ID: 1121248496

View in Genome Browser
Species Human (GRCh38)
Location 14:92482395-92482417
Sequence GGGGGAACAGACTCACCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121248496_1121248502 11 Left 1121248496 14:92482395-92482417 CCTCTGGGTGAGTCTGTTCCCCC 0: 1
1: 0
2: 1
3: 17
4: 175
Right 1121248502 14:92482429-92482451 TTCCTTATCCTGTCAAATGAAGG 0: 1
1: 0
2: 2
3: 24
4: 289
1121248496_1121248504 17 Left 1121248496 14:92482395-92482417 CCTCTGGGTGAGTCTGTTCCCCC 0: 1
1: 0
2: 1
3: 17
4: 175
Right 1121248504 14:92482435-92482457 ATCCTGTCAAATGAAGGATTTGG 0: 1
1: 0
2: 1
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121248496 Original CRISPR GGGGGAACAGACTCACCCAG AGG (reversed) Intronic
900119890 1:1044077-1044099 AGGGGAGCAGAGTCACCCAGGGG - Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
902741284 1:18440247-18440269 GGGGAAACAGAGGCACCAAGAGG - Intergenic
904067293 1:27763576-27763598 GGGTAAACAGAATCACCAAGAGG - Intergenic
906404500 1:45530999-45531021 GGAGGAACATAAGCACCCAGAGG + Intergenic
906747771 1:48233756-48233778 GGGAGAAGAGACTCACCAACAGG - Exonic
907920335 1:58905569-58905591 GGGGAAACAGATTCAGACAGAGG - Intergenic
907968348 1:59355867-59355889 TGGGGACCAGATTCAGCCAGTGG - Intronic
908437268 1:64119198-64119220 GGGGGACCACATTCCCCCAGAGG - Intronic
908548704 1:65188051-65188073 GGGGGTACAGACTCAGTCTGGGG + Intronic
914803112 1:150974603-150974625 GGGGGCCCCGACTCACCCGGCGG + Exonic
915020081 1:152771038-152771060 GTGAGAACAGACTAACACAGAGG - Intronic
915473610 1:156139709-156139731 GGGAGAATGGACTCACCCCGGGG - Exonic
915719014 1:157970273-157970295 GGGGAAACTGATTCACCTAGTGG + Intergenic
918186784 1:182134605-182134627 GGGAGAACAGACTAATACAGTGG + Intergenic
919733306 1:200928437-200928459 GGGGGGAAAGGCTGACCCAGTGG + Intergenic
920226250 1:204441373-204441395 GTGGGAAGAGAACCACCCAGGGG + Intronic
921061112 1:211585186-211585208 GGGGGAACAAACCCAGTCAGAGG + Intergenic
924694323 1:246382957-246382979 CAGTCAACAGACTCACCCAGTGG + Intronic
1063686118 10:8238551-8238573 GGGGAAACTGAGGCACCCAGCGG - Intergenic
1067215528 10:44299702-44299724 GGGGACACAGACACACACAGGGG - Intergenic
1068571003 10:58629108-58629130 GGGGGAAAGGACTCAGCCACAGG + Intronic
1069583729 10:69582803-69582825 GGGTGATGTGACTCACCCAGGGG + Intergenic
1073581086 10:104666147-104666169 TGGGAAACCGAATCACCCAGGGG - Intronic
1075068634 10:119306302-119306324 GGCTGAACAGACTCACACAGAGG - Intronic
1075614808 10:123883229-123883251 TGGGGAACAGACTCCCCAAAGGG + Intronic
1076657490 10:132034534-132034556 GTGGGAACGGACTAACACAGAGG + Intergenic
1077119456 11:900116-900138 GGGGCAACAGACACACACGGGGG + Intronic
1080030139 11:27651639-27651661 GTGGGCACAGAATCACCTAGAGG + Intergenic
1081410114 11:42747594-42747616 AGGGGAAGAGACTCACTCACTGG - Intergenic
1081868356 11:46371983-46372005 GAGGGAACAAAGTCACCCAGGGG + Intronic
