ID: 1121247306

View in Genome Browser
Species Human (GRCh38)
Location 14:92471277-92471299
Sequence CAAGGAGGACAAAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 665}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121247299_1121247306 -5 Left 1121247299 14:92471259-92471281 CCCTACTCCTAGCAGGGACAAGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 52
4: 665
1121247293_1121247306 23 Left 1121247293 14:92471231-92471253 CCCACTGGCCTCTGCAACTCCAG 0: 1
1: 0
2: 1
3: 30
4: 282
Right 1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 52
4: 665
1121247294_1121247306 22 Left 1121247294 14:92471232-92471254 CCACTGGCCTCTGCAACTCCAGT 0: 1
1: 0
2: 6
3: 32
4: 410
Right 1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 52
4: 665
1121247295_1121247306 15 Left 1121247295 14:92471239-92471261 CCTCTGCAACTCCAGTGACTCCC 0: 1
1: 0
2: 1
3: 26
4: 306
Right 1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 52
4: 665
1121247296_1121247306 4 Left 1121247296 14:92471250-92471272 CCAGTGACTCCCTACTCCTAGCA 0: 1
1: 0
2: 0
3: 8
4: 183
Right 1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 52
4: 665
1121247301_1121247306 -6 Left 1121247301 14:92471260-92471282 CCTACTCCTAGCAGGGACAAGGA 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG 0: 1
1: 0
2: 4
3: 52
4: 665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121247306 Original CRISPR CAAGGAGGACAAAGGGCAGA AGG Intronic
900310928 1:2032767-2032789 CAAGGAGGACAAGGCAGAGATGG - Intergenic
900595225 1:3477345-3477367 GAAGGATGGCAAAGGCCAGAGGG - Intronic
901263544 1:7891905-7891927 CAAGGAGGTAAAAGGGCATGAGG + Intergenic
901621906 1:10595335-10595357 AAAGGAGGAGAAAGGGACGAGGG - Intronic
901806778 1:11743545-11743567 AAAGAAAGAAAAAGGGCAGATGG - Intronic
902161645 1:14535254-14535276 CAGGGAGGAGAAGGGGCATAGGG - Intergenic
902169977 1:14602073-14602095 CAGGGATGACAACGGGCAGTAGG + Intronic
902207338 1:14878649-14878671 CAAGGAGGAGAAAGGACATTCGG + Intronic
902255097 1:15183653-15183675 GAAGGCAGACACAGGGCAGATGG - Intronic
902436151 1:16399201-16399223 CAGGGAGGAGAAAGGGTAAAAGG - Intronic
902677702 1:18020301-18020323 GAAGGAGGCCCAAGGGCAGGAGG + Intergenic
902774756 1:18667540-18667562 CCAGGAGGACAAATCACAGAAGG + Intronic
903190461 1:21652980-21653002 GAAGGATGACCAAGGGCACAAGG + Intronic
903659876 1:24970450-24970472 CAAAGATGACACTGGGCAGAAGG - Intergenic
903732480 1:25506582-25506604 CCAGGAGGAAAAAGGAAAGATGG + Intergenic
903908297 1:26702418-26702440 AAAGGAGGGAAAAGGGTAGAGGG + Intronic
904213126 1:28898727-28898749 CAAGGCGGGCAAGGGGCAGGAGG - Intronic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
905283385 1:36863537-36863559 GAAGCAGGACAAAGGGTACAGGG - Intronic
905483859 1:38281951-38281973 AAAGAAGGACAAAGAGAAGAAGG - Intergenic
905945454 1:41897898-41897920 GAAGGAGGACCCAGGGTAGAAGG + Intronic
906080828 1:43087140-43087162 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
906672604 1:47667442-47667464 CAAGAAGGGCAAAGTGCAGAAGG - Intergenic
907525272 1:55050264-55050286 CAAGGTGGGCAGAGGCCAGATGG - Intronic
907703226 1:56810026-56810048 GAAGGAGGAGGAAGGGGAGAAGG + Intronic
907887987 1:58611542-58611564 ACTGGAGGACAAAGGGCAGATGG + Intergenic
908843913 1:68305344-68305366 CAACGGGGACAAATGCCAGAAGG - Intergenic
910791810 1:91059265-91059287 GAAGGAGGAGAAAAGGTAGACGG + Intergenic
911355283 1:96810340-96810362 CAAGGAGTAAACAGAGCAGAAGG - Intronic
911362066 1:96889446-96889468 GAAGGAGGAAAAAGAGCATAGGG - Intergenic
912418612 1:109528782-109528804 AGAGGTGTACAAAGGGCAGAAGG - Intergenic
912430039 1:109624153-109624175 AAAGCTGGACAAAGGGAAGAGGG - Intronic
912545474 1:110448048-110448070 AGAGGAGGACAAGGGACAGAGGG - Intergenic
913305418 1:117425151-117425173 AAAGGAGGGCAAAGGGGGGAGGG + Intronic
914409432 1:147411632-147411654 CAGGGAGGACAATGTGAAGACGG + Intergenic
916052902 1:161048611-161048633 GGATGAGGACAAAGGACAGAGGG - Exonic
916160625 1:161909296-161909318 CAAGAAGGAGAAAGGGAAGGAGG + Intronic
916293280 1:163189315-163189337 AGAGGATGGCAAAGGGCAGAAGG + Intronic
917193404 1:172442574-172442596 CAAGGAGGTCAAGTGGCAGAAGG - Exonic
917333012 1:173901800-173901822 AAAGGAGGAGAAAAGGCTGAGGG + Exonic
917488840 1:175480007-175480029 CAAGTAGGAGAAGGAGCAGAGGG + Intronic
918357862 1:183723267-183723289 CAAGGAGGACAATTGGTTGAAGG - Intronic
918410146 1:184249873-184249895 GAAGGAGATCAAAGGGTAGAAGG - Intergenic
918573813 1:186031345-186031367 CAAAAAAGACAAAGGCCAGAAGG - Intronic
919186708 1:194160497-194160519 AAAGTAAGACAAAAGGCAGAAGG + Intergenic
919473454 1:198007438-198007460 CAAGGAGGGAAAAGGGGAAAGGG - Intergenic
920354435 1:205360161-205360183 AAAGGAGGCCAGAGAGCAGAGGG + Intergenic
920855660 1:209659125-209659147 CACAGAGGACAGAGGACAGAGGG + Intergenic
920900714 1:210107533-210107555 GAAGGCAGACATAGGGCAGATGG + Intronic
921739184 1:218664464-218664486 GGAGGAGGAAGAAGGGCAGAAGG - Intergenic
922203035 1:223422759-223422781 GAAGGAAAACAAAGGGGAGAAGG + Intergenic
922368344 1:224886718-224886740 GAAGGAGGAGAGAGGTCAGAGGG - Intergenic
1062893202 10:1081516-1081538 AAGTGAGGACAAACGGCAGAAGG - Intronic
1063042692 10:2359290-2359312 CAAGGAGCACCAAGGGCTGGGGG + Intergenic
1063363021 10:5472428-5472450 CTAGGAGGAGAGAGGTCAGATGG - Intergenic
1064004344 10:11688281-11688303 CAAGGATGGCTGAGGGCAGACGG - Intergenic
1064671062 10:17714169-17714191 TACGGAGGACAAAGAGCAGCTGG - Intronic
1064673297 10:17737268-17737290 GCAGGAGGCCAAAGGGCAGCAGG - Intergenic
1065432822 10:25676648-25676670 CAAAGAGCACAAAAGGCAGAGGG - Intergenic
1065790267 10:29254193-29254215 GAAGGAGGAAGAAGGGGAGAAGG + Intergenic
1066630519 10:37455294-37455316 CAAGGAGAAAAATGGGCAGCAGG - Intergenic
1067761216 10:49048514-49048536 CAAGAAGGGCAAGAGGCAGAAGG - Exonic
1069567531 10:69473740-69473762 CAAAGAGGACAAAGGGGAAAGGG - Intronic
1069705064 10:70453851-70453873 GAGGGATAACAAAGGGCAGAAGG + Intergenic
1070277910 10:75025379-75025401 TAAGGATGGGAAAGGGCAGATGG - Intronic
1071080726 10:81806826-81806848 GAATGAGGACACAGGGCAAACGG + Intergenic
1071495016 10:86162226-86162248 CAGGGAGGAAAAAGGGAAGAGGG + Intronic
1071559063 10:86631574-86631596 AAAGAAGGCCAAAGGGAAGAAGG - Intergenic
1072227910 10:93387253-93387275 CAAGGAGGGCCGCGGGCAGAGGG + Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1073689150 10:105788010-105788032 GAAGAAGGAGAAAGAGCAGAAGG - Intergenic
1074693679 10:116029171-116029193 CCTGGAGCACAAAGAGCAGATGG - Intergenic
1074765122 10:116694827-116694849 CCAGGCGGCAAAAGGGCAGAAGG - Intronic
1074825158 10:117209402-117209424 CAAGGAGGGGAGATGGCAGAAGG + Intronic
