Intronic
1103495316 12:121357584-121357606 CAGAAAGAATGGAGGGAGGGAGG + Intronic
1104332149 12:127856916-127856938 CAGAAAGTCTGGAGTCAAGAGGG + Intergenic
1104368625 12:128201431-128201453 CAGAAACTGTGGAGGCCAGAAGG + Intergenic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1105285102 13:18996950-18996972 CAGAAGGTGTGAAGGCAAGAAGG + Intergenic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106829611 13:33565218-33565240 CAGGAAGTGTAGAGGGAAGGGGG + Intergenic
1107664854 13:42678237-42678259 CAGAAAATGTGGAGGGATTCAGG - Intergenic
1108229773 13:48324372-48324394 CAGAAGCTGTGAAGGGTAGTGGG - Intronic
1109195682 13:59375548-59375570 CAAAATCTATGGAGGGAAGTGGG + Intergenic
1110748558 13:79085545-79085567 CAGAAATTGTGGGGGAAAGAGGG - Intergenic
1111060315 13:83010074-83010096 CAGAAGCTGTGAAGGGTAGTAGG - Intergenic
1111478762 13:88793321-88793343 AAGAAAGTATGGAGGTAATTTGG + Intergenic
1112557919 13:100486032-100486054 CAGAAACTGTGGGTGGTAGTGGG - Intronic
1114378703 14:22177367-22177389 AAGACAGTGGGGAGGGAAGAGGG + Intergenic
1115450613 14:33543133-33543155 CAGAAAGAGATGAGGGAAGGAGG - Intronic
1116745724 14:48816144-48816166 CAGGAAGGGTAGAAGGAAGTGGG + Intergenic
1117376653 14:55123779-55123801 AAAAAAGTGTTGGGGGAAGTTGG + Intergenic
1117738099 14:58787982-58788004 AAGAAAGAGAGGAGAGAAGTAGG - Intergenic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119862811 14:77948798-77948820 CAGGTAGTGGGGAGGGAAGGAGG - Intergenic
1120974441 14:90236265-90236287 GAGAGAGAGTGGAGGGAGGTAGG - Intergenic
1121244297 14:92451175-92451197 CAGAAAGTGTGGAGGGAAGTGGG + Intronic
1121244494 14:92452122-92452144 TAGAGAGTGTGGAAGGAAGTGGG + Intronic
1121322237 14:92998670-92998692 CACAAAGTTTGGGGGGAAATGGG + Intronic
1121766043 14:96486605-96486627 TAGAAAGTCTGGAGGGCATTGGG - Intronic
1121888953 14:97571601-97571623 CAGGAAGTTTAGTGGGAAGTGGG - Intergenic
1122022618 14:98851714-98851736 CAGGAAGTGAGCAGGGGAGTTGG - Intergenic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1125375006 15:39019489-39019511 CTGAAAGTGTGGTGGGACATTGG + Intergenic
1125431069 15:39593898-39593920 CAGACAGAGAGGAGGGAAGGAGG - Intronic
1125971892 15:43918455-43918477 CAGAAAAGGAGGAGGGAAGAAGG - Intronic
1126771284 15:52058845-52058867 CAGAATCTGTGTAGGGAAGCTGG + Intronic
1128272281 15:66321048-66321070 CAGAGAGTGTGGAGCTCAGTTGG - Intronic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130239372 15:82171715-82171737 TAGAGAGTGGGGAGGGAGGTTGG + Intronic
1130474447 15:84251658-84251680 CAGAAAGTGTGCAATGAAATGGG + Intergenic
1130481862 15:84365706-84365728 CAGAAAGTGTGCAATGAAATGGG + Intergenic
1131266511 15:90918614-90918636 CAGACAGTGCCCAGGGAAGTGGG - Intronic
1131894910 15:97016648-97016670 CAGAAACTGTGGAAGGGAGTGGG - Intergenic
1132242552 15:100269793-100269815 GGGAAAGTTTGGAGGGAACTTGG - Intronic
1132563168 16:608003-608025 AGGAACGTGTGGAGGGAGGTGGG - Intronic
1133663059 16:7937530-7937552 CAGTAAGTAAGGAAGGAAGTGGG - Intergenic
1133699041 16:8291947-8291969 TAGAAGGTATGGAGGGGAGTGGG + Intergenic
1134143889 16:11744711-11744733 CAGAAAGTGAAGAGGAAAGGAGG - Intergenic
1134857492 16:17532500-17532522 CACAAAGAGTGGAGGGAAGCTGG + Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1138195836 16:55051515-55051537 AAGGAAGTGGGGAGGGAAGGCGG + Intergenic