1083400226 11:62418436-62418458 GTGGGAACAGACCCAGCCTGGGG + Intronic
1096520838 12:52183746-52183768 GTGGGAGCAGCCTTACCCAGTGG + Intronic
1101637934 12:106561664-106561686 GTGAGAACACACTCACCCCGAGG - Intronic
1103029471 12:117600959-117600981 GGGGCAAAAGACTCATCCAGGGG - Intronic
1103354901 12:120312474-120312496 TGGGGAACAGACTCCCCGGGGGG + Exonic
1104189650 12:126467705-126467727 GTGGGAACAGACTAATACAGTGG - Intergenic
1104198654 12:126566602-126566624 GTGAGAACAGACTCATACAGTGG - Intergenic
1105755856 13:23463656-23463678 GAGGAAACAGACACACGCAGAGG + Intergenic
1105828426 13:24143135-24143157 TGGGGAGCACCCTCACCCAGTGG - Intronic
1106928717 13:34640646-34640668 GGGGGAGCAGAATGACGCAGAGG - Intergenic
1109753404 13:66725795-66725817 GGGGGAACAGAACTACCCAAAGG + Intronic
1111818373 13:93183478-93183500 GGGGCAGCAGAGTCAGCCAGAGG - Intergenic
1113094973 13:106653883-106653905 GAGGAAACAGACGCACACAGAGG + Intergenic
1113255058 13:108496529-108496551 GAGGGACCAGTCTCACCCGGGGG + Intergenic
1114409351 14:22486130-22486152 GGGAGAATAAACTCACCCAAAGG - Intergenic
1115852582 14:37599511-37599533 AGGGGAAAAGACAAACCCAGTGG - Intronic
1116094201 14:40347864-40347886 AGAGGAAGAGACTCACCTAGAGG + Intergenic
1118575772 14:67240448-67240470 GGGGGCACAGTTTCCCCCAGGGG - Intergenic
1121248496 14:92482395-92482417 GGGGGAACAGACTCACCCAGAGG - Intronic
1123155229 14:106218405-106218427 GGGGGAACAGGACCACCCGGGGG - Intergenic
1125542594 15:40478837-40478859 GAGGGAGCAGACTCACCCAGAGG + Intergenic
1126807012 15:52361050-52361072 TGGAGAGCAGACTCATCCAGAGG + Intronic
1127354529 15:58185595-58185617 AGGGGAAAAGACTGAGCCAGAGG - Exonic
1132143755 15:99414876-99414898 CCGGGAACTGACTCACCCTGCGG - Intergenic
1132631777 16:921261-921283 AGGGGAACAGAATGCCCCAGTGG - Intronic
1132800040 16:1747501-1747523 GAGGACACAGACACACCCAGGGG - Intronic
1132956526 16:2597269-2597291 CTGGGAACAGACTCACCGTGTGG - Exonic
1133130631 16:3674290-3674312 GGGACAACAGAGTCACCCTGAGG + Intronic
1134092983 16:11401413-11401435 AGGGAGACAGACTCAGCCAGTGG + Intronic
1135035687 16:19075147-19075169 AGGGGGACAAACTCACCCTGAGG - Intronic
1135260011 16:20972636-20972658 CAGGGATCAGACCCACCCAGGGG + Intronic
1138230586 16:55332886-55332908 GGGGGAACAGACTGCCACTGGGG - Intergenic
1139041701 16:63005914-63005936 GTGAGAACAGACTAACACAGTGG - Intergenic
1139653614 16:68374802-68374824 GGGGACACAGAGTCACCCACAGG + Intronic
1141039785 16:80663216-80663238 GAGAGAACAGACCAACCCAGGGG + Intronic
1142027419 16:87822067-87822089 GGGGTTACAGGCTGACCCAGGGG - Intergenic
1142284613 16:89166689-89166711 GGGGACACAGACCCACGCAGCGG + Intergenic
1142703266 17:1677488-1677510 CAGGGAACAGACTCAAACAGGGG + Intronic
1142780125 17:2175136-2175158 GTGGGATCAGACTCAGGCAGCGG - Intronic
1144669831 17:17126670-17126692 GGCGGCAGAGAGTCACCCAGAGG - Intronic
1146399890 17:32494212-32494234 GGGTGAGCAGAGTCACCCACAGG - Exonic