1075507435 10:123036798-123036820 CATGAAGGACAAAGTGCAGTTGG + Intronic
1075518913 10:123132402-123132424 CAAGGAGCCAAGAGGGCAGAAGG - Intergenic
1075726555 10:124613546-124613568 CATGCAGGGCAGAGGGCAGAAGG - Exonic
1075765949 10:124893014-124893036 CAAAGAAGACACAGGGAAGAAGG - Intergenic
1075845748 10:125544048-125544070 CAGGGAAGAAACAGGGCAGAGGG - Intergenic
1076024578 10:127101022-127101044 GAGAGAGGACAAAGGGCAGGAGG + Intronic
1076031649 10:127164125-127164147 CAGGGAAGACAAAGGGCCAAGGG - Intronic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1077248397 11:1549995-1550017 TGAGCAGGAGAAAGGGCAGAGGG - Intergenic
1077442321 11:2574521-2574543 GAAGGAGGACTCGGGGCAGACGG - Intronic
1077589968 11:3483708-3483730 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1080462197 11:32464552-32464574 CAAAGGGGACAAAGAGTAGAAGG - Intergenic
1080522098 11:33076412-33076434 CAAGGAGGTAAAGTGGCAGAGGG - Intronic
1080967837 11:37234305-37234327 AACTGAGGACAAAAGGCAGAAGG + Intergenic
1081258374 11:40926243-40926265 CACGGAGGTCACAGGACAGAAGG - Intronic
1081847274 11:46249755-46249777 CAGGGAGGGAGAAGGGCAGAAGG - Intergenic
1081942809 11:46958869-46958891 CACGCAGAACAAAAGGCAGAGGG - Intronic
1082094002 11:48112130-48112152 TAAGAAGGAGGAAGGGCAGAAGG + Intronic
1082096004 11:48129844-48129866 TAAGAAGGAGGAAGGGCAGAAGG + Intronic
1082846202 11:57727707-57727729 GAAGGAAAACAAAGGGGAGAGGG - Intronic
1083410450 11:62488905-62488927 CCAGGAAGACAGGGGGCAGAGGG + Intronic
1083762604 11:64826835-64826857 CAAGGAGGACAAGAGGCCCAAGG + Intronic
1083935956 11:65870256-65870278 GAAGGAGGGCGGAGGGCAGAGGG + Intronic
1084266461 11:68007899-68007921 CAAGGAGGAGGCAGGGCAGGCGG + Intergenic
1084378386 11:68794283-68794305 GAGAGATGACAAAGGGCAGAGGG + Intronic
1084892191 11:72242071-72242093 GAAGGAGGGCAAAGAGAAGATGG - Intronic
1084946164 11:72639757-72639779 CAAGGAGGATGAAGGGCAAAGGG + Intronic
1085714264 11:78857950-78857972 CTAGGAGGAAAAAGCTCAGAAGG - Intronic
1085950217 11:81321573-81321595 CAAGGAACCCAAATGGCAGAGGG + Intergenic
1085992737 11:81869928-81869950 CAAGGAGGTAAAAGAACAGAAGG + Intergenic
1086136363 11:83446977-83446999 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1086402881 11:86474775-86474797 CAAGGTTGATAAAGGGCATAAGG - Intronic
1087008588 11:93492672-93492694 CATGGAGGGCAAAGGCCACAAGG + Intronic
1087231844 11:95675112-95675134 CAAGTAGGAAAAAGGGTAGATGG - Intergenic
1087839630 11:102908152-102908174 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1088675198 11:112186112-112186134 GAAGGAGGGCAAAGGGGAGGAGG + Intronic
1088727970 11:112656281-112656303 CAAGGAGGATAGATGGGAGAGGG - Intergenic
1088771302 11:113038267-113038289 CAAGGAGGCCAGAGAGCAGTGGG - Intronic
1088771716 11:113042385-113042407 GAAGGAGGCCAAAGGGCAGAGGG - Intronic
1088795147 11:113261259-113261281 CCAGGAGGAGACAGGCCAGAGGG + Intronic
1088821383 11:113460553-113460575 CAAGGAGGGGCCAGGGCAGAGGG - Intronic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088995060 11:114989022-114989044 CAAGGGCAGCAAAGGGCAGATGG + Intergenic
1089628794 11:119770534-119770556 CACAGAGGAGGAAGGGCAGAGGG + Intergenic
1089785607 11:120904849-120904871 CAAGGAGGGCATTGGGAAGAGGG - Intronic
1089785655 11:120905180-120905202 CGGGGAGGACATGGGGCAGAAGG - Intronic
1090557237 11:127889656-127889678 AAATGAGGACAAGAGGCAGAGGG + Intergenic
1091236725 11:134027045-134027067 AAAGGAGCACAAAGGGCAAAAGG + Intergenic
1091364710 11:135007968-135007990 GAAAGAGGGCAGAGGGCAGAAGG + Intergenic
1092146402 12:6217712-6217734 CCAGGAGGACAATGGGAAGTTGG + Intronic
1092203423 12:6601280-6601302 CAAGGAGGGCAAAGGTGAAATGG - Exonic
1092736977 12:11592206-11592228 CAAGAGGAACAAAGAGCAGATGG + Intergenic
1092789622 12:12060063-12060085 CGAGGAGGAGAGAGGTCAGATGG - Intronic
1093220995 12:16420553-16420575 AAGGGAGGAGAAAGGGTAGAAGG + Intronic
1093578727 12:20765042-20765064 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1094042662 12:26133861-26133883 CAATGAGGACAGAGTGGAGAAGG + Intronic
1094720035 12:33053217-33053239 CAGGGAGGCCAAAGGGGAGTGGG - Intergenic
1094740272 12:33280935-33280957 CATGGCTGACAAAGAGCAGATGG - Intergenic
1095168083 12:38998384-38998406 CAAGGGGGAGAAAGGGAAGGGGG - Intergenic
1095429794 12:42120916-42120938 AAAAGAGGGCAAAGGACAGAGGG - Intronic
1095989541 12:48025279-48025301 AGAGGAAGACAAAGGGGAGATGG + Exonic
1096473888 12:51896311-51896333 TAGGGAGGACAGAGGACAGATGG + Intergenic
1096829299 12:54301676-54301698 AAAGGAGGACAAAGGACACCTGG - Intronic
1096842845 12:54390047-54390069 AAAGGAAGACAAATAGCAGAGGG + Intronic
1096869807 12:54586177-54586199 CAAGTATGACAGAGGGCAGCAGG + Intronic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1097984449 12:65768628-65768650 CAAGGAGGACGTAGTACAGATGG - Intergenic
1098981623 12:76962678-76962700 TAAGGGGGAGAAAGGGGAGAGGG + Intergenic
1099224177 12:79949407-79949429 GAAGGAGGACAGAGGGAAGGAGG - Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1099380431 12:81946004-81946026 CAAGGAGCACAGAGGCCATAGGG - Intergenic
1099424039 12:82501036-82501058 CAGGAAGGACAAAGGGCTAAGGG + Intergenic
1100112267 12:91259972-91259994 CAAGGAGTTCAAAGTGCACAGGG + Intergenic
1101005586 12:100398119-100398141 CAAGGAGGTAAAAGGCCAGCAGG - Intronic
1101094763 12:101326694-101326716 CAGGAAGGACAAAGGCCAGAAGG - Intronic
1101868163 12:108538803-108538825 CAAAGAGGAGAAAAAGCAGATGG + Intronic
1102454953 12:113065510-113065532 GAAGGAGGAGAAAGGGGTGAGGG - Intronic
1102650694 12:114440128-114440150 CAGCGGGGACAAAGGCCAGAGGG - Intergenic
1102780749 12:115562431-115562453 CAAGGACCACAAATAGCAGAGGG - Intergenic
1103226465 12:119292037-119292059 CATGAAGGACCAAGGCCAGAGGG + Intergenic
1103456755 12:121073864-121073886 CATGGAGGCCAAAAGGCAGTGGG + Intergenic
1103920793 12:124398234-124398256 AAAGGAGAGAAAAGGGCAGAAGG - Intronic
1104038949 12:125116917-125116939 AAAGGAGGACAAAAGGCAAAGGG - Intronic
1104750234 12:131233695-131233717 CAAGGAGAGTGAAGGGCAGAGGG + Intergenic
1104782480 12:131430766-131430788 CAAGGAGAGTGAAGGGCAGAGGG - Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284765 13:18994947-18994969 CAAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105341444 13:19529764-19529786 CCAGGATCACAAAGGGCATAAGG - Intronic
1105358866 13:19687574-19687596 AAAAGAGGAGAAAGGGCAGATGG - Intronic
1105698439 13:22914736-22914758 GAAGGATTACAAAGGGCACAAGG + Intergenic
1105850101 13:24326976-24326998 GAAGGATTACAAAGGGCACAAGG + Intergenic
1106069511 13:26394939-26394961 GATGGAGAAAAAAGGGCAGATGG + Intronic