1138580828 16:57939573-57939595 CAGAAGCTGTGGGAGGAAGTTGG - Exonic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139375052 16:66491637-66491659 CAGACAGGGTGGAGGGATGGGGG + Intronic
1141076760 16:81013401-81013423 CAAGAAGAGTGGAAGGAAGTGGG + Intronic
1141149026 16:81551626-81551648 CAGACAGTGTGGAGAGAAAACGG - Intronic
1141700945 16:85641801-85641823 CAGCCAGTGAGTAGGGAAGTGGG - Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142005804 16:87689106-87689128 CGAAAGGTGGGGAGGGAAGTCGG + Intronic
1142252780 16:89000350-89000372 CAGCACGTGTGAAGGGAAGCAGG + Intergenic
1142713793 17:1737273-1737295 GAGAAACTGCGGAGGGAACTGGG + Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1142914912 17:3128461-3128483 CATAAAGTGTGGAGTGGAGGAGG - Intergenic
1143161786 17:4876707-4876729 CAGAAAGTGAGGATGGCACTTGG - Intronic
1143585546 17:7848633-7848655 CTGAGAGGGTGGAGGGAACTTGG - Exonic
1143837333 17:9702749-9702771 CAGATAGTGTGGAGGGTCATCGG + Intronic
1143978817 17:10850226-10850248 AAGAAAGTGAGGAGGGGAATTGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1147411841 17:40258711-40258733 CAGAAAGAGAGGAGGGAGGGAGG + Intronic
1148089318 17:45013333-45013355 GAGAAAGTGAGGAGGGAGGGAGG - Intergenic
1148371118 17:47100393-47100415 CAGAAAGGGGAGAGGGAAGCTGG + Intergenic
1148585413 17:48775196-48775218 CATAAAGTGAGTTGGGAAGTAGG - Intronic
1149931101 17:60756417-60756439 AAGAATGTGTGGATGGAAGGGGG - Intronic
1150922903 17:69502161-69502183 CAGGAAGGGAGAAGGGAAGTGGG - Intronic
1152008032 17:77694721-77694743 CAGGGAGTGGGGAGGGAAGGAGG - Intergenic
1153375168 18:4368955-4368977 CAGTAACTGTGGAGCAAAGTAGG + Intronic
1153747369 18:8193695-8193717 CAGAAAGTGTTGAGGGACCCAGG + Intronic
1155443922 18:25890966-25890988 CAGAAACTGGGAAGGGTAGTAGG + Intergenic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1156658236 18:39312993-39313015 AAGAAAATGGGGAGGGAAATTGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157741844 18:50100540-50100562 TAGAAAGTGGGGAGGGTGGTAGG - Intronic
1158068263 18:53439460-53439482 CAGCAAGTGTAGAGGGAGCTAGG - Intronic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159952064 18:74491895-74491917 CAGAAAATGTAGATGGAAGTGGG + Intergenic
1160107704 18:75993991-75994013 CAGAAAGAGAGGAGGGAAAAGGG - Intergenic
1160816155 19:1036691-1036713 CAGAGAGCGGGGAGGGAAGCCGG - Intronic
1161438362 19:4277467-4277489 CTGAAAGGGTGGGGGGAAGCGGG + Intergenic
1162157534 19:8689239-8689261 TTGAAAGTGGGGAGGGAAATTGG - Intergenic
1162232898 19:9282404-9282426 CAGTAAGTGTTGAGGGAAATAGG - Intergenic
1162441672 19:10696120-10696142 CAGCCAACGTGGAGGGAAGTGGG - Intergenic
1163457880 19:17419350-17419372 CACAAAGTGGGGAGGTAACTCGG + Exonic
1164582825 19:29445358-29445380 CCCAAAGAGTGGAGAGAAGTAGG - Intergenic
1164834598 19:31349415-31349437 CCGAACGTGCGGAGGGAAGAAGG + Exonic
1166129298 19:40736475-40736497 CAGCAAGTGTGCAGGCAGGTGGG + Intronic
1167022166 19:46885519-46885541 CAGAGAGAGAGGAGGGAGGTGGG - Intergenic
1167258618 19:48444861-48444883 AAGAGAGTGGGAAGGGAAGTTGG - Exonic
1167283631 19:48586330-48586352 CAGGAAGGGTGGAAGGAAGTTGG + Intronic
1167333113 19:48868558-48868580 GAGAAAGTGAGAAGGGAAATCGG - Exonic
1168109906 19:54186530-54186552 CAGGATGTGTGGAGGGGAGCAGG - Intronic
925397780 2:3548584-3548606 CAGTAACTGTGAAGGGAAATTGG - Intronic
926561113 2:14418649-14418671 CCAAAAGTGGGGAGGGAAGGAGG - Intergenic
926640422 2:15230021-15230043 CAGACACTATGGAGGGTAGTGGG + Intronic
