ID: 1121244807

View in Genome Browser
Species Human (GRCh38)
Location 14:92454011-92454033
Sequence GGTCCTGGGTCCAAACTTAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121244807_1121244809 -10 Left 1121244807 14:92454011-92454033 CCAATAAGTTTGGACCCAGGACC 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1121244809 14:92454024-92454046 ACCCAGGACCCGACTACGGATGG 0: 1
1: 0
2: 0
3: 4
4: 26
1121244807_1121244813 -2 Left 1121244807 14:92454011-92454033 CCAATAAGTTTGGACCCAGGACC 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1121244813 14:92454032-92454054 CCCGACTACGGATGGCCAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 33
1121244807_1121244816 14 Left 1121244807 14:92454011-92454033 CCAATAAGTTTGGACCCAGGACC 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1121244816 14:92454048-92454070 CAGCAGGATCATCATTAATGAGG 0: 1
1: 0
2: 0
3: 8
4: 145
1121244807_1121244817 30 Left 1121244807 14:92454011-92454033 CCAATAAGTTTGGACCCAGGACC 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1121244817 14:92454064-92454086 AATGAGGTGAGTTTGCTTGAAGG 0: 1
1: 0
2: 3
3: 14
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121244807 Original CRISPR GGTCCTGGGTCCAAACTTAT TGG (reversed) Exonic
900702624 1:4057765-4057787 GCTCCTGGGGCCAAACTGTTGGG + Intergenic
902053351 1:13581350-13581372 GGTCCTGGGTCCCCACTTTGAGG - Intergenic
918638338 1:186807155-186807177 GGTCTTTGGTCCCTACTTATAGG - Intergenic
1075633485 10:124015423-124015445 GGTCCTGGCTCCAAGGGTATTGG - Intronic
1077917553 11:6621419-6621441 GGAGCTGGGTCCAAACATGTTGG + Exonic
1084656121 11:70519859-70519881 GGTCCTGGGTCCCAGCTACTTGG - Intronic
1095092493 12:38120214-38120236 GGTCCTGGTTCCACACTTGGAGG - Intergenic
1096857883 12:54498200-54498222 GGTCTGGGGTCCAACCTTCTGGG + Intronic
1107570634 13:41654398-41654420 GGTCCTGGGGCCAAAAATGTTGG - Intronic
1112171540 13:96977455-96977477 GGCCATGGGTCCAAGCTTAAGGG + Intergenic
1113785509 13:113000263-113000285 AGCCCTAGGTCCAAACTTACAGG + Intronic
1118429183 14:65698872-65698894 TGTCCTTGTTCCAGACTTATGGG + Intronic
1121244807 14:92454011-92454033 GGTCCTGGGTCCAAACTTATTGG - Exonic
1122964879 14:105118357-105118379 GGTCCTGGAGCCAAACATAGGGG - Intergenic
1128099730 15:64989224-64989246 GGTCCTGTCTCCAAAATTACTGG + Intronic
1129049701 15:72770310-72770332 GGTCCTGGGACCAGTCTGATTGG - Intronic
1129535529 15:76311196-76311218 GGACTTGGGTCCAAAGTTCTGGG - Intronic
1131767306 15:95692494-95692516 GGTTCTGTATCCAAACTGATGGG - Intergenic
1134626310 16:15725202-15725224 GGGCCAGGGTCCCAACTCATAGG - Exonic
1139984462 16:70886690-70886712 GATTCTGGGTCCACAGTTATTGG + Intronic
1140186484 16:72777461-72777483 GTTCCTGTGTTCAAACTTTTTGG + Intergenic
1144057939 17:11558485-11558507 GGTCCTGGGTCTAAGTGTATTGG - Exonic
1145017255 17:19407559-19407581 GGTCCTGGGTCCATGTCTATGGG - Intergenic
1150723486 17:67633210-67633232 GGCCCTGATTCCAAACATATTGG - Intronic
1163163394 19:15479272-15479294 AGTCCTGGGACCAAACCTCTTGG - Intronic
1168071846 19:53957924-53957946 GGTCTTGGGTCCAAATTTCACGG - Intergenic
929146385 2:38710253-38710275 GGTCCTAGGTCCACACTTGGAGG + Intronic
929726342 2:44432003-44432025 GGTCCTGGGTCCAAAAATCTTGG + Intronic
929855860 2:45638264-45638286 GGTCCTGGAGCCAAACTTAGTGG + Intergenic
935151578 2:100441315-100441337 GGTCCTGGGCCAAAAATTGTGGG + Intergenic
937868775 2:126772899-126772921 GGTCCTGGGTCCAAAGCTCTTGG - Intergenic
945795501 2:214357928-214357950 AATCCTGGGTCCAAACTCTTAGG + Intronic
946541913 2:220694062-220694084 AGTCCTGGGCCCAAGCTTTTGGG + Intergenic
1173087563 20:39938736-39938758 GTTCCTGGGTCCAAAGTTGAAGG + Intergenic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1176178268 20:63738628-63738650 GGTCCTGGGTCCCTCCTTTTAGG - Exonic
1181338150 22:22156968-22156990 GCTCCTGGGTCCATACTCACTGG + Intergenic
1181694342 22:24585447-24585469 GGTCCTGGGTCCATCCCTGTGGG - Intronic
950636800 3:14321242-14321264 GGTCCTGGGTCCTAGGTTACTGG + Intergenic
953195168 3:40725306-40725328 GTTCCTGGCTCCAAACATCTTGG - Intergenic
956843731 3:73163285-73163307 AGTTCTGAGACCAAACTTATGGG + Intergenic
962978746 3:140469165-140469187 GGTCCTAGCTCCAAATATATTGG + Intronic
963167377 3:142219220-142219242 AGTCCTGTGTACAACCTTATAGG - Intronic
964750665 3:160051087-160051109 GGTCCTGGGTACAAACAGACAGG + Intergenic
966881129 3:184351925-184351947 TGGCCTGAGTCCAAACTTGTAGG + Intronic
971350138 4:25848363-25848385 TGCCCTGGCTTCAAACTTATGGG - Intronic
976759062 4:88528592-88528614 GGTCCTAGGTCCAGGCTCATGGG + Intronic
977187779 4:93961808-93961830 GGTCCTTAGTCCAAACTTTGAGG - Intergenic
978845850 4:113271853-113271875 GGACCTGGGTGCAAACACATTGG - Intronic
979521448 4:121672211-121672233 GGTCCTGGGTACCAACCTCTAGG + Intronic
984386117 4:179060055-179060077 GGCCCTGGATCCACAGTTATAGG - Intergenic
990475854 5:56161099-56161121 GAGCCAGGGTCCAAACTTCTGGG - Intronic
997434095 5:133861702-133861724 GGTCCTGAGTCAAAACCTACAGG - Intergenic
1001575196 5:172758683-172758705 GGTCCTGGGTCCAAGCTAGGCGG - Intergenic
1003349429 6:5302148-5302170 GTTCCTAGGACCAAACTTAGGGG - Intronic
1012820034 6:104074906-104074928 GTTCCTGGGTTCACACTTGTAGG + Intergenic
1014601929 6:123423924-123423946 GGTCATGGGCCCACACTCATGGG + Intronic
1019301690 7:307553-307575 GGTCCAGGGTCCACACTTTTAGG + Intergenic
1026842746 7:73679563-73679585 CATCCTAGGTCCAAACTTCTAGG + Intergenic
1033397864 7:140992932-140992954 GGTCCTGGGTCCAACCTAAAAGG + Intergenic
1043763109 8:84094745-84094767 GGTCCTGGGTTCAATTTTAGTGG - Intergenic
1047317037 8:123744483-123744505 GGTTCTGTATTCAAACTTATGGG - Intergenic
1055950491 9:81725429-81725451 GGTCCTGGGTGCAGAGTCATGGG + Intergenic
1059769149 9:117411677-117411699 GGTCCTGGGACCAGAATTAGTGG - Intronic
1060054010 9:120397911-120397933 GGTCCAGGGCCCACACTTATGGG + Intronic
1185945164 X:4367629-4367651 GGCCATGGGTCCAGACTTAAGGG - Intergenic
1186263023 X:7801314-7801336 GGTCCTCAGTGCAAACTCATGGG - Intergenic
1188343633 X:29036870-29036892 GGTTCTAGGTTCAAATTTATAGG - Intronic
1192596340 X:72412454-72412476 GGTACTGGGTACAAGCTTATAGG + Intronic
1192807523 X:74523572-74523594 GGTCCTGGCTTAAAACTCATAGG - Intronic
1196350015 X:114717858-114717880 AGTCCTGGGTACAAAGTAATTGG - Intronic
1196591048 X:117485417-117485439 GCTCCTGGGTCCACAATTTTAGG - Intergenic