1106389226 13:29319241-29319263 CAAGAAAGCAAAAGGGCAGAGGG + Intronic
1107336548 13:39361909-39361931 GAAGGAGGGAAAAGGGCAGGAGG + Intronic
1107732637 13:43364211-43364233 ACAGGAAGACAAAGGGGAGAAGG + Intronic
1108202606 13:48058029-48058051 CAAGGAGGGGAGAGGTCAGATGG - Intronic
1111297450 13:86300226-86300248 CAAGGTTTAAAAAGGGCAGATGG - Intergenic
1112479346 13:99759357-99759379 CAAGGATGGCAAAGGAGAGAGGG + Intronic
1113016541 13:105834462-105834484 GAAGGATGACAAAGGGGTGAAGG - Intergenic
1113324246 13:109267009-109267031 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1113413868 13:110113085-110113107 CAAGTGGGTCAAGGGGCAGAGGG + Intergenic
1113782387 13:112984054-112984076 CATGCAGGACAGAGGGGAGATGG - Intronic
1114786981 14:25611727-25611749 AATGAAGGACAAAGAGCAGATGG - Intergenic
1116250118 14:42470944-42470966 TAAGGAGGAAAAAGCGAAGAAGG - Intergenic
1116584905 14:46690938-46690960 CAAGGAAGAATAATGGCAGAGGG - Intergenic
1116837922 14:49789307-49789329 CAAAGAAGAAAAAGGGAAGAAGG - Exonic
1117989537 14:61420140-61420162 CATTTAGTACAAAGGGCAGAAGG - Intronic
1118327964 14:64794234-64794256 CAAGGAGAATGAAGGACAGAGGG + Intronic
1118442912 14:65828157-65828179 CAAGGTGGTCAAGGGGCGGATGG + Intergenic
1118685309 14:68284980-68285002 CAATGAGGGCAAGAGGCAGAAGG - Intronic
1118904358 14:70012802-70012824 CAAGGAGGAAAAAAGGAACAAGG + Intronic
1119065634 14:71523422-71523444 AAAGGTGGGCAAAGGGTAGATGG - Intronic
1119665397 14:76481733-76481755 TAAGGAGAACCAAGGGCTGAGGG + Intronic
1119675036 14:76547192-76547214 GAAGGAGAAGGAAGGGCAGAAGG + Intergenic
1119751964 14:77085157-77085179 GGAAGAGGACAAAGGGTAGAAGG - Intergenic
1119757813 14:77131083-77131105 CAGGGAGGAGCAGGGGCAGAAGG + Intronic
1120180120 14:81334710-81334732 CAAGGCAGAAATAGGGCAGAAGG + Intronic
1120251484 14:82065154-82065176 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1120957104 14:90092501-90092523 CATGGAGGACAGAGGTCAAAGGG + Intronic
1121228229 14:92337296-92337318 CAAGGAGCTCAAAGGCAAGAAGG - Intronic
1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG + Intronic
1121471367 14:94156925-94156947 CAAGGAGGACCAAGGCCATTGGG - Intronic
1121782728 14:96632185-96632207 CAAGGAGCTCACAGGGCAGTGGG + Intergenic
1121786598 14:96666184-96666206 AAAGGAGAGCAAAGGGAAGACGG - Intergenic
1121939819 14:98059423-98059445 CAGGAAGGATAAAGGGGAGAGGG + Intergenic
1122287086 14:100658525-100658547 CCAGGAGGGCAAAGGGGAGGTGG + Intergenic
1122323474 14:100868961-100868983 CCAGGATGACAGAGGCCAGATGG - Intergenic
1122332523 14:100932653-100932675 GCAGAAGGACAAAGGGCATATGG - Intergenic
1122708120 14:103634378-103634400 CAAGGAGGGAAAATGGGAGAAGG + Intronic
1122840050 14:104454949-104454971 GAAGGATTACAAAGGGCACAAGG + Intergenic
1123987215 15:25656542-25656564 CAAGGGAGAAGAAGGGCAGATGG + Intergenic
1124362782 15:29050955-29050977 TCAGGACGGCAAAGGGCAGATGG - Intronic
1124406944 15:29401504-29401526 CAGTGATGGCAAAGGGCAGAGGG + Intronic
1124506267 15:30277240-30277262 AAAGGAGAACAAAGAACAGATGG + Intergenic
1124514177 15:30352364-30352386 CCAGGAGGACACAGAGAAGAAGG + Intergenic
1124680882 15:31729862-31729884 AGTGGAGGACAAAGGGCAGAGGG - Intronic
1124688778 15:31804479-31804501 CATGGAGGAGAAAGGGGAGGAGG - Intronic
1124728743 15:32178400-32178422 CCAGGAGGACACAGAGAAGAAGG - Intergenic
1124737289 15:32261396-32261418 AAAGGAGAACAAAGAACAGATGG - Intergenic
1125528961 15:40398700-40398722 CAAGGAGGAAAAAGAGTAAAAGG - Intergenic
1125679075 15:41519627-41519649 GGAGCATGACAAAGGGCAGAAGG - Intronic
1125756355 15:42068245-42068267 GCAGGAGGACAAAGAGGAGAAGG + Exonic
1126171272 15:45697168-45697190 GAAGGAGAAGAAAGGGAAGAAGG - Intergenic
1127310460 15:57747483-57747505 CAAGGAGGAAAAAGGGGAAGTGG - Intronic
1127533931 15:59872242-59872264 TAAGGACAGCAAAGGGCAGAAGG + Intergenic
1128341839 15:66827712-66827734 CAAGGAGAACAGAGGAAAGAAGG - Intergenic
1128883484 15:71264461-71264483 CATTGAGGACAAAGCCCAGAGGG + Intronic
1129315714 15:74742498-74742520 CAAGGAGCTCAAAGTCCAGAGGG + Intergenic
1129730654 15:77929851-77929873 CAAAGAGGACAAATGGAAGGGGG + Intergenic
1129781758 15:78276877-78276899 CAAGGAGGGGAAGGGGGAGAGGG - Intronic
1130331492 15:82925624-82925646 AGAGGAGGTCAAAGGGAAGAAGG - Intronic
1130869402 15:87958690-87958712 CCAGCAGGATAAGGGGCAGAGGG - Intronic
1130932198 15:88437623-88437645 CAAGGAGGGCTATGGGAAGAGGG - Intergenic
1131187679 15:90289185-90289207 CAAAGAGGACAAATGGAAGGGGG - Intronic
1131509943 15:93044382-93044404 CAGGGAGGCCACAGGCCAGAAGG + Intronic
1132351918 15:101145062-101145084 GTAGGAGGAAAAAGGGCAAATGG + Intergenic
1132387116 15:101408474-101408496 CCAGGGAGACACAGGGCAGAAGG + Intronic
1132551197 16:554452-554474 CAGGGAGGCCAAAGGGGAGTGGG - Exonic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1134189648 16:12111360-12111382 CATGGAAGGCAAAGGGCAGCAGG - Intronic
1134399505 16:13896369-13896391 CAAGGAGGATGAAGGGCACATGG + Intergenic
1135693918 16:24570005-24570027 CAAAGAGGAAAAAGTGAAGAAGG + Exonic
1135801056 16:25496116-25496138 CAAGGAAGACAAAGGAGTGAGGG + Intergenic
1136070016 16:27782093-27782115 CAGGGAGGAAAAAGGAGAGAGGG + Intergenic
1136342672 16:29655163-29655185 CAAGGAGGCCAAAGGGTGGAGGG - Intergenic
1137728781 16:50674621-50674643 CTGGGAGGAGAAAGGGCAGAGGG + Intronic
1138946154 16:61852775-61852797 CAGGGAGGATAAAGGGAAGGAGG - Intronic
1139248283 16:65469965-65469987 CAAGGAGCACAAAGTGCTGAGGG + Intergenic
1139325710 16:66151350-66151372 GAAAAAGGAAAAAGGGCAGAAGG + Intergenic
1140138834 16:72234337-72234359 CAAGGAGGACAATGAGCAGAAGG + Intergenic
1140746307 16:77983319-77983341 CAAGAAGCACAGAGGGCAGGAGG + Intergenic
1141243034 16:82280591-82280613 TAAGAAGGACAAAGAGAAGAGGG - Intergenic
1141319003 16:82989114-82989136 CAAAGCAGACAAAGGGGAGACGG + Intronic
1141635133 16:85310562-85310584 CAACAAGGACCAAGGGCAGTGGG - Intergenic
1142727307 17:1825353-1825375 GATGGAGGAAAAAGTGCAGAAGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142767081 17:2070930-2070952 GCAAGAGGAGAAAGGGCAGAGGG - Intronic
1143331299 17:6137878-6137900 GAAACAGGAGAAAGGGCAGATGG + Intergenic
1143807724 17:9443129-9443151 CAAGGAGGACACATTACAGAAGG - Intronic
1145057442 17:19712802-19712824 CCTGGAGGACACAGGGGAGAGGG - Intronic
1145118131 17:20231104-20231126 CAAGGAGAACAAGGGGCTGCAGG + Intronic
1145170321 17:20650883-20650905 CAAGGAGAACAAGGGGCTGCAGG + Intergenic
1145204574 17:20976147-20976169 GAAGGAGGAAAAAGAGGAGAAGG - Intergenic
1145303565 17:21656964-21656986 CGGGCAAGACAAAGGGCAGAGGG - Intergenic
1145994746 17:29098909-29098931 CAAGAAGAACAAAGGGGTGAAGG - Exonic