926688900 2:15719207-15719229 CAAGAAGTGAGGAGGGAAGACGG + Intronic
926835653 2:17016598-17016620 CAGCAGGTGTGGAATGAAGTGGG - Intergenic
928012549 2:27623743-27623765 TAGAGAGAGTGGAGGGAAGGGGG - Intergenic
929120590 2:38480936-38480958 TAGAAACTGTGGAGAGAAGGGGG - Intergenic
929279918 2:40066538-40066560 CAAGAAGTGTGGAGTGAAGTGGG + Intergenic
929425264 2:41838739-41838761 CACATACTGTGGAGGTAAGTGGG - Intergenic
930250272 2:49027131-49027153 CAAAAATGGTGGAGAGAAGTTGG - Intronic
930434812 2:51327483-51327505 GAGAAAGTTAGCAGGGAAGTTGG - Intergenic
931021276 2:58047161-58047183 GAGAACTTGTGGCGGGAAGTTGG + Intronic
931186740 2:59959863-59959885 TAGAAAGTGTGGCAGGAACTGGG - Intergenic
931464385 2:62473913-62473935 CAGAAAGAGTGGAAGTAAGAGGG + Intergenic
932411385 2:71549911-71549933 CAGAAGGTGTTGAAGGAGGTGGG + Intronic
932580582 2:72990463-72990485 GAGAAAGTGTGGGAGGAAGCTGG + Intronic
932584645 2:73019983-73020005 CAGAAAACGTGCAGGGAAGAAGG + Intronic
932693094 2:73930148-73930170 CAGAGGGTGTGGTGGGAACTTGG + Intronic
932797463 2:74709284-74709306 CAGAAACTGTGGAGGCCAGAGGG + Intergenic
933247607 2:79993639-79993661 CAGGTAGTGTGGAGTGAAGAGGG + Intronic
933927307 2:87106050-87106072 CAGGGAGTGTGGAGGGAGGGAGG - Intergenic
935306399 2:101741140-101741162 GGGGAAGTGTGGAGGGTAGTAGG + Intronic
935309536 2:101769936-101769958 AGGAAAGTCTGGAGGGAAATCGG + Intronic
935597228 2:104888715-104888737 CTGAGAGTGGGGAAGGAAGTGGG - Intergenic
936399725 2:112156085-112156107 CAGGAAGCGTGAAGGGAAGGTGG - Intronic
936598422 2:113872080-113872102 GAGACAGTGTGGAGAGAAATGGG + Intergenic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
937033450 2:118761070-118761092 CAGAAGCTGGGGAGGGGAGTTGG + Intergenic
938109270 2:128553203-128553225 CAGAATCTGAGGAGGGCAGTGGG - Intergenic
939070979 2:137542265-137542287 CAGAAACCGTGGAGGCAAGAAGG + Intronic
939175299 2:138741023-138741045 AGGAAAATGTGGAGGGAGGTGGG - Intronic
940015220 2:149097377-149097399 AACACATTGTGGAGGGAAGTAGG + Intronic
940565357 2:155353566-155353588 AAGTACGTGTGGAGGGAAGGTGG - Intergenic
941653691 2:168120891-168120913 TAGCAAGTGTAGAGGGAAGGAGG - Intronic
941733263 2:168943943-168943965 CAGAAAGTGGGTAGAGATGTTGG + Intronic
942286395 2:174421708-174421730 CAGAAAATGGGGAGGGAACCTGG - Intronic
942378012 2:175356704-175356726 TAGCAAGTGTGGAGGGGAGTGGG + Intergenic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
944889768 2:204105252-204105274 CAGGCAGTGTGGGGGGCAGTGGG - Intergenic
945058800 2:205890708-205890730 CCAAAAGCGTGGAGGGAGGTCGG + Intergenic
946452100 2:219789082-219789104 GAGAGAGTGGGGAGGGAAGGAGG - Intergenic
946623838 2:221589910-221589932 GAGAAACTGTTGAGGGGAGTGGG + Intergenic
946766204 2:223043384-223043406 CAGGAAGTGGGGCAGGAAGTGGG - Intergenic
946865427 2:224038446-224038468 CAGAAATTCTGGAAGGAATTAGG - Intronic
947534642 2:230933189-230933211 CAGAGAGGGCGGAGGGAAGGGGG - Intronic
947926900 2:233929371-233929393 CAGAAGGTGAGAAGGGAAGGGGG + Intronic
947941874 2:234064011-234064033 CAGAAAGGAAGGAGAGAAGTTGG + Intronic
948674919 2:239591617-239591639 CAGGAGGTGTGGACGGCAGTGGG + Intergenic
948752578 2:240141087-240141109 CAGAAAGTGTGGGGTCAAGATGG + Intronic
948827387 2:240579240-240579262 CAGGAAGTGGGGAGGGCAGGAGG + Exonic
1168951755 20:1806951-1806973 CAGAAAGTGTGGAGGACTGGTGG + Intergenic
