ID: 1121249144

View in Genome Browser
Species Human (GRCh38)
Location 14:92486677-92486699
Sequence CGGATACACACTTGGGATCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121249137_1121249144 6 Left 1121249137 14:92486648-92486670 CCACCCCACATTCTGCAGGTGAC 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1121249144 14:92486677-92486699 CGGATACACACTTGGGATCCCGG 0: 1
1: 0
2: 0
3: 2
4: 66
1121249139_1121249144 2 Left 1121249139 14:92486652-92486674 CCCACATTCTGCAGGTGACTATT 0: 1
1: 0
2: 0
3: 23
4: 155
Right 1121249144 14:92486677-92486699 CGGATACACACTTGGGATCCCGG 0: 1
1: 0
2: 0
3: 2
4: 66
1121249140_1121249144 1 Left 1121249140 14:92486653-92486675 CCACATTCTGCAGGTGACTATTA 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1121249144 14:92486677-92486699 CGGATACACACTTGGGATCCCGG 0: 1
1: 0
2: 0
3: 2
4: 66
1121249138_1121249144 3 Left 1121249138 14:92486651-92486673 CCCCACATTCTGCAGGTGACTAT 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1121249144 14:92486677-92486699 CGGATACACACTTGGGATCCCGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121249144 Original CRISPR CGGATACACACTTGGGATCC CGG Exonic
903325155 1:22564987-22565009 GGGATTCACACTTGTGACCCAGG + Intronic
918417694 1:184329084-184329106 CAGCTTCACACTTGGGATCAGGG - Intergenic
1065174175 10:23061067-23061089 TAGACACACTCTTGGGATCCAGG - Intergenic
1066294848 10:34044892-34044914 CCGAGACACACTCGGGATCCAGG + Intergenic
1070328710 10:75403578-75403600 TGCATACACACTGGGCATCCAGG - Intergenic
1075786088 10:125051175-125051197 GGGACATAAACTTGGGATCCAGG - Intronic
1078001739 11:7502197-7502219 CAGAAACACACTTGACATCCTGG + Intronic
1081943848 11:46970251-46970273 ATGATACACAATTGAGATCCCGG + Intronic
1085220816 11:74872514-74872536 TGGATACACCTTGGGGATCCTGG - Intronic
1086286424 11:85256541-85256563 CACATACCCACTTGGGCTCCAGG + Intronic
1090925438 11:131245917-131245939 AGAATACAGACTTGGGGTCCAGG + Intergenic
1091181541 11:133608731-133608753 AAGATACAAACTTGGCATCCTGG - Intergenic
1096621059 12:52865776-52865798 CGGAAGCTCTCTTGGGATCCTGG + Intergenic
1101652883 12:106693747-106693769 CGGAGCCACAGTAGGGATCCTGG + Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1106346502 13:28884602-28884624 CATATACACACTTGGGAGCGGGG + Intronic
1107697435 13:43013870-43013892 AGGACACACACTTGGTTTCCAGG + Intergenic
1112975806 13:105315488-105315510 GGGATACTCCCTTGGGAACCCGG + Intergenic
1121249144 14:92486677-92486699 CGGATACACACTTGGGATCCCGG + Exonic
1128979710 15:72177339-72177361 CGAGTACACACCTGGGAACCAGG + Intronic
1133648557 16:7787801-7787823 AGGATACACACTATTGATCCTGG + Intergenic
1133817090 16:9206170-9206192 CGCACACACACATGGGATCAGGG - Intergenic
1142217748 16:88838149-88838171 AGGAGACACACTTGGGTTCGAGG - Intronic
1203143862 16_KI270728v1_random:1786708-1786730 CAGATACTCACCTGGGATGCGGG - Intergenic
1142813344 17:2406851-2406873 GGGAATCAGACTTGGGATCCAGG + Intronic
1154130872 18:11735907-