1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG + Intronic
1146292498 17:31620134-31620156 CATGGAGGACAGAAGGCAGTGGG - Intergenic
1146790894 17:35750026-35750048 CACGAAGGACAAAGGGAAGGGGG + Intronic
1147186951 17:38718058-38718080 CAGGGAGGGCAATGGCCAGAGGG - Intronic
1147919065 17:43905558-43905580 CCAGGAAGGCAAAGGGAAGAAGG - Intronic
1147927626 17:43955196-43955218 CCAGGAGGAGAAAGGGCTGTGGG + Intronic
1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG + Intergenic
1148128892 17:45250864-45250886 CAGGAAGGAGAGAGGGCAGAGGG + Intergenic
1148213576 17:45822428-45822450 GACGGGGGTCAAAGGGCAGAAGG + Intronic
1148467905 17:47875795-47875817 AAAGGAGGTCTAAGGGCAAAAGG - Intergenic
1148964210 17:51421123-51421145 GAGGGAGGAGAAAGTGCAGAAGG + Intergenic
1149081277 17:52660528-52660550 CAATGAGGAGAAGGAGCAGAAGG + Intergenic
1149298491 17:55283198-55283220 CTAGGAGGACAGTGGCCAGAGGG + Intronic
1149690013 17:58567697-58567719 GCAGAAGGATAAAGGGCAGAGGG - Intronic
1150619426 17:66798156-66798178 CAAAGAGGCTAAAGGGCTGAGGG - Intronic
1151163026 17:72181813-72181835 CAGGAAAGGCAAAGGGCAGAAGG - Intergenic
1151224025 17:72635178-72635200 CAAGAATGAAAACGGGCAGATGG - Intergenic
1151852927 17:76701616-76701638 CCAGCAGGGCAAAGAGCAGAGGG + Intronic
1153086548 18:1295024-1295046 AAAGGACCACAAAGGGCACAGGG + Intergenic
1153776119 18:8455755-8455777 GAAGAAGGACAAAGAGAAGAGGG - Intergenic
1154055843 18:11013329-11013351 CAAGGAGGACAGCTGGCAGCTGG + Intronic
1156252025 18:35360394-35360416 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1156454157 18:37283443-37283465 CATGGAGGAGAGAGGTCAGAGGG - Intronic
1156539331 18:37894147-37894169 AGAGTAGGACAAAGGCCAGAGGG + Intergenic
1156924149 18:42556570-42556592 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1157440199 18:47705519-47705541 CAAGGTGGACAATGTTCAGAAGG + Intergenic
1157476011 18:48024113-48024135 AAAGGAGGACACAGGGGAGTTGG + Intergenic
1157728078 18:49980089-49980111 CAAGGAGATGAAAGGGCACAGGG - Intronic
1158495833 18:57954517-57954539 CAGGGAGGTCAAAGGGCTCAGGG - Intergenic
1158900407 18:61957151-61957173 CAGGGTGGACAACTGGCAGAAGG - Intergenic
1158993941 18:62898014-62898036 CAAAGAGGAGAAAGAGGAGAAGG - Intronic
1159976804 18:74723539-74723561 CAAGGAAGAGAGAAGGCAGATGG - Intronic
1161048480 19:2149991-2150013 CAAGGAGGCCGAAGGGAAGTGGG + Intronic
1162227100 19:9232211-9232233 CAAGGTTGACAAAAGGAAGATGG - Intergenic
1163055189 19:14712653-14712675 CAAGGAGCACCAAGGGCTGCAGG - Intronic
1164771932 19:30816215-30816237 AAAGAAGGAGGAAGGGCAGAAGG - Intergenic
1165509643 19:36258573-36258595 CAAGGAGGGCAAAGGGCAAGAGG - Intergenic
1165511164 19:36267536-36267558 CAAGGAGGGCAAAGGGCAAGAGG - Intergenic
1166082399 19:40452188-40452210 CAAGGACGTCAGAGGGCTGATGG - Intronic
1166499030 19:43327546-43327568 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1166790292 19:45395378-45395400 AAGGGAGGACAAATGGCAGGGGG - Intronic
1166873361 19:45883780-45883802 CAAGGAGGACAGAGGGAAACTGG + Exonic
1166985718 19:46659276-46659298 CCGGGAGGACAGAGGGCTGAGGG + Intronic
1167351533 19:48978063-48978085 CTAGGAGGGCACAGGGCTGAGGG + Intronic
1167477773 19:49710836-49710858 CATGGAGGACAAAGAGAAGACGG + Exonic
1167694107 19:51003896-51003918 CAGGGAGGACTCAGGGCAGTGGG - Intronic
1167723455 19:51195045-51195067 CAAGGGGGTAGAAGGGCAGAAGG - Intergenic
1167760191 19:51441737-51441759 CAAGGAGGTAGAAGGGAAGAAGG + Intergenic
1167836053 19:52070944-52070966 CCAGGAGGACAAAGGGCAAGAGG + Intronic
1168451518 19:56470128-56470150 AAGGGAGGACAAAGGGCTGCTGG + Intronic
925003497 2:424691-424713 CAAGGAGGTCAGAGTGGAGAGGG + Intergenic
925113015 2:1352404-1352426 CCAGGAGCTCAATGGGCAGAGGG - Intronic
925187145 2:1856255-1856277 CCAGGAGCACAAAGGGGACAAGG - Intronic
925272284 2:2620416-2620438 GAAGGAGGAGAGAGGACAGAGGG - Intergenic
926518831 2:13883926-13883948 AAAGGAGGATAAAGAGCAAAAGG + Intergenic
927132450 2:20072064-20072086 GAAAGAGGACAAAGGGCTGGAGG - Intergenic
927517259 2:23679764-23679786 GGAGGAGGGCAGAGGGCAGAGGG + Intronic
927650131 2:24907611-24907633 CAAGGAGGGGAAAGGAGAGAGGG + Intronic
927666058 2:25033613-25033635 GAAGGAGCAGAAAGGGCTGATGG - Intergenic
927859849 2:26553775-26553797 GAGGAAGGAGAAAGGGCAGACGG - Intronic
928022651 2:27716111-27716133 GAAGGAGGACTGAGGGCAGGGGG - Intergenic
928216904 2:29369373-29369395 AAAGGAGGAGAAATAGCAGAAGG + Intronic
928424545 2:31167196-31167218 CAAGGGGCACAAAAGACAGATGG + Intergenic
928779769 2:34804936-34804958 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
929440971 2:41965604-41965626 CAAGACTGAGAAAGGGCAGACGG - Intergenic
929490698 2:42393727-42393749 GAAGGAGGAGGAAAGGCAGATGG + Intronic
929670979 2:43876265-43876287 CCAAGAGGCAAAAGGGCAGAGGG - Intronic
930487460 2:52026193-52026215 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
930711499 2:54555067-54555089 CAAAGAGGAAAGAGGGTAGATGG - Intronic
930955008 2:57194635-57194657 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
931137250 2:59416801-59416823 AAAGGAGAACAAAAGGAAGAAGG + Intergenic
931630985 2:64298598-64298620 CAAGGAGGAAAAAGAGATGAGGG + Intergenic
931891942 2:66682816-66682838 CTAGAAGGACAAAGAGAAGAAGG - Intergenic
932220537 2:69995689-69995711 GAAGAGGGACACAGGGCAGAAGG + Intergenic
932796552 2:74700795-74700817 CATGCAGAACAAAGGACAGAAGG + Intergenic
932861438 2:75296992-75297014 GAAGGAGGATAAAAGACAGAAGG - Intergenic
933200698 2:79444774-79444796 CAAGGAGGAGAAAGGGAATTAGG + Intronic
934588648 2:95527130-95527152 CAAGGAGGAGAAACGGGAGGCGG + Intergenic
934955866 2:98617976-98617998 CAAGGAGGAAACAGCACAGAGGG + Intronic
935123002 2:100198575-100198597 CAGGGAGGACGAGGGGGAGAAGG - Intergenic
935257574 2:101325608-101325630 CATGGAGGCCAAAAGGCAGTGGG - Intergenic
935931034 2:108125805-108125827 CAAGCAGAACATAGGCCAGATGG - Intergenic
936090328 2:109498058-109498080 CAAGGAGGACAGATGGCTGCCGG - Intronic
937307477 2:120881368-120881390 CAGGGAGGACAGTGGGGAGAGGG + Intronic
938132949 2:128732911-128732933 CAAGGAGGGGAAGGGGCAGAAGG - Intergenic
938797620 2:134731531-134731553 TCAGGAAGACAAAGGGAAGAAGG - Intergenic
938814324 2:134884295-134884317 CCAGAAGGACAAATTGCAGAAGG + Intronic
939664041 2:144928353-144928375 CATGGAGGTCAGAGGGCAAAGGG - Intergenic
940348033 2:152647720-152647742 TAAGCAGGACAAAGGCCAGCTGG - Intronic
941073989 2:160986858-160986880 GAAACAGGACAAAGGGCAAAAGG + Intergenic
942446633 2:176082690-176082712 CAAGGAGGAAAAGTGGCCGAGGG + Intronic
943421671 2:187674516-187674538 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