1169147411 20:3261931-3261953 CAGAAAATGTGGAAGGAGGGTGG + Intronic
1172071646 20:32261694-32261716 CAAAAGGGGTGGAGGGCAGTGGG - Intergenic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1172878092 20:38178297-38178319 TGGAGAGTGTGGAGGGAACTTGG + Intergenic
1173175652 20:40762940-40762962 CAGCAAGAGGGGAGGGAAATGGG + Intergenic
1174024878 20:47565730-47565752 AAGAAACTGAGGAGGGAGGTGGG + Intronic
1174216681 20:48921557-48921579 GAGAAGGTGGGGAGGGGAGTGGG - Intergenic
1175362232 20:58421704-58421726 AAGAAAGAGAGGAGGGAAGCAGG + Intronic
1175413344 20:58785691-58785713 AAGAAAGAGAGGAGGGAAGGGGG + Intergenic
1175605096 20:60306259-60306281 CAGATAAGGTGGAGGGAAGGAGG + Intergenic
1175696424 20:61106202-61106224 CAGAAAGGCTGGAGAGAGGTGGG + Intergenic
1176335434 21:5593540-5593562 CATAAAGTGAGAAGGGAAATAGG + Intergenic
1176392323 21:6227408-6227430 CATAAAGTGAGAAGGGAAATAGG - Intergenic
1176469096 21:7088766-7088788 CATAAAGTGAGAAGGGAAATAGG + Intergenic
1176492657 21:7470544-7470566 CATAAAGTGAGAAGGGAAATAGG + Intergenic
1176507985 21:7667839-7667861 CATAAAGTGAGAAGGGAAATAGG - Intergenic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1178327327 21:31656613-31656635 AAGAAAGGGAGGAGGGAAGGAGG - Intergenic
1178522252 21:33296167-33296189 CAAAAACTGTGGAGGGAAAGAGG - Exonic
1178758459 21:35376519-35376541 CTGAAAGAGTGGAAGGAAGCCGG - Intronic
1179031537 21:37724555-37724577 TAGTGAGTGTGGAGGGGAGTGGG + Intronic
1179042326 21:37815105-37815127 CAGAGACTGGGGAGGGTAGTGGG + Intronic
1179359239 21:40689968-40689990 CAGCCAGTGTGGAGGGAGGGAGG + Intronic
1180157628 21:45985811-45985833 CACCAACTCTGGAGGGAAGTGGG - Intronic
1180836156 22:18930517-18930539 CAGTGAGTGTAGAGGGCAGTTGG + Intronic
1180868497 22:19133284-19133306 CAGGAAGTGGGGAGGGAGGGGGG - Exonic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1181000809 22:19987057-19987079 CAGACAGGTTGGAGGGAAGTTGG - Intronic
1181595747 22:23913520-23913542 CAGAAAGGTGGGTGGGAAGTGGG - Intergenic
1181770208 22:25119743-25119765 CAGAAAGTTTGGAGGGACATTGG + Intronic
1181828386 22:25538441-25538463 CAAAAAGTGGGGAGGGAGGTAGG + Intergenic
1182237985 22:28891665-28891687 AAGAAAGTGTGAAGTGAAGCGGG - Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183016254 22:34990141-34990163 TAGAAAGTATGGAGGGAATAAGG + Intergenic
1183085831 22:35486413-35486435 AAGAGAGTGTGGAGGTAAGGAGG - Intergenic
1183486025 22:38088222-38088244 CAGAAAGTGCGGAGGACAGCAGG - Intronic
1183583304 22:38738269-38738291 CAAAGAGAGCGGAGGGAAGTGGG + Intronic
1183601979 22:38845003-38845025 GATAAAGTGTGGAGGATAGTAGG - Intergenic
1183746258 22:39693810-39693832 CAGAAAGAGAGGAGGGGAGATGG - Intergenic
1183912772 22:41091881-41091903 CAGAGAGTGCGGAGGGGAGTCGG + Exonic
1184564046 22:45280841-45280863 TAGAAAGTGGGGAGGGAGTTTGG - Intergenic
1184998747 22:48228790-48228812 CAGAAAGTGTGGACCAAATTGGG + Intergenic
1185027929 22:48426158-48426180 CAGGAAGTGTGTAAGGAAGGTGG - Intergenic
1185159524 22:49214836-49214858 CCCAAAGTGCGGAGGGCAGTGGG - Intergenic
1185413712 22:50698570-50698592 GAGAAAGTGGGAAGGGAAGGAGG + Intergenic
1203286248 22_KI270734v1_random:155816-155838 CAGTGAGTGTAGAGGGCAGTTGG + Intergenic
950381644 3:12620447-12620469 AAGAAAGTGTGGATGGAGGAAGG - Intronic
950723222 3:14899255-14899277 CAGAGAGATGGGAGGGAAGTGGG - Intronic
950998403 3:17529492-17529514 GAGAAAGGGTGGGGGGAAGAGGG + Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