1147587243 17:41659520-41659542 GGGGGAAGAGAGGCACCCTGGGG + Intergenic
1148402418 17:47377505-47377527 GGGGGAACAGCCTGTTCCAGTGG - Intronic
1152319052 17:79597733-79597755 GGGAGGACAGACTCACCCTGTGG + Intergenic
1156867386 18:41904101-41904123 GGGTGAACACCCCCACCCAGTGG + Intergenic
1157522115 18:48352501-48352523 GGAGGCACAGTCTCACCCTGTGG + Intronic
1159680290 18:71341741-71341763 GGGCACACAGACACACCCAGAGG - Intergenic
1159951703 18:74488836-74488858 GTGAGAACAGACTCACACAATGG + Intergenic
1160836032 19:1124810-1124832 TGGGCCACAGACTCATCCAGAGG - Intronic
1161523035 19:4736520-4736542 GGGGGGACAGAATCACCCCCAGG - Intergenic
1164844719 19:31422149-31422171 GCTGGAACAGAATCACCAAGGGG - Intergenic
1164877417 19:31701214-31701236 GGAGGAACAGAATCACAGAGGGG + Intergenic
1165151626 19:33763987-33764009 GGGTGGACAGACTCCTCCAGTGG + Intronic
1166561213 19:43733547-43733569 GGGGGTAGAGACTGACCCACGGG + Intronic
1166926360 19:46271473-46271495 GTGAGAACAGACTCATACAGTGG - Intergenic
929581730 2:43085662-43085684 GGGAGAACAGATTCAGGCAGTGG - Intergenic
931587156 2:63841283-63841305 CGGGAAACACACTCATCCAGGGG - Intronic
931618766 2:64189288-64189310 GGAGGATCAGACTCACCTGGAGG + Intergenic
931777591 2:65553768-65553790 GGAGGAACAGAATTACCCAAAGG + Intergenic
934851235 2:97702479-97702501 GGGGGAAGAGAGTATCCCAGAGG + Intergenic
935348084 2:102127178-102127200 TGGGGAGCTGACTCACCCAATGG - Intronic
936376559 2:111946115-111946137 GGGGGAAGAGACTCCCTCAGAGG + Intronic
937231811 2:120402387-120402409 GGGGTACCAGCCTCACACAGAGG + Intergenic
939099343 2:137878072-137878094 GGGGGAACTCATTCACCCTGAGG + Intergenic
939171499 2:138701434-138701456 GGGAGAACACACACACCCTGGGG + Intronic
945257348 2:207813539-207813561 GGGGGAATAGACCCACAGAGGGG + Intergenic
946331725 2:219013390-219013412 GGAGGAACTGACACAGCCAGTGG + Intronic
948874034 2:240818045-240818067 GGGGGAAAGGAGGCACCCAGGGG + Intronic
1168877645 20:1182331-1182353 AGGGGAACAGACTGCCTCAGAGG + Intronic
1168940449 20:1706978-1707000 GAGGGTACAGACGCACACAGAGG + Intergenic
1169330091 20:4709546-4709568 TAGGGCACAGACACACCCAGAGG - Intergenic
1173865512 20:46309879-46309901 GAGGGAACAGACTGGCACAGTGG - Intergenic
1178121929 21:29477938-29477960 GGGAGAACAGGCTGACCCAGAGG + Intronic
1179928533 21:44551727-44551749 CGGGGGACAGGCTCAGCCAGGGG - Intronic
1180152597 21:45958685-45958707 GGGAAAACAGACTCAGCCAGAGG + Intergenic
1180867013 22:19125514-19125536 TGGGGAACAGACACAGCCCGAGG + Intergenic
1181434255 22:22900992-22901014 GCGGGAACAGAGTGACCGAGGGG - Intergenic
1181435191 22:22906358-22906380 GTGGGAACAGAGTGACCGAGGGG - Intergenic
1181436762 22:22915640-22915662 GCGGGAACAGAGTGACCAAGGGG - Intergenic
1181438241 22:22922610-22922632 GTGGGAACAGAGTGACCGAGGGG - Intergenic
1181541045 22:23573547-23573569 GCGGGAACAGAGTGACCGAGGGG + Exonic