943835057 2:192507690-192507712 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
943951391 2:194134967-194134989 CTAGGAGGAGAGAGGTCAGATGG + Intergenic
944144366 2:196490157-196490179 CAAGGAGGGCCAAGCCCAGAGGG - Intronic
944473413 2:200079819-200079841 CAAGGTGGACAAAAGGCAGAAGG + Intergenic
945014722 2:205503058-205503080 AAGGGAGGAAAAAGGGGAGAGGG - Intronic
945547381 2:211173322-211173344 CAGGGAGTACAAAGTGAAGAGGG - Intergenic
946021683 2:216644449-216644471 CCAGGAAGTCAAAGGGAAGAGGG + Intronic
946057846 2:216917221-216917243 CAGGGAGGAAGAAGGGAAGAGGG + Intergenic
946194886 2:218027018-218027040 CAGGGAGGAGGAAGGGCAGCCGG + Intergenic
946330092 2:219004112-219004134 CAAGGAGGAGATAGAGGAGAAGG - Exonic
947044552 2:225966462-225966484 CAAGGAGGAGAAAGGAAGGAAGG - Intergenic
947074252 2:226324839-226324861 CAGAGAGGACAGAGGGCAGTGGG + Intergenic
947996191 2:234529759-234529781 GCAGGAGGACAGAGTGCAGAGGG + Intergenic
947999786 2:234558295-234558317 CAAGGGGGAGAAATGGCAAAGGG - Intergenic
948976527 2:241466761-241466783 CAGGGAGGCCAAAGGGGAGTGGG - Intronic
1169057030 20:2631584-2631606 CATGGAGGCCAAATGGCAGTGGG - Intronic
1169229185 20:3875740-3875762 CAAGGACACCCAAGGGCAGAGGG - Exonic
1169799606 20:9501358-9501380 CAATGAGGACAAAGGTCCAAGGG + Intergenic
1170372999 20:15669809-15669831 CCAGGGGCACAAAGGGCAGGTGG + Intronic
1171055928 20:21906211-21906233 GAAGGATGACAAGGGGCACAGGG - Intergenic
1171298872 20:24042049-24042071 CCAAGAGGGCAAAGGGCAAAGGG - Intergenic
1171403117 20:24892180-24892202 CCAGGAGGGCAAAGGCCAGCGGG + Intergenic
1172068676 20:32239998-32240020 GAAAGAGGAGAAAGGACAGAGGG + Intergenic
1172094443 20:32453765-32453787 AAAGGAGGGCAAGAGGCAGAGGG + Intronic
1172164707 20:32892090-32892112 CATGGGGGAAAAAGGGCTGAAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172340511 20:34153984-34154006 CAAGGAGGACCAAGGAAAGTCGG - Intergenic
1172643642 20:36456587-36456609 CACAGAGGACACTGGGCAGAAGG + Intronic
1173101819 20:40095009-40095031 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1173603074 20:44309950-44309972 GAAGGTGGACCAAGGACAGAAGG + Intronic
1173781584 20:45761068-45761090 GGAGGAGGAGAAAGGTCAGATGG - Intronic
1173845558 20:46186358-46186380 CAAGGATAAGAAATGGCAGATGG - Intronic
1174089385 20:48034901-48034923 CAGGCAGGACAAAGGGCACCTGG + Intergenic
1174105204 20:48157011-48157033 CAAGAATGACCAAGGGCAGTTGG + Intergenic
1174451589 20:50624192-50624214 CAGGGAGGGCAAGGGGAAGAGGG - Intronic
1174628400 20:51935108-51935130 CTGGGAGGACAATGGGAAGAGGG + Intergenic
1174999922 20:55616315-55616337 AAAGGAGGAAGAAGAGCAGAAGG - Intergenic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1175452065 20:59077783-59077805 GAAGGAGGACAAAGAGGAGGAGG + Intergenic
1175520690 20:59600785-59600807 CAAGGAGATCAAGGGGCAGAAGG + Intronic
1175797266 20:61779699-61779721 CATGGAGGTGAAAGGGCACATGG + Intronic
1176346591 21:5753993-5754015 CTAGGAGGCCAAAGAGGAGAAGG - Intergenic
1176353405 21:5874577-5874599 CTAGGAGGCCAAAGAGGAGAAGG - Intergenic
1176498236 21:7570462-7570484 CTAGGAGGCCAAAGAGGAGAAGG + Intergenic
1176540912 21:8152063-8152085 CTAGGAGGCCAAAGAGGAGAAGG - Intergenic
1176559863 21:8335108-8335130 CTAGGAGGCCAAAGAGGAGAAGG - Intergenic
1176654936 21:9579766-9579788 CGGGCAAGACAAAGGGCAGAGGG - Intergenic
1177357755 21:20031191-20031213 CAAGGAGAACAGAAGACAGATGG - Intergenic
1178821287 21:35977341-35977363 CGAGCAGGACAAATGGAAGAGGG - Intronic
1179213405 21:39346805-39346827 CCAAAAGGAAAAAGGGCAGAAGG - Intronic
1181688490 22:24545056-24545078 CCAGAGGGACAGAGGGCAGATGG + Intronic
1181987542 22:26810958-26810980 CAAGGACCACAGAGGGCAGTGGG - Intergenic
1182006020 22:26960305-26960327 AAAGGAGGAGGAAGGGAAGAAGG + Intergenic
1182575149 22:31267975-31267997 CTAGGAGCTTAAAGGGCAGAGGG + Intronic
1183324169 22:37182628-37182650 CAAGGGTGACAAGGGGGAGATGG - Exonic
1183382244 22:37496030-37496052 CAAGGAGGACAAGAGGAGGATGG + Intronic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
1184542050 22:45132610-45132632 AAAGGAGGCCAGAGGGAAGAAGG + Intergenic
1184842190 22:47058557-47058579 CAAGCAGAAGAGAGGGCAGAGGG - Intronic
1184927252 22:47651496-47651518 CAGGGTGGTCAAAGGGCACAGGG + Intergenic
1185074141 22:48674127-48674149 CAAGCAGGAGGAAGGGCGGAGGG - Intronic
1203245851 22_KI270733v1_random:68482-68504 CTAGGAGGCCAAAGAGGAGAAGG - Intergenic
949695578 3:6690392-6690414 CAAGGAGGAAAAAGGAAAAATGG - Intergenic
949749086 3:7330391-7330413 CAAGGGGGACAGAGAGAAGAGGG - Intronic
950236853 3:11329615-11329637 AAAGGAAGACAAAGAGCATATGG - Intronic
950860118 3:16140405-16140427 CAAGGTGGACAAAGGGGTAAGGG - Intergenic
951257667 3:20469070-20469092 CATGGAGGACACAGGGCAAACGG - Intergenic
951300938 3:20995342-20995364 CAAGGAAAACAAAGGGGAAAGGG + Intergenic
951316412 3:21193268-21193290 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
951378860 3:21957684-21957706 TAAGGAGGAGATGGGGCAGATGG - Intronic
951539276 3:23766851-23766873 AAAGGAAGACAAAGGACAAAGGG - Intergenic
951558581 3:23945113-23945135 CAAGGAGAAGGAAGGGGAGAAGG + Intronic
952015591 3:28952876-28952898 CAAGGAGGAAGAAGGCAAGAGGG + Intergenic
952185781 3:30966865-30966887 AAGGAAGGAAAAAGGGCAGAAGG + Intergenic
952277793 3:31894296-31894318 CAAGGAGGACAAGGGGAGGCAGG + Intronic
952424346 3:33159495-33159517 GAAGGAGGAAGAAGAGCAGAGGG - Intronic
952530939 3:34261053-34261075 AAAGGAGGAAGAAGGGAAGAAGG - Intergenic
952846982 3:37696032-37696054 GGAGAAGGACAAAGGGCAAAAGG + Intronic
953237545 3:41119682-41119704 CAAGGAGGAGGAAGGGAAGAGGG - Intergenic
953825795 3:46250336-46250358 CAAGGAGGGGAGAGGTCAGATGG + Intronic
953847998 3:46444116-46444138 GAAGGAGAAGAAAGGGCAAAAGG - Intronic
953931338 3:47007348-47007370 CAAGTAGGACAGAGGGCTGTGGG + Exonic
954615896 3:51968397-51968419 CCTGGTGGACAAAGGGCAGGGGG + Intronic
954618450 3:51982578-51982600 CTGGGAGTACAAAGGGCAGCTGG + Intronic
954748116 3:52798494-52798516 AAAGGAGGAGAAAGGGGAGGAGG - Intronic
956709125 3:72024628-72024650 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
956767610 3:72497099-72497121 CAAGAAGGAAAAAGGACAGATGG - Intergenic
956787227 3:72652623-72652645 AAAGGAGGAGAGAGGGCAAAGGG + Intergenic
957606879 3:82411198-82411220 CCAAGAGAACAAAGGGAAGATGG - Intergenic
958024460 3:88034552-88034574 CAAGAAGGAAAGAGTGCAGACGG - Intergenic
959888007 3:111524849-111524871 GAAACAGGACAAAGGGCAAAAGG - Intronic
959888668 3:111530154-111530176 GAAACAGGACAAAGGGCAAAAGG - Intronic
960160321 3:114343532-114343554 GAAGGAGGAGAAAGAGGAGAAGG + Intronic