952075048 3:29685844-29685866 CAGAAGGTGTGGGGAGAGGTGGG - Intronic
953008058 3:38996230-38996252 CAGAAAGGGTGGATGGACATAGG + Intergenic
953012809 3:39043666-39043688 CAGAAACTGGGAAGGGTAGTTGG + Intergenic
953114344 3:39977158-39977180 GATAACGTGAGGAGGGAAGTGGG - Intronic
953629968 3:44605839-44605861 CAGAAGCTGGGGAGGGTAGTGGG + Intronic
953771317 3:45780296-45780318 CAGAAGGTGAGGAGGGAGGTTGG - Intronic
954143344 3:48621610-48621632 CAAAGAGTGTGGAGGGCTGTAGG - Exonic
954384499 3:50237146-50237168 CAGGAAGGGTGGAGGGATCTGGG - Intronic
954386410 3:50246328-50246350 GAGACACTGTGGAAGGAAGTGGG - Intronic
955873027 3:63459932-63459954 CGGAAATTGTGGAGGGAAAATGG - Intronic
956045275 3:65189565-65189587 CAGAAATTGTCAAGGGAAGGGGG - Intergenic
956679651 3:71766483-71766505 CAGAAGGGGTGGAGGTAGGTGGG + Intergenic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
958969365 3:100594317-100594339 CAGAGAGTGGGAAGGGTAGTGGG - Intergenic
959776352 3:110168763-110168785 CAGAAAATGTGGATGCAAGTAGG - Intergenic
959932970 3:112002820-112002842 CAGCAAGTGTGGAGGAGTGTAGG + Intronic
960973393 3:123154842-123154864 CTGACAGTGTGGCGGGCAGTGGG + Intronic
961624148 3:128247959-128247981 CAGTAAGTGTGGAAGAAAGCTGG + Intronic
961768303 3:129229228-129229250 CAGGAAGTGGGGAGGGAACTGGG - Intergenic
961853066 3:129840922-129840944 CAGAAAATGTGGAGTGACTTTGG + Intronic
962201950 3:133407573-133407595 AAGAAAGAGTGGAGGGGAGGAGG + Intronic
963211219 3:142693655-142693677 CACAAAGTGAGCAGGGATGTGGG - Intronic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG + Intronic
964852768 3:161112794-161112816 CAGAAAATGTGGAGGGCAAAAGG + Intronic
965556048 3:170019416-170019438 CAAAATGTGTGGGAGGAAGTGGG + Intergenic
967452985 3:189648228-189648250 GAGAATGTGTGAAGGGAAGGGGG - Intronic
968488929 4:879759-879781 CAGAAAGGGAAGAGGGAAGCGGG - Intronic
968498875 4:934986-935008 CTGAAAGTGAGAGGGGAAGTAGG + Intronic
969325338 4:6440870-6440892 CAGGAAGGGTGTAGGGAAGTGGG + Intronic
970445131 4:16117003-16117025 TAGGAAGTGGGGAGGAAAGTAGG - Intergenic
971059050 4:22946617-22946639 GATAAGGTGAGGAGGGAAGTGGG + Intergenic
973138344 4:46734259-46734281 CAGAAACTGTGGAGACAAGAAGG + Intergenic
975413096 4:74077949-74077971 GAGACACTGTGGAGGGAAGGAGG + Intergenic
976410136 4:84703764-84703786 CAGAAAGGGGGATGGGAAGTGGG - Intronic
976535585 4:86211392-86211414 CAGAAACTTTGGAGGGCAGAAGG + Intronic
977226574 4:94398894-94398916 CAGAAATGGAGGAGGGAAGAGGG - Intergenic
977407558 4:96619359-96619381 CAGAAAGGGTGGAGGAAGGGAGG - Intergenic
977758991 4:100708081-100708103 GTGAAAGTGTGGAGGGAAGGAGG + Intronic
978009559 4:103663034-103663056 CAGAAAGTAAAGAGGGAAGGTGG + Intronic
978343202 4:107739029-107739051 CAGAAAGAATGGAAGGAAGCTGG + Intergenic
979125722 4:116969525-116969547 CTGAAAATGTGGAGGCAACTTGG - Intergenic
979388410 4:120098129-120098151 CAGTCACTTTGGAGGGAAGTGGG + Intergenic
979972286 4:127150362-127150384 CAGATAGGGTGGAGCCAAGTGGG - Intergenic
980899648 4:138892605-138892627 CAGAAAGTGTGGGCGAAAATGGG - Intergenic
981031202 4:140127423-140127445 CAGAAAGTGTGGAGGGAATTTGG + Intronic
981342961 4:143643647-143643669 CAGAGACTGGGGAGGGCAGTTGG + Intronic
981406298 4:144373780-144373802 TAGAAAGAGTTGAGGGAAGAAGG - Intergenic
982326107 4:154129438-154129460 CAAAACGTTTGGAGGGAAATTGG + Intergenic