1182049580 22:27302522-27302544 GAGGCCACAGACTCACCCAGTGG - Intergenic
1182172718 22:28249118-28249140 GGGGAGACAGAATAACCCAGAGG + Intronic
1182981103 22:34672164-34672186 GGGTCAACAGACCCACCCAGTGG + Intergenic
1184743732 22:46444087-46444109 CGGGGCTCAGACTCTCCCAGAGG + Intronic
1184774376 22:46616045-46616067 GGGGGAACCGACACGCACAGGGG - Intronic
1184774478 22:46616471-46616493 GGGGGAACCGACACGCACAGGGG - Intronic
1184774646 22:46617137-46617159 GGGGGAACCTACACACACAGGGG - Intronic
1184950405 22:47837888-47837910 GGGGCAACAGATTCACACAGGGG - Intergenic
950442730 3:13019380-13019402 GGGGCAACAGGCTCACTCGGAGG + Intronic
950669651 3:14518441-14518463 GGGGGAGCAGCCTCAGCCCGTGG - Intronic
953041759 3:39261775-39261797 GGAGGGACAGCCACACCCAGGGG - Intergenic
953509732 3:43523973-43523995 GGGTAAACAAGCTCACCCAGGGG + Intronic
953706232 3:45232936-45232958 GAGAGAACAGACTGACCAAGAGG - Intergenic
956294334 3:67695657-67695679 AGGGGAACAGAGGCACCCAGAGG - Intergenic
957833213 3:85550512-85550534 AGTGTACCAGACTCACCCAGAGG - Intronic
967808356 3:193734691-193734713 GGGGCAACAGAGACTCCCAGGGG + Intergenic
968994224 4:3935633-3935655 CTGGGAACCCACTCACCCAGGGG + Intergenic
969049424 4:4362202-4362224 GTGAGAACAGACTAACACAGTGG - Intronic
969475108 4:7417876-7417898 GGGGGAGCAGCCCCACCAAGGGG + Intronic
969717109 4:8873068-8873090 GAGAGAAGAGACTCCCCCAGAGG + Intergenic
981136944 4:141221048-141221070 GGGAGACCGGACTCACTCAGGGG - Exonic
981444346 4:144818394-144818416 GGTGGTACAGATTCACCCTGTGG - Intergenic
984660817 4:182373304-182373326 GGCAAAACAGACTCACTCAGAGG - Intronic
987046733 5:14115863-14115885 GGTGGAAAAGACCAACCCAGAGG - Intergenic
987060901 5:14242973-14242995 GAGGGAACAGACACATGCAGTGG + Intronic
989695095 5:44190941-44190963 GGGTCCACAGACTCACCCAGGGG - Intergenic
991250918 5:64560222-64560244 GTTGTAACAGACTAACCCAGTGG + Intronic
991293777 5:65059960-65059982 GTGAGAACAGACTCATACAGAGG + Intergenic
991509638 5:67362486-67362508 GGGAGAACAGACTGGCTCAGTGG + Intergenic
991941826 5:71860728-71860750 TAGGGAACAGACTAGCCCAGAGG - Intergenic
996110628 5:119562376-119562398 GGGATAAAAGACTCACCCACAGG + Intronic
996776279 5:127136019-127136041 GGGAGACCAGAATCACCTAGAGG - Intergenic
998129781 5:139645878-139645900 GTGGGGACAGTCTCACCCAAGGG + Intergenic
1004062216 6:12208695-12208717 GGGGACACAGACACACACAGAGG + Intergenic
1004310311 6:14539816-14539838 GGAGGAACAGCCACACACAGAGG + Intergenic
1006423408 6:33949336-33949358 TGGGGAAAGGCCTCACCCAGGGG + Intergenic
1006603309 6:35239873-35239895 GGGTGAGCAGACTCAGCCAAAGG + Exonic
1007407588 6:41643928-41643950 GGGGGACCTGACTCTCCCACAGG - Intronic
1013286897 6:108689628-108689650 GCTGGCACAGGCTCACCCAGGGG - Intergenic
1015322798 6:131894822-131894844 GGGGTAACAGCTTCTCCCAGAGG - Exonic
1016078687 6:139829359-139829381 AGGGGAAAATACTCTCCCAGAGG + Intergenic
