ID: 1121245567

View in Genome Browser
Species Human (GRCh38)
Location 14:92458982-92459004
Sequence TCTCCACCCCTTGAAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121245567 Original CRISPR TCTCCACCCCTTGAAGTGGG TGG Intronic
900584225 1:3424755-3424777 CCTCCACCCCTCGAGGTGGCTGG - Intronic
901051901 1:6429551-6429573 TCTCCTCTGCTTGAAGTGAGGGG - Intronic
902482334 1:16718463-16718485 TCTCCTCTGCTTGAAGTGAGGGG + Intergenic
902999569 1:20255348-20255370 TCTCCACACCTTGCAGTGCACGG - Intergenic
904413020 1:30336328-30336350 TCTCCACCCCATGAGGAGGCAGG - Intergenic
905116301 1:35643659-35643681 CCTCAACCTCTTGAAGTGGCTGG - Intergenic
905785942 1:40757653-40757675 TCTGTCCCCCTTGAAGTGGTGGG + Intronic
906179331 1:43804874-43804896 CCTCCACCCCTTGCAGTGAGGGG - Intronic
906561372 1:46760328-46760350 TCTTCACCCTCTGAAGTTGGGGG - Intronic
908702841 1:66920625-66920647 GCTCCACCCCTTGAGGGAGGTGG - Intronic
911195815 1:94994333-94994355 TCTCCACACCCTGAAGTAAGTGG + Intronic
913106846 1:115622699-115622721 TCTCCTTGCCTTGAAGAGGGAGG - Intergenic
918090977 1:181294715-181294737 TCTCCACTCCATGATGTGTGGGG + Intergenic
922126350 1:222728869-222728891 TCTCCAGCCCTTGGAGTGCCAGG + Intronic
922329183 1:224558667-224558689 TCCCCACCCCTTGATGGGAGTGG + Intronic
922552950 1:226510488-226510510 TCTCCTCCCCTTAAACTGGGTGG + Intergenic
923317517 1:232795609-232795631 TCCCCCCACCTTGAAGTGGCTGG + Intergenic
924140565 1:241018740-241018762 CCTCTACCCCTTGAGGAGGGAGG - Intronic
924277260 1:242401261-242401283 TCTCCACTCCTTGCACTGGCAGG + Intronic
924558606 1:245138636-245138658 TTTCCACCCCTTTATGGGGGAGG - Intergenic
1067095611 10:43297622-43297644 TCCCCACCCCTTGACCTGGGTGG + Intergenic
1067451230 10:46383328-46383350 CCTGCCCCACTTGAAGTGGGAGG - Intronic
1067586012 10:47476428-47476450 CCTGCCCCACTTGAAGTGGGAGG + Intronic
1068163570 10:53299324-53299346 TCTCCACCTCCTGAAGTGCTAGG + Intergenic
1069809619 10:71148743-71148765 TCTCCATTCCTTAAAGGGGGAGG - Intergenic
1072065708 10:91869360-91869382 TCTCCACACCTAGATGTCGGAGG - Intergenic
1072733904 10:97866214-97866236 TCCCCACACCTTGAATTTGGTGG - Exonic
1073190987 10:101650554-101650576 CCACCACCCCTTGAGGGGGGCGG - Intronic
1076057648 10:127388783-127388805 TCTCCACCCCTTGAAGTCTGGGG - Intronic
1076425199 10:130362786-130362808 TCTTCACCTCCTGAAGTGGCAGG + Intergenic
1078631565 11:13009048-13009070 GCTCCACTCCCTGAAGTGGAGGG + Intergenic
1079350347 11:19686563-19686585 TCACAACCCCTTTAAGTGAGAGG - Intronic
1080142740 11:28942248-28942270 TCTTTCCCCCTTGAAATGGGAGG - Intergenic
1080750075 11:35143008-35143030 ACCCCACCCCCTGCAGTGGGTGG + Intronic
1081572718 11:44301705-44301727 TTTCCACCCATTGTAGTGGAAGG + Intronic
1081640326 11:44748870-44748892 TCTCTGTCCCTGGAAGTGGGTGG - Intronic
1082084906 11:48041966-48041988 TGTCCAACTCTTGAGGTGGGGGG + Intronic
1084106623 11:66984772-66984794 TCCCCAGCCCTGGAAGTGTGAGG - Intergenic
1088239212 11:107756671-107756693 TCTCCAATCCTAGAAGTGTGGGG + Intergenic
1089406294 11:118200440-118200462 CCCCCACCCCTTGGATTGGGAGG - Intronic
1090661095 11:128882187-128882209 TATCTACCCCTGGAAGTGGGGGG + Intergenic
1091693861 12:2615135-2615157 TCTCCTTCCCTAGAAGTGAGAGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1093423235 12:18998919-18998941 TCTCCCCTCCATGAAGTGCGCGG + Intergenic
1093629755 12:21394792-21394814 TCTCAACACCTGGGAGTGGGTGG + Intronic
1097503662 12:60438028-60438050 TCTCAACCCCTTGCAGGAGGGGG + Intergenic
1099222767 12:79934598-79934620 TCTCCACCTCTTGAGGCTGGGGG - Intronic
1100401062 12:94230392-94230414 TCTGCACCCTTTGAACTGTGTGG + Intronic
1100757883 12:97772665-97772687 TCTCAACCCCTTGCAGGAGGGGG + Intergenic
1101858286 12:108462579-108462601 TCTCCACCCCATGAAGAGAAGGG - Intergenic
1106208638 13:27621424-27621446 TCAACACACCTTGAAGAGGGAGG - Exonic
1109605196 13:64685108-64685130 TCTCCACCCCATTTAGAGGGTGG - Intergenic
1110071273 13:71182238-71182260 TCTCAACCCCTTGCAGGAGGGGG + Intergenic
1111966389 13:94866307-94866329 GCTCCTGCCCTTGCAGTGGGAGG + Intergenic
1118756764 14:68850552-68850574 TCTCCACCCCAGGACCTGGGAGG - Intergenic
1119087967 14:71754247-71754269 CCTCCACCCCTGGAAGCGAGGGG - Intergenic
1121245567 14:92458982-92459004 TCTCCACCCCTTGAAGTGGGTGG + Intronic
1122051567 14:99064546-99064568 TCTCCACCCCTAAAAGTGGTGGG + Intergenic
1123935919 15:25194041-25194063 TCTCCGTCCCTGGAAATGGGTGG + Intergenic
1124168591 15:27352335-27352357 CCATCACCCCTTGAAGTGTGCGG - Intronic
1125233683 15:37486010-37486032 TCCCCACTCCATGGAGTGGGAGG + Intergenic
1132473897 16:122809-122831 TTTCCATCCCTTTAGGTGGGTGG - Intronic
1132700079 16:1218599-1218621 TCTCCACCTCCTGCAGCGGGCGG - Exonic
1132739918 16:1406743-1406765 TCTACACACCCTGAAGTGAGTGG + Intronic
1135294959 16:21271200-21271222 TTTCCACCCCTTCAAGTTGTGGG + Intronic
1135523072 16:23192191-23192213 TCCCAACCCCTAGAAGTGAGAGG + Intronic
1138116445 16:54364318-54364340 GCTCCACTCCCTGGAGTGGGAGG - Intergenic
1139598095 16:67969547-67969569 CCTCCAGCCCTTGGGGTGGGGGG + Intronic
1141103020 16:81211638-81211660 CCTCCACCCCGTGATCTGGGGGG + Intergenic
1141128836 16:81420661-81420683 TCTCCACCATTTGAATTTGGGGG + Intergenic
1142564854 17:833480-833502 TCTGCACCCTTTCAAGTGTGAGG + Intronic
1144804151 17:17953021-17953043 TCCCCACCCCTTCATTTGGGAGG + Intronic
1151897600 17:76990708-76990730 GCTACATACCTTGAAGTGGGAGG + Intergenic
1152660430 17:81539553-81539575 TCTCCACCCGCTGAAGAGGCCGG + Intergenic
1156346565 18:36262313-36262335 TCTCAGCTCCTTGAGGTGGGAGG + Intronic
1157854969 18:51097186-51097208 TCTCCAGCCCTGGAGGTGGAGGG + Intergenic
1162918131 19:13885153-13885175 TCTCCTCCCCTAGCAGAGGGCGG - Intronic
1163602547 19:18257707-18257729 GCTCCACCCCGTCACGTGGGTGG - Exonic
1165797792 19:38528782-38528804 TCTATACCCCTTGATGTGGAGGG - Intronic
1166001810 19:39881930-39881952 TCTCCCCTCCTTGAAGAGGAGGG + Intronic
926274656 2:11394469-11394491 TCTCCACCTCCTGAAGTGTTGGG - Intergenic
931200745 2:60095284-60095306 TCCCCTCCCCTTGAAGTTGGTGG + Intergenic
931302597 2:60995209-60995231 TCACAACCCCTTAAAGTAGGTGG - Intronic
932091348 2:68808948-68808970 TCTCCACCCCTAGAAGTGAGGGG + Intronic
933165525 2:79070580-79070602 TCTCAACCCCTTGCAGTTGGGGG - Intergenic
938639298 2:133263646-133263668 TCTCCACTCCTTGAACATGGAGG - Intronic
940159249 2:150693697-150693719 CCTCAACCCCTTGACCTGGGTGG + Intergenic
941916117 2:170815159-170815181 TCTGCGCTGCTTGAAGTGGGCGG - Intronic
942689178 2:178567185-178567207 TCTCCACCACTTCAAGATGGTGG - Exonic
945868554 2:215202921-215202943 TCTCAACCCCTTGCAGGAGGGGG + Intergenic
947841972 2:233213574-233213596 TCTTCGCCCCTTGAAATGGAAGG - Intronic
948274016 2:236694715-236694737 TCCCCAGCCCCTGAAGTGTGTGG + Intergenic
1168842680 20:919788-919810 CCTACTCCCATTGAAGTGGGAGG - Intergenic
1170131262 20:13022661-13022683 TCTCCTCCCCTTGAACCTGGTGG - Intronic
1172174818 20:32965929-32965951 TGGCCACCACTTGAGGTGGGAGG + Intergenic
1172804045 20:37598458-37598480 TCCCATCCCCTTGAAATGGGAGG - Intergenic
1175066228 20:56290924-56290946 GCTCCAACCCTGGAAGTGGGAGG + Intergenic
1175628205 20:60507471-60507493 CCTCCTCCCCATGTAGTGGGTGG + Intergenic
1177490525 21:21820001-21820023 TCTCCACCCCTTAAAATGTTGGG - Intergenic
1183575986 22:38689479-38689501 TCTCCATCCCTGGTAGTGCGGGG - Intronic
1183597335 22:38820575-38820597 TCCCCACCCCAGGAAGTGCGGGG - Exonic
1183617207 22:38953230-38953252 TCTCCACCCCTGGAAGAGGGTGG + Intronic
1184681768 22:46076027-46076049 TTTCCTGCCCCTGAAGTGGGGGG - Intronic
951451157 3:22840121-22840143 TCTCCTCTCCTTCAATTGGGTGG - Intergenic
954402279 3:50325286-50325308 CCTCCACCCCTCCAATTGGGAGG - Exonic
955481248 3:59392657-59392679 TCTCCTCTCCTTGAAATTGGAGG - Intergenic
956404124 3:68910221-68910243 TCACCTCCCCTTGAGATGGGTGG - Intronic
957312130 3:78534200-78534222 TCTTCACCTCTAGAACTGGGCGG - Intergenic
960664352 3:120095029-120095051 TCTCCCCACCTTGGAGAGGGAGG - Intergenic
961738752 3:129018944-129018966 TGTCCACCCCTGGGAGTGGATGG - Intronic
964620119 3:158712771-158712793 TCTTCACCCCCTGAAATGGAAGG + Intronic
967915926 3:194578181-194578203 TTCCCACCCCGTGAAGTAGGAGG + Intergenic
969102429 4:4779094-4779116 TCTCCAGTCCTTGAAGTGAGTGG - Intergenic
969664422 4:8548939-8548961 TCTCCTCCCTGTGCAGTGGGGGG - Intergenic
971253834 4:24995721-24995743 GCTCCACCTCTTGAAGGGAGGGG + Intergenic
971436802 4:26635209-26635231 TCTCCACCATTTGGGGTGGGAGG + Intronic
977416292 4:96736400-96736422 TCTCCAGGCTATGAAGTGGGGGG - Intergenic
979082374 4:116360246-116360268 TCTCCACACCTGGTTGTGGGAGG - Intergenic
980812494 4:137900657-137900679 TCTTCTCCCCTTGCACTGGGTGG - Intergenic
981640354 4:146935198-146935220 TCTCCACCCATCGCATTGGGAGG + Intronic
989388725 5:40878726-40878748 TCCCCACCCCTTGAGGAGGGAGG + Intergenic
997404462 5:133633984-133634006 TCTCCACCCCATGATGTCAGTGG - Intergenic
1003222501 6:4173495-4173517 TTTCCTTCTCTTGAAGTGGGGGG + Intergenic
1005737693 6:28764169-28764191 TCTCCCTCCGTTGAAGTGGGAGG - Intergenic
1007260199 6:40558072-40558094 TCTCCACTCCTTCACGTGCGTGG - Intronic
1010781760 6:79952863-79952885 TGCACACCCCTTGAAGAGGGAGG - Intergenic
1016183052 6:141170849-141170871 GCTCCACCCCTTGTGGTGGGGGG + Intergenic
1017311189 6:152979561-152979583 TCCCCACTCCTTTAAGTGTGAGG - Intronic
1019345214 7:526424-526446 TCTCCAACCCCTGCAGGGGGAGG + Intergenic
1021459123 7:20865851-20865873 GCTCTAACCCCTGAAGTGGGAGG + Intergenic
1026180127 7:68031910-68031932 ACTCCACGCCTTGAACTTGGGGG + Intergenic
1031684707 7:124718890-124718912 TCTCAAACCCTTGAACTAGGTGG + Intergenic
1034282210 7:149862261-149862283 TCTCCACCTCTTGCTGTGAGCGG + Exonic
1034298988 7:149998755-149998777 GCTCCACCTCTTGAAGGGAGAGG - Intergenic
1034807027 7:154098018-154098040 ACTCCACCTCTTGAAGGGAGAGG + Intronic
1035904926 8:3499485-3499507 ACTCCACTGCTTGGAGTGGGGGG + Intronic
1038016157 8:23516929-23516951 TCTCCATTCCTGGAAGTTGGTGG - Intergenic
1039878983 8:41611676-41611698 TCTCCACCCACTGATTTGGGTGG + Intronic
1041350150 8:56940249-56940271 TCTCCTCCCCTAGAAATGGTAGG - Intergenic
1041395006 8:57381162-57381184 TCTGCACAGCTTGAAGTCGGAGG + Intergenic
1042280531 8:67051494-67051516 TCCACAACCCTTGAAGTGTGAGG - Intronic
1042586415 8:70344226-70344248 TCTCCACCTCATTCAGTGGGAGG - Intronic
1044801193 8:95958211-95958233 TCTCCTCTCCTTGATGTGTGGGG - Intergenic
1051428582 9:16959599-16959621 TCTCCACCCCTTAAGGTAGATGG - Intergenic
1052409360 9:28103343-28103365 TCTCCATCTCTTGAACTGGTTGG + Intronic
1052740045 9:32384446-32384468 GCTCCTCCGCTGGAAGTGGGAGG - Intergenic
1055679170 9:78697004-78697026 ACCCCAGCCCTTGAAGTTGGAGG + Intergenic
1056797575 9:89669311-89669333 ACACCACCCCTTGAGGTGTGGGG + Intergenic
1058049131 9:100388949-100388971 TATCCAACCCAGGAAGTGGGTGG + Intergenic
1059177557 9:112181089-112181111 TCTCCACCACCTGAGGTCGGGGG - Intergenic
1059956599 9:119522427-119522449 TCTCTCCCCATTGAAGTTGGAGG + Intronic
1060585010 9:124780341-124780363 TCCCCACCCCTTGATGCTGGAGG - Intronic
1061213253 9:129205590-129205612 TCTGCACCCCTTGAGGAGGCTGG - Intergenic
1062647311 9:137555247-137555269 GCTCCACCTCTGGGAGTGGGAGG - Exonic
1188909435 X:35827644-35827666 TATTCACTGCTTGAAGTGGGTGG - Intergenic
1190707576 X:53043510-53043532 TTTCCTCCCTTTGCAGTGGGAGG - Intergenic
1197665013 X:129214064-129214086 ACTCCACCTCTTGATGTGGAGGG - Intergenic
1201695487 Y:16819493-16819515 TCTCCATCACCTGAAGTTGGAGG - Intergenic