984409840 4:179382991-179383013 CATAAAGTGTGGAGGCAATGAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985236698 4:187883169-187883191 CAGGAAATGCGGAGGGCAGTGGG + Intergenic
985870715 5:2553801-2553823 CAGAAAGGGTGTAGGGAACAAGG - Intergenic
986084108 5:4425854-4425876 CACAACATGTGGAGGGCAGTGGG - Intergenic
986154045 5:5155937-5155959 CAGAAAGTGAGGAGGCAGATAGG + Intronic
986283302 5:6341002-6341024 CAGCAAGTGGGGTGGGAAGGGGG + Intergenic
988353624 5:30143896-30143918 CAACAAGTGTAGAGTGAAGTGGG + Intergenic
989099487 5:37810914-37810936 CCGTGAGTGTGGAGTGAAGTAGG - Intergenic
989171838 5:38479077-38479099 CGGGAAGAGGGGAGGGAAGTTGG - Exonic
989301673 5:39902529-39902551 CAGAAAGAAGGGAGGAAAGTGGG - Intergenic
990074080 5:51820960-51820982 CAGAAAGTGGGGAGGGATGCAGG - Intergenic
990292985 5:54373667-54373689 CAGAAACTTTGGAGGTAAGAAGG - Intergenic
990766198 5:59186056-59186078 GAGAAAGAGAGGAGGGAAGAAGG - Intronic
991245885 5:64507455-64507477 CTGAAAGGGTGAGGGGAAGTAGG + Intronic
991593661 5:68280101-68280123 CAGAATGTGTTGAGGGAAGATGG + Intronic
992833298 5:80616307-80616329 CAGAAAGTGTCTTGGGAAGAAGG - Intergenic
992848963 5:80784684-80784706 TTTAAAATGTGGAGGGAAGTGGG - Intronic
994021047 5:95026446-95026468 CAGAGAGTGGGAAGGGTAGTTGG - Intronic
994390737 5:99190076-99190098 CAGAAGGTGGGAAGGGTAGTGGG - Intergenic
994933192 5:106216667-106216689 GAGAAAGTTATGAGGGAAGTGGG - Intergenic
996732079 5:126726124-126726146 GAGAGAATGAGGAGGGAAGTAGG + Intergenic
998375388 5:141687178-141687200 AAAAATGTGAGGAGGGAAGTGGG - Intergenic
998502519 5:142645841-142645863 CAGTGACTGTGGAGGGAGGTTGG - Intronic
999498733 5:152125666-152125688 AAGAAAGAGTGGAGGGCTGTGGG - Intergenic
1001839084 5:174858151-174858173 CAGAAAGTTTGGAGGCTAGAAGG - Intergenic
1001949716 5:175807803-175807825 AAGGAAGAGGGGAGGGAAGTGGG + Intronic
1002048152 5:176553570-176553592 AAAAAAGTGAGGAGGGAGGTAGG + Intronic
1002886826 6:1304558-1304580 CAGAAAGGTGGGAGGGAAGTAGG + Intergenic
1003244731 6:4374274-4374296 AAGAAAATCTGCAGGGAAGTTGG - Intergenic
1004367989 6:15028080-15028102 AAGAAAGTGGGGAGGGTAGGAGG + Intergenic
1004979721 6:21009830-21009852 CAGAAAGTGGAAAGGGAGGTAGG + Intronic
1005161695 6:22871527-22871549 CAGAAAGGCTGGAGGGGAGCTGG + Intergenic
1005265218 6:24105262-24105284 GAGAGTATGTGGAGGGAAGTGGG - Intergenic
1005503007 6:26446216-26446238 CAGAAAGTGTGACAGGCAGTGGG + Intronic
1005636847 6:27761071-27761093 AAGAAACTGTGGAGTGAGGTGGG - Intergenic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1006920751 6:37625666-37625688 CAGAAAGAAGGGAGGGAAGAGGG - Intergenic
1007178798 6:39913724-39913746 AGGGCAGTGTGGAGGGAAGTCGG + Intronic
1007277860 6:40688922-40688944 GAGAAGGCTTGGAGGGAAGTAGG - Intergenic
1007840625 6:44713089-44713111 CAGCAAGGTTGGGGGGAAGTTGG - Intergenic
1008013025 6:46489236-46489258 AAGAAAGAGTGGAGGGAATCTGG - Intronic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1011106362 6:83786087-83786109 CTGAAAGTCTGGAGGGCATTTGG + Intergenic
1012066916 6:94559665-94559687 ACGAAAATGTGGAGGGAAGAAGG + Intergenic
1012848271 6:104417380-104417402 CAGAAAGTGTGAAAGGAAAAGGG - Intergenic
1012978201 6:105802538-105802560 CTGAAAGTGTGGAAGTAGGTAGG - Intergenic
1014613214 6:123569420-123569442 CAGAAAATGTGGAAGCAACTTGG - Intronic
1017359002 6:153543660-153543682 AAGAAAGACTAGAGGGAAGTGGG - Intergenic
1017912930 6:158810331-158810353 GGGTAAGTGTGGAGGGATGTGGG - Intronic
1017945141 6:159090495-159090517 GAGAAAGGGTGGAGTGAAGCAGG - Intergenic
1018627196 6:165791545-165791567 CAGAAAGTGTGGACAGAAATCGG - Intronic
1018691971 6:166353701-166353723 AAGAAAGTGTGGAAGAAAGAAGG - Intergenic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1019566682 7:1685150-1685172 CAGAAACTATGGAGGAAAGAAGG - Intergenic
1020223207 7:6257838-6257860 CAGGAAGTGTGGAGGTAGGGAGG + Intronic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1022659100 7:32349398-32349420 GGGAGAGTGTGGAGGGAAATGGG + Intergenic
1023314734 7:38923912-38923934 CAGAAAGTGTGGTGGCATATGGG - Intronic
1023979293 7:45057821-45057843 CATAAGGTGAGGATGGAAGTGGG - Intronic
1024970530 7:55065682-55065704 CAGAAGGTGTTGGGGGAATTAGG + Intronic
1024977327 7:55125949-55125971 CTGAGAGTGTGAGGGGAAGTGGG - Intronic
1025267898 7:57481268-57481290 CAGCAGGTGTGCACGGAAGTGGG - Intergenic
1026421614 7:70242967-70242989 CTGAATGTGTGGAAGGCAGTAGG - Intronic
1026622429 7:71961799-71961821 CAGAAAGTATGCAGGGGAGGAGG - Intronic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1028122441 7:87071321-87071343 CAGAAACTGAGGAGTGAAGTGGG - Intergenic
1028617728 7:92788780-92788802 CAGAAACTATGGAGGGCAGAAGG + Intronic
1029144222 7:98434358-98434380 CAGACAGTGCCGGGGGAAGTGGG - Intergenic
1030103047 7:105962883-105962905 CAGAAACAGGGGTGGGAAGTGGG - Intronic
1030109713 7:106016543-106016565 CAGAAAGTGAAGCTGGAAGTGGG - Intronic
1030424441 7:109356285-109356307 CAGAAAGAAAGGAGGGAAGGAGG + Intergenic
1031859524 7:126962004-126962026 GAGAAAGAGTGTAGGGAAGAAGG - Intronic
1032161373 7:129513520-129513542 AATAGAGTGTGGAGGGAAGGAGG - Intergenic
1032790937 7:135242022-135242044 CAGGAAGTAAGGAGGGAAGAAGG + Intronic
1034439035 7:151077229-151077251 CAGGAAGTCTGGAGGGGAGCAGG + Exonic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1035986375 8:4436672-4436694 CAGAAGCTGTGTAGGGTAGTAGG - Intronic
1037178097 8:15970930-15970952 CAGCAAGTTTGCAGGCAAGTTGG + Intergenic
1037339650 8:17830981-17831003 AAGAAAGGAGGGAGGGAAGTGGG + Intergenic
1037352564 8:17976910-17976932 CTGAAACTGTGAAGAGAAGTAGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037475321 8:19251465-19251487 CAGAGAGTGGAGAGGGAAGTGGG + Intergenic
1038678439 8:29644593-29644615 CAGAAAGGGAGGGGGGAAATTGG + Intergenic
1039228491 8:35417238-35417260 CAGAAGGTGAGAAGGGTAGTGGG - Intronic
1040077676 8:43255710-43255732 AAGAAAGTGAGGAAGGAAGAAGG + Intergenic
1040455467 8:47593663-47593685 GAGAAAGTGAGGAGTGGAGTGGG + Intronic
1041568906 8:59313574-59313596 CAGAGAGGGTGGAAGGAAGATGG - Intergenic
1041576031 8:59396303-59396325 CAGAAGGTGGGGAGGGAACTGGG - Intergenic
1042745111 8:72098787-72098809 CTGAAAGAATGGAGGGAAGCTGG - Intronic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1045064958 8:98436421-98436443 GAGCAAGTTTGGAGTGAAGTGGG - Intronic
1045895796 8:107215116-107215138 GAAAAAATGTGGAGGGGAGTGGG - Intergenic
1046383818 8:113483803-113483825 CAGAGAGTGGGGAAGGAAGTGGG - Intergenic
1046519262 8:115303315-115303337 CAGAAAGTGTGGACAGAGCTTGG - Intergenic
1047188106 8:122653968-122653990 GAGAAGGTGTGGTGGGGAGTGGG - Intergenic
1047278344 8:123423248-123423270 CAGAAAGAAAGGAGGGAAGGAGG - Intronic
1047330212 8:123880173-123880195 TGGGAAGAGTGGAGGGAAGTTGG - Intronic
1047535941 8:125719650-125719672 CAGAAGGTGTGGAATGAAGAAGG - Intergenic
1047553902 8:125908130-125908152 TAGAAAGAGTTGAGGAAAGTGGG - Intergenic
1048336244 8:133504490-133504512 CTGAAAGTGGGTAGTGAAGTGGG + Intronic
1048629432 8:136225921-136225943 CAGCAATTGCAGAGGGAAGTTGG - Intergenic
1049701042 8:144012745-144012767 AAGAGAGTGAGGAGGGAAGTGGG + Intronic
1050405995 9:5309260-5309282 CAGAGAGTGAGAAGGGATGTGGG - Intergenic
1050496200 9:6245093-6245115 GAGAAAGTGTTGATGGATGTGGG - Intronic
1052238661 9:26245729-26245751 CTGAATATGTGGAGGGCAGTGGG + Intergenic
1053255500 9:36613805-36613827 TAGCAAGTGAGGAGGGCAGTAGG + Intronic
1054716235 9:68560068-68560090 CTGAAAGTGTGAAGGAAAGCAGG + Intergenic
1055673614 9:78632394-78632416 CGCAAAGTGCGGTGGGAAGTTGG + Intergenic
1056084639 9:83134148-83134170 CAGAAAGTCTGGATGTAAGTGGG - Intergenic
1056965166 9:91159365-91159387 AAGAAAGAGAGGAGGGAAGGAGG + Intergenic
1057791583 9:98128275-98128297 CAGACAGTGAGGAGGGTGGTAGG + Intronic
1058207081 9:102121798-102121820 AAGAAAGTTTGGAGCGAACTGGG - Intergenic
1060147992 9:121268393-121268415 CAAAGAGTGTGGATGGGAGTTGG + Intronic
1061764534 9:132873419-132873441 CTGACAGTGGGGAGGGAGGTGGG + Intronic
1203426202 Un_GL000195v1:41362-41384 CATAAAGTGAGAAGGGAAATAGG - Intergenic
1186519565 X:10193501-10193523 CAGAGAGTGAGGAGGAAAGCAGG + Intronic
1186900283 X:14047522-14047544 CAGAAACTGGGGAGGGAATGGGG - Intergenic
1187617434 X:21012596-21012618 CAGAAACTGGGAAGGGTAGTGGG + Intergenic
1187664056 X:21584542-21584564 CAGAAAGTATTGAGGGCAATTGG + Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1189667351 X:43370952-43370974 CAGAGAGTGGGGAGGGAGGGAGG + Intergenic
1190734093 X:53243775-53243797 TAGGAAGAGTGCAGGGAAGTGGG + Intronic
1191834889 X:65454000-65454022 CAGAAAGGGTGGAGCCAAGATGG + Intronic
1192070153 X:67930336-67930358 CAGAAATTGGGAAGGGTAGTAGG + Intergenic
1192633474 X:72794889-72794911 CAGAAGCTGGGGAGGGAAGGGGG - Intronic
1192648235 X:72925912-72925934 CAGAAGCTGGGGAGGGAAGGGGG + Intronic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1193326600 X:80185163-80185185 TATAAAGTGGGGAGGGAAATGGG - Intergenic
1193494201 X:82190120-82190142 CACAAGGTGTGGAGGGAAAGTGG + Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193765286 X:85521341-85521363 CAGAAGGTGGGAAGGGTAGTGGG - Intergenic
1194010532 X:88555001-88555023 AACAAAGTGGGGAGGGAAGGTGG - Intergenic
1194155763 X:90386763-90386785 CAGAAACTTTGGAGGGAAAAAGG + Intergenic
1194328698 X:92554885-92554907 TGGAAAGTTTGGTGGGAAGTGGG - Intronic
1194821236 X:98509729-98509751 CAGGAAGTGTGGGTGGAAGTAGG + Intergenic
1195772321 X:108364573-108364595 CAGAAAGGTGGGAGGGGAGTGGG - Intronic
1196562137 X:117162563-117162585 CAGAAAGTGTGAAGTGAGATAGG + Intergenic
1196748336 X:119091934-119091956 CAGAAAGTGGGAAGGGTAGGAGG + Intronic
1197439513 X:126472324-126472346 AAGAAAGTGTTGTGGGAAGAAGG - Intergenic
1199062870 X:143379671-143379693 CAGAAAATGTGGCTGGAAATGGG - Intergenic
1199734748 X:150675242-150675264 CAGAGACTGAGGAGGGTAGTGGG + Intergenic
1200409881 Y:2850694-2850716 CAAAAAATGTGGAGGACAGTTGG + Intronic
1200502110 Y:3963706-3963728 CAGAAACTTTGGAGGGAAAAAGG + Intergenic
1200637405 Y:5674082-5674104 TGGAAAGTTTGGTGGGAAGTGGG - Intronic
1201123475 Y:10892386-10892408 GAGAAAGTGTGGAATGAAATGGG - Intergenic
1202376543 Y:24243209-24243231 CAGAAAGTGTGCAATGAAATGGG - Intergenic
1202494237 Y:25426910-25426932 CAGAAAGTGTGCAATGAAATGGG + Intergenic