1018028886 6:159826535-159826557 GGGAGAACAGACTAACACAGTGG - Intergenic
1019432270 7:1004611-1004633 GGGGGAGCAGACACAGCGAGGGG + Intronic
1020259288 7:6521629-6521651 GGGGACACAGAGTCACACAGAGG - Intronic
1020318506 7:6923999-6924021 CTGGGAACACACTCATCCAGGGG + Intergenic
1024117768 7:46209544-46209566 TGGGGCACAGACACACACAGAGG - Intergenic
1026899878 7:74030943-74030965 GAGGGGACACAGTCACCCAGTGG + Intronic
1027216314 7:76186058-76186080 GGGTGAACAGCCTCCCTCAGAGG - Intergenic
1027883832 7:83876806-83876828 CAGGGAACAGATTCCCCCAGGGG + Intergenic
1029357824 7:100065806-100065828 GTGGGAACAGACTCACCCTATGG - Intronic
1031330975 7:120464168-120464190 GCACGAACAGACTCACCGAGAGG - Intronic
1032400974 7:131624237-131624259 GGGGTAACAGATTCTGCCAGGGG - Intergenic
1032824776 7:135558233-135558255 GGGGGACCAGACTCAGCCCTGGG - Intronic
1033287936 7:140058522-140058544 TGGGGCACAGACACACACAGAGG + Intronic
1036123264 8:6040683-6040705 GTGAGAACAGACTCATACAGGGG - Intergenic
1037152552 8:15655471-15655493 GGGGGAAGAGACAAACCCTGGGG + Intronic
1038983659 8:32785915-32785937 GGGGGAACAGTTGCACCCAGTGG + Intergenic
1039571245 8:38588093-38588115 AGGGGACTAGACTCACCCAGTGG - Intergenic
1043927447 8:86053285-86053307 GGGAGAACAGAGTCAGCAAGTGG - Intronic
1046815023 8:118573439-118573461 GTGAGAACAGACTAACACAGTGG + Intronic
1047170994 8:122492127-122492149 TGAGGAACAGACTAACACAGAGG + Intergenic
1047690528 8:127348970-127348992 TGGGCACCAGAATCACCCAGAGG - Intergenic
1049094475 8:140540347-140540369 GGGGGAGGAGCCCCACCCAGTGG - Intronic
1049249751 8:141581963-141581985 GAGGGGACAGACTCAGCAAGGGG + Intergenic
1056751287 9:89353305-89353327 GGGGAGACAGAGACACCCAGGGG - Intronic
1057260275 9:93579017-93579039 TGGGGAGCAGGCACACCCAGAGG - Intronic
1057317875 9:93981826-93981848 GGGAGAACAGACTAATACAGAGG + Intergenic
1058724503 9:107789137-107789159 TGGGGAACAGAATGACTCAGTGG + Intergenic
1058940999 9:109812471-109812493 GGGGGTACTGACCCATCCAGCGG + Intronic
1059410020 9:114125881-114125903 GAGAGAAGAGAGTCACCCAGTGG + Intergenic
1059414594 9:114155325-114155347 GGGGAAACAGATTCACAGAGAGG - Intergenic
1060549789 9:124479496-124479518 GGGACATCATACTCACCCAGCGG + Intergenic
1060983900 9:127808919-127808941 AGGGGCACAGACACACGCAGTGG - Intronic
1060989715 9:127841389-127841411 GGGGGATCCCAGTCACCCAGAGG + Intronic
1185682031 X:1896864-1896886 GGGGACACAGACACACACAGAGG - Intergenic
1186434704 X:9532741-9532763 GGGGACACAGACACACACAGAGG - Intronic
1189202744 X:39211756-39211778 GCGAGAACAGACTAACACAGAGG - Intergenic
1195179427 X:102342541-102342563 GGGGCCACAGACTCAAGCAGTGG + Intergenic
1195221010 X:102745659-102745681 GGGGGTGCAGACACACCAAGGGG + Intronic
1197308767 X:124878307-124878329 GGAGGAACAATCTCATCCAGAGG + Intronic
1197803219 X:130373953-130373975 GGAGGAACAGCCTTACCTAGAGG + Intergenic
1198114393 X:133531169-133531191 GCGGGAACAGAGACACCCATCGG + Intergenic