960596514 3:119412511-119412533 CTAGAAGGACAAAGGGAAGCTGG + Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960773321 3:121219186-121219208 CAAGGAGGTTAAAAAGCAGAGGG + Intronic
960966647 3:123110343-123110365 CACGGAGCACACAGGGCAGAAGG - Intronic
961345989 3:126263696-126263718 CAAGGAGGAGAAATGAAAGAAGG + Intergenic
961893805 3:130151210-130151232 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
962264330 3:133934730-133934752 CAAGGAGTACAACGTGCAGAAGG - Exonic
962982817 3:140506309-140506331 CAAAGAGAAGAATGGGCAGAAGG - Intronic
962996967 3:140639339-140639361 CAAGGTAAACAAAGAGCAGAAGG - Intergenic
963058526 3:141206606-141206628 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
963179240 3:142336565-142336587 AAGGAAGGACAAAGGGGAGAAGG + Intronic
963555331 3:146780134-146780156 CCAAGAAGAAAAAGGGCAGAAGG - Intergenic
964377294 3:156060772-156060794 TAAGGAGGGCAAAAGACAGAAGG + Intronic
964749150 3:160038860-160038882 CACGGAGGAGAAAGGGCGGCCGG - Intergenic
964984963 3:162726591-162726613 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
965774041 3:172209842-172209864 GAAGGAGGCCAAGGGGCTGAGGG - Intronic
965904415 3:173685957-173685979 CAAGAAGGGTAAAGGGAAGAGGG + Intronic
966279206 3:178209171-178209193 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
966806226 3:183809955-183809977 CAAGCAGGACAGTGGGCAGCAGG - Intronic
967153072 3:186667405-186667427 GTAGGAGAACAAAGGGCAGAAGG + Intronic
967263810 3:187672301-187672323 GAAGGAGGAGAAAGTGTAGAGGG - Intergenic
967643931 3:191899451-191899473 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
967701973 3:192603756-192603778 GAAACAGGACAAAGGGCAAAAGG + Intronic
968480091 4:829421-829443 CCAGGAGGGCTATGGGCAGATGG - Intergenic
968488025 4:873590-873612 CAGGCAGCACAAAGGGCAGAAGG - Intronic
968680115 4:1912656-1912678 CAAGAAGCAGAAAGGGAAGATGG - Intronic
969359178 4:6650839-6650861 CCATGAAGACAAAGGGAAGAAGG - Intergenic
969369678 4:6723706-6723728 CAAGGAGGACAGGGAGCAGGTGG + Intergenic
969748964 4:9095898-9095920 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
969857977 4:10015217-10015239 CAAAGAGGAACAAGGGGAGATGG - Intronic
970399773 4:15706001-15706023 CGAGCAGGACCAAGGGCAGAGGG + Intronic
971132458 4:23827807-23827829 AAAGGAGGAGAAGGGGAAGAAGG + Intronic
972252871 4:37323072-37323094 CAAAGAAACCAAAGGGCAGAGGG - Intronic
972694667 4:41433901-41433923 GAGGGAGGACTGAGGGCAGAGGG + Intronic
973567603 4:52204007-52204029 AAGGGAGGATAAAGGGAAGAAGG - Intergenic
973882157 4:55284319-55284341 GAAGCAGGAAAGAGGGCAGAAGG - Intergenic
974727869 4:65819114-65819136 GAAGGAGAACAAAGGGAAAAAGG + Intergenic
975980875 4:80157830-80157852 GAAGGACGACAGAGAGCAGAGGG + Intergenic
976218895 4:82740330-82740352 CTAGGAGCACAAAAGTCAGAGGG + Intronic
976636619 4:87292677-87292699 CCAGGGGGACAAGCGGCAGAGGG + Intergenic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
978001210 4:103557810-103557832 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
980370098 4:131857880-131857902 AAAGAAGGCCAAAGGGAAGAAGG - Intergenic
980416578 4:132496411-132496433 AAAGGAAGACTAAGGGGAGAAGG - Intergenic
980472532 4:133267766-133267788 CGAGGAGGAGAGAGGTCAGATGG + Intergenic
981365918 4:143903020-143903042 AAAAGAGGACAGAAGGCAGAGGG - Intronic
981386548 4:144138192-144138214 AAAAGAGGACAGAAGGCAGAGGG - Intronic
981608066 4:146561670-146561692 GAAGGAGGACAAAATGCAGGGGG - Intergenic
981633296 4:146846583-146846605 CAAGGTGGCCAAAAGGAAGAAGG - Intronic
981989860 4:150904936-150904958 CAAGTGGGCCAAAAGGCAGAAGG + Intronic
982197867 4:152934743-152934765 CAAGGAGATCAAAGGGATGAGGG + Intergenic
982421440 4:155203568-155203590 CATGGAGGAGAAGGAGCAGAAGG - Intergenic
983404296 4:167307023-167307045 CAAGCAGAATAAAGGGCACATGG + Intergenic
983707586 4:170679128-170679150 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
984148575 4:176095712-176095734 AAGGAAGGACAAAGGGCTGAAGG - Intronic
984393705 4:179168937-179168959 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
984949200 4:184994224-184994246 CTAGAAGGACAAACGGAAGAGGG + Intergenic
984984136 4:185311059-185311081 TGGGGAGGACAAAGGGAAGATGG - Intronic
985309063 4:188577520-188577542 CAATCATGACAGAGGGCAGAGGG + Intergenic
985549518 5:525878-525900 ATAGGTGGACAAAGGGCAGGTGG + Intergenic
985604725 5:852564-852586 CACGGAGGACAATGAGCAGCGGG + Intronic
985966017 5:3339217-3339239 CACGGTGCACAAAGAGCAGAGGG + Intergenic
987264173 5:16235188-16235210 CAAGGAGGAGAAAGGGGAGATGG - Intergenic
987729748 5:21753630-21753652 CAAGGAGGTCAAAGATTAGATGG + Intronic
987929712 5:24388511-24388533 CAAGGAGGACCAAAGGCAGTTGG - Intergenic
988722858 5:33895600-33895622 CAAGCAGGTCAAAGGGTAGAAGG + Intergenic
989033616 5:37146075-37146097 CAAGGAAGAAAAAGGAGAGAAGG + Intronic
989635327 5:43525595-43525617 CAAGGAAAACTAAGGGCTGAGGG - Intergenic
990095495 5:52107216-52107238 CAATCATGACAAAAGGCAGAGGG + Intergenic
990323504 5:54651951-54651973 CAAGGTAGACAAAGTGTAGAAGG - Intergenic
991244673 5:64497638-64497660 CAGAGAGGAAAAAAGGCAGAGGG - Intergenic
991336617 5:65555291-65555313 CAAGGATGAAGAGGGGCAGAGGG + Intronic
991359870 5:65808342-65808364 CACGGAGGGGAAAGGGAAGAGGG - Intronic
992712234 5:79471073-79471095 CAAGCACGACAAAATGCAGATGG + Intronic
993823779 5:92655404-92655426 CATGGAGAATAAAGGGAAGAGGG - Intergenic
994132674 5:96248194-96248216 CAAGAGGGACAAAGAGCAAAGGG - Intergenic
994780525 5:104083845-104083867 AAAGGGGGACAAAGGGCACTAGG + Intergenic
995835123 5:116392975-116392997 CCAGGAGCTCAAAGGGCAAAGGG - Intronic
996423882 5:123291776-123291798 CTAGGAAGACAGAGGGCTGAAGG + Intergenic
996522833 5:124446603-124446625 CAAGGAGGAGAAACAGGAGAAGG - Intergenic
996562797 5:124848976-124848998 AGAGGAAGGCAAAGGGCAGAAGG - Intergenic
996682147 5:126239213-126239235 CACTCAGGACAAAGGGCACAAGG - Intergenic
997208949 5:132066576-132066598 CAAGAAGGAGCAAGGGCAGAGGG + Intergenic
997364036 5:133314136-133314158 CAGGGAGCACCAAGGGCAGGTGG - Intronic
997469106 5:134106940-134106962 CAGGGAGGACAGAGACCAGAGGG - Intergenic
997697509 5:135873142-135873164 CCTGGAGGACCAAGGGCAGGAGG + Intronic
997803559 5:136890817-136890839 TAAAGAGGTCAATGGGCAGATGG + Intergenic
998054476 5:139062602-139062624 CAAGGAGGACAAACTACAGCTGG + Intronic
998446551 5:142203288-142203310 GAAGGAGGACACAGGGCAGGTGG + Intergenic
999123447 5:149228210-149228232 GAACTAGGACTAAGGGCAGAAGG - Intronic
999518882 5:152330082-152330104 CAAGGCTGACAGATGGCAGAGGG - Intergenic
999768146 5:154755949-154755971 CAAGGAGGGCACCGGGCAGCAGG + Intronic
999873297 5:155774370-155774392 CAACAAGGACAAAGGGAAAATGG - Intergenic
1000037343 5:157459704-157459726 AAAGGAGGTCGCAGGGCAGAAGG + Intronic
1000596802 5:163224071-163224093 CAAGGAGGTAAAAGAGCAGAAGG - Intergenic
1001157636 5:169287007-169287029 CAAGGAGGGCACACGGCAGGGGG + Intronic
1001758908 5:174191588-174191610 CAAGGAGGATACAGGGAAGGAGG - Intronic
1001845818 5:174920125-174920147 CAAGGAGGACAAATGGAAGGGGG + Intergenic
1001903716 5:175453307-175453329 GGAGGAGGGAAAAGGGCAGAAGG + Intergenic
1002666449 5:180829192-180829214 GAAACAGGACAAAGGGCAAAAGG - Intergenic
1002666455 5:180829241-180829263 GAAACAGGACAAAGGGCAAAAGG - Intergenic
1002666461 5:180829290-180829312 GAAACAGGACAAAGGGCAAAAGG - Intergenic
1003021258 6:2511481-2511503 AGAGGCGGAAAAAGGGCAGAAGG + Intergenic
1003156942 6:3604916-3604938 CAATGATGAGAATGGGCAGAGGG - Intergenic
1003257482 6:4487183-4487205 CAAGGAGCAGAGAGGACAGAGGG + Intergenic
1003311163 6:4971030-4971052 CAAGGAGGACAAGGACCAGAAGG + Intergenic
1003731831 6:8833088-8833110 CAAGGAGCACAATTGCCAGATGG + Intergenic
1003994511 6:11525489-11525511 GAAGGTGGGCAAAGGGCAAAAGG + Intergenic
1004869527 6:19890722-19890744 GAAGAAGGAGAAAGGGAAGAAGG - Intergenic
1005069262 6:21849438-21849460 CTAGGAGTACGAAGGCCAGAGGG + Intergenic
1005248425 6:23915591-23915613 CAAAGAAGTAAAAGGGCAGAAGG - Intergenic
1005530935 6:26705206-26705228 GAAGGAGGAGAAAGGGAACAAGG - Intergenic
1005539861 6:26796430-26796452 GAAGGAGGAGAAAGGGAACAAGG + Intergenic
1006100391 6:31682832-31682854 CGAAGAGGGCAAAGGGCAAAGGG + Intronic
1007113433 6:39326936-39326958 CAAGGCAGAGAAACGGCAGACGG - Intergenic
1007210481 6:40189869-40189891 CAAGCTCCACAAAGGGCAGATGG + Intergenic
1007586056 6:42990109-42990131 CAATCAGGACCAAGGGCAGTGGG - Intronic
1008008968 6:46443531-46443553 CAAGGAGAAGAAAAGGGAGATGG - Intronic
1008413017 6:51205298-51205320 GAGGGAGGACAAAGGAAAGAGGG - Intergenic
1008675503 6:53813709-53813731 CAAGGTGTCCAAAGGTCAGAGGG - Intronic
1008753447 6:54764990-54765012 GAAGGAGGAGAAAAAGCAGAAGG - Intergenic
1009010678 6:57838571-57838593 GAAGGAGGAGAAAGGGAACAAGG + Intergenic
1009359267 6:62793142-62793164 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1009594972 6:65723668-65723690 CAAGGACAACAACGGGGAGATGG - Intergenic
1010077902 6:71822297-71822319 CCAGGAGAAAACAGGGCAGAGGG + Intergenic
1010373943 6:75144439-75144461 CAAGGAGGAAAAAGGGACTAAGG - Intronic
1010466521 6:76173262-76173284 CAAAGAGCACAGAGTGCAGAAGG + Intergenic
1010749568 6:79602963-79602985 AAAGGAGGAAAAATGGGAGAGGG + Intergenic
1010827008 6:80486485-80486507 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1011409685 6:87055082-87055104 CAGGGAGGAGAATGGGCAGAGGG - Intergenic
1011597302 6:89028165-89028187 CAAAGATGATTAAGGGCAGAAGG + Intergenic
1011716033 6:90106013-90106035 GAAGAAGGAAACAGGGCAGAGGG + Intronic
1012530087 6:100225190-100225212 CAAGGAGCACCAATGTCAGAGGG + Intergenic
1012652282 6:101770415-101770437 CAAAGAAGACAAAGAGCAGTAGG - Intronic
1012754295 6:103205517-103205539 CAAGGAGGAGAAGGAGGAGAAGG - Intergenic
1013794081 6:113865652-113865674 GATGGAGGAAAAAGGGGAGAGGG - Intergenic
1013891611 6:115033547-115033569 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1014454963 6:121624486-121624508 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1014657744 6:124129252-124129274 GAAGGAGGAGAAAGGGAAGAAGG + Intronic
1014856860 6:126412376-126412398 CAAGGAGGCCAGAAGGCAGTGGG - Intergenic
1015584671 6:134763350-134763372 CAATGGGTAGAAAGGGCAGATGG + Intergenic
1016017148 6:139198336-139198358 CAAGAAGGAGAAAGGAGAGAAGG - Intergenic
1016540461 6:145158630-145158652 CAAGGAGAACAACGAGCAAAAGG - Intergenic
1016994263 6:149950541-149950563 CACTGAGGGCAAAGAGCAGAGGG + Intergenic
1017058680 6:150460373-150460395 GCAGGAGGAAACAGGGCAGAAGG + Intergenic
1017190922 6:151651615-151651637 CAAGGAGGAAAAAAAGGAGAAGG - Intergenic
1017779425 6:157704731-157704753 CAAGGAGGGGAGAGGTCAGATGG + Intronic
1018842766 6:167530291-167530313 GAAGGATGACAGAGGGCAAAAGG - Intergenic
1019260006 7:76743-76765 GAAGGGGGACAAGGGGGAGAAGG - Intergenic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019453365 7:1111304-1111326 CAGGGAGGACACAGGGTAGCAGG + Intronic
1019660163 7:2219667-2219689 CAAGGGGGGCAGAGGGCAGGGGG + Intronic
1019937740 7:4267338-4267360 AAAGGAGGAGAAAAGGAAGAAGG - Exonic
1020129723 7:5552965-5552987 CGCAGAGGACAAAGGGCAAAAGG + Intronic
1020541222 7:9462578-9462600 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1021637223 7:22704907-22704929 CATGGAGGAGAGAGGTCAGATGG - Intergenic
1021804763 7:24343771-24343793 CCAGGAGGACAGAGAGCATATGG + Intergenic
1022316179 7:29247471-29247493 CAAGGAGGGCTGTGGGCAGAAGG - Intronic
1022473475 7:30695472-30695494 CAAGCAGGACTGAGGGGAGAGGG - Intronic
1022607611 7:31831700-31831722 GGAGGAGGAGAAGGGGCAGACGG + Intronic
1023538947 7:41244324-41244346 CAAGGAGCACAACGGCCAGTTGG - Intergenic
1024899345 7:54300086-54300108 CAAGGAGGGCAAGGGGGAGAAGG - Intergenic
1025048692 7:55715474-55715496 CTAGGAGGAGAAAGAGAAGAGGG - Intergenic
1025959280 7:66205765-66205787 GAAGGGAGAGAAAGGGCAGAGGG - Intronic
1026526915 7:71161994-71162016 GAAGGAGGAAGAAGGGAAGAAGG - Intronic
1026534109 7:71226294-71226316 CCAGGAAGGCCAAGGGCAGATGG - Intronic
1026901071 7:74037838-74037860 CAAGGAAGCCAACGGGCAGGAGG + Intronic
1027246910 7:76373718-76373740 CAAGGTGGAGAAAGGAAAGAAGG + Intergenic
1028823872 7:95246146-95246168 GAAGGATGATAAAGGGAAGATGG - Intronic
1029177510 7:98675279-98675301 CCAGGAGGTCACAGGACAGATGG - Intergenic
1029236530 7:99124346-99124368 TAAAAAGGCCAAAGGGCAGAAGG + Intronic
1030170395 7:106596129-106596151 GGAGGAGGAAAAAGGGAAGAAGG + Intergenic
1030751597 7:113237626-113237648 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1030830972 7:114221318-114221340 CTAGGAAGTCAATGGGCAGAGGG + Intronic
1030973478 7:116090914-116090936 CAATGAGAACATAGGGCACAGGG + Intronic
1031049959 7:116934994-116935016 CAGGGAGGAAGAAGGGCAGAGGG - Intergenic
1031417064 7:121507536-121507558 GAAGGAGGAGAAAGGGAAGGGGG + Intergenic
1031478442 7:122250403-122250425 CAAGGAGTACAAATGCCAAAAGG + Intergenic
1031862682 7:126999600-126999622 AAAAGAAGACAAATGGCAGACGG + Intronic
1033534292 7:142298093-142298115 TCAGGAGGACTGAGGGCAGATGG + Intergenic
1033534969 7:142303704-142303726 CATGGTGGACCAAAGGCAGAAGG - Intergenic
1033779729 7:144654407-144654429 GAAGGAGAACGAAGGGAAGAGGG + Intronic
1034084924 7:148314122-148314144 CAAGGAGGGGAGAGGTCAGATGG + Intronic
1034312588 7:150101951-150101973 ATAGGAGGATAAAGGGCAGTGGG + Intergenic
1034527402 7:151674174-151674196 AAAGAAAGACAAAGGGAAGATGG + Intronic
1034547981 7:151801431-151801453 CAATGAGGACCAAGTACAGAGGG + Intronic
1034794268 7:153998710-153998732 ATAGGAGGATAAAGGGCAGTGGG - Intronic
1034938731 7:155216403-155216425 CAAAGAGGAGAAAGAGTAGAGGG - Intergenic
1035601544 8:900070-900092 AAAGGAGGACAGAGGGCACTGGG + Intergenic
1035810477 8:2486770-2486792 CAAGGAGGACACTGTGCGGAAGG - Intergenic
1035825898 8:2643853-2643875 GGAGGAGGACAAAGGGGAGAAGG + Intergenic
1036032044 8:4984742-4984764 CAAGGAGGATGAACAGCAGAAGG + Intronic
1036400256 8:8401473-8401495 CAAGGAGGACACATGGCTGGAGG + Intergenic
1036472431 8:9063520-9063542 CAAGGAGGGGAGAGGTCAGATGG + Intronic
1036639394 8:10572909-10572931 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1037750494 8:21679059-21679081 GAAGGCAGACAGAGGGCAGAGGG - Intergenic
1037831973 8:22195119-22195141 CAGGGAGGAAAAAAGGCAGTTGG + Intronic
1038032400 8:23654054-23654076 AAAGGAGGAGAAAGGACAAAAGG - Intergenic
1038197185 8:25379070-25379092 GAAACAGGACAAAGGGCAAAAGG + Intronic
1038241651 8:25814709-25814731 AAAGGAGGACGAAGGGAAGGAGG + Intergenic
1038483594 8:27918565-27918587 GAAGGAAGACAAAGAGGAGAAGG + Intronic
1038524447 8:28261120-28261142 CAAGGAGGGAGAAGGGAAGAGGG - Intergenic
1038548994 8:28449220-28449242 CAAGGAAAAAAAAGGACAGAGGG + Intronic
1040663294 8:49599871-49599893 CAAGGAGGACAAAGAAGAAAAGG + Intergenic
1041483409 8:58348077-58348099 CAACAAGGAGAAAGGGCAAAGGG + Intergenic
1042223935 8:66500672-66500694 AAAGGAGGAGGAAGGGAAGAGGG - Intronic
1045912493 8:107426575-107426597 CAAGGAGGAAGAAGAGTAGAGGG - Intronic
1046358011 8:113113086-113113108 CAAGGAGCACATAGTGCAGTGGG - Intronic
1046386433 8:113513561-113513583 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047421995 8:124714935-124714957 ATAGGAGGACAAAGGTTAGAGGG - Intronic
1047829632 8:128615956-128615978 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1048143679 8:131820818-131820840 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1048325508 8:133436134-133436156 CAAGGTGGGCAGAGGACAGAAGG + Intergenic
1048382775 8:133882685-133882707 CAAGGGGCACACAGGGAAGAAGG - Intergenic
1048642091 8:136375078-136375100 CAAGGAGGTAGAAGAGCAGAAGG + Intergenic
1049471235 8:142775882-142775904 TAAGATGGACAAAGGACAGAGGG - Intronic
1049519494 8:143080748-143080770 GAAGGGGGACCAAAGGCAGAGGG + Intronic
1049657385 8:143804846-143804868 CAGGGAGGCCCAAGGGCAGAAGG + Intronic
1049681925 8:143922869-143922891 GCAGGAGGACAAGGAGCAGATGG - Exonic
1049824949 8:144662346-144662368 CAAGGTGGATAACGGGGAGAGGG - Intergenic
1049941395 9:549690-549712 CGAGGAGGAGAAAGGACAAAGGG - Exonic
1050774045 9:9237945-9237967 CAAAGGTGACAAAAGGCAGAAGG - Intronic
1050833623 9:10048218-10048240 CAAGGAGTACAAAGGACATGAGG - Intronic
1051769962 9:20566791-20566813 GAAGGAGGAAAAAGGGTAGAGGG + Intronic
1051939222 9:22484767-22484789 CAAGGAGGGCATAAGGCAGAAGG + Intergenic
1051949910 9:22619157-22619179 CAAGGAGGAAAAATGCCAGAGGG + Intergenic
1052980532 9:34445290-34445312 CAAGGAGATCAAAGGGGAGTTGG + Intronic
1053164891 9:35837333-35837355 TTAGGAGGATAAAGGGGAGATGG + Intronic
1053634672 9:39984368-39984390 AAAGAAGGCCAAAGGGAAGAAGG - Intergenic
1054209215 9:62266329-62266351 AAAGAAGGCCAAAGGGAAGAAGG + Intergenic
1054315602 9:63581801-63581823 AAAGAAGGCCAAAGGGAAGAAGG - Intergenic
1055783607 9:79847312-79847334 CAGAGAGAACAAAGGGCAAAGGG - Intergenic
1056247956 9:84717015-84717037 CAAGGAGGTGGAAGGGTAGAGGG + Intronic
1056684511 9:88748548-88748570 CAAGAAGGACAAATACCAGATGG + Intergenic
1056808763 9:89748017-89748039 AAACCAGGACAAAGGCCAGAAGG + Intergenic
1056979577 9:91296776-91296798 AAAGGAGGAAAAAGGACACATGG + Intronic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1057192961 9:93097387-93097409 AAGGGAGGACAAAGGGGAGCAGG - Intronic
1057286970 9:93764529-93764551 CAGCAAGGGCAAAGGGCAGAAGG - Intergenic
1058219777 9:102284206-102284228 CAAGGAGAAAAAAAGGCATAAGG - Intergenic
1058612310 9:106789833-106789855 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1059812652 9:117873055-117873077 CATGGAGCCCAAAGGGTAGATGG + Intergenic
1060771812 9:126337426-126337448 CAAGGGGGAAAAAGTACAGAAGG - Intronic
1061287284 9:129631272-129631294 CCAGGAGGACAAAGAACAAAGGG - Intronic
1061600936 9:131669618-131669640 TGAGGAGGAGAAAGGGCTGAGGG - Intronic
1061873653 9:133533560-133533582 CAAGCTGGACAGAGGGCAGACGG + Intronic
1061970233 9:134040985-134041007 CAAGGAAGACAGAGGGCGGGTGG + Intronic
1062359187 9:136179334-136179356 GAAGCAGGACAAAGGGCAGGCGG - Intergenic
1062478200 9:136739917-136739939 CCAGGAGGGCAAAGGGCTGAGGG + Intronic
1062665356 9:137668125-137668147 GAAGGAAGACAAAAGGAAGAAGG + Intronic
1062744691 9:138203721-138203743 GAAGGGGGACAAGGGGGAGAAGG + Intergenic
1203462188 Un_GL000220v1:51553-51575 CTAGGAGGCCAAAGAGGAGAAGG - Intergenic
1203632661 Un_KI270750v1:83219-83241 CGGGCAAGACAAAGGGCAGAGGG - Intergenic
1185817474 X:3169702-3169724 CCTTGTGGACAAAGGGCAGAAGG - Intergenic
1186681079 X:11874940-11874962 AAAGCATGACAAATGGCAGAAGG + Intergenic
1189214346 X:39310487-39310509 CCAGGAGGACAAATGTGAGATGG + Intergenic
1189383794 X:40520559-40520581 GAGGGAGGCCCAAGGGCAGAAGG + Intergenic
1189491024 X:41471942-41471964 AAAGGAGGACAAACTGCACAGGG - Intronic
1189900121 X:45697861-45697883 CATGGAGGACCAAGAACAGACGG - Intergenic
1190056206 X:47182275-47182297 GAAGGAGGGCAAAGAGAAGAAGG + Exonic
1190497518 X:51040811-51040833 CCAGAGGGAGAAAGGGCAGAGGG + Intergenic
1190623992 X:52318317-52318339 AAAAGGGAACAAAGGGCAGATGG - Intergenic
1191793545 X:64997167-64997189 CATGGAGGCCAAAAGGCAGTGGG + Intronic
1191797743 X:65039847-65039869 CTAGGAGGTAAAAGGTCAGAAGG + Intergenic
1193042748 X:77020865-77020887 CAAGGTGGGCAAATGGCAGTAGG + Intergenic
1193177151 X:78408005-78408027 GATGGAGGACAAAGGTAAGATGG - Intergenic
1194822860 X:98528318-98528340 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1195427427 X:104750287-104750309 CAATGAAGCCAAAGGGCAGTTGG + Intronic
1195551723 X:106179309-106179331 CAAGGTGGAGAAAGGAGAGAAGG - Intronic
1195696095 X:107668733-107668755 GGAGGAGGACAGTGGGCAGATGG - Intergenic
1196186548 X:112750568-112750590 CAAGCTGGTCAAAGGTCAGATGG - Intergenic
1196572412 X:117280825-117280847 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1197136811 X:123070529-123070551 CAATAAGGACTAAGGTCAGATGG + Intergenic
1198662443 X:138984443-138984465 TAAGGAGGAGAAAGAGGAGAAGG + Intronic
1200532933 Y:4359442-4359464 CGAGGAGGGGAGAGGGCAGATGG + Intergenic
1200611232 Y:5328823-5328845 CAAGGAGGGGAGAGGTCAGATGG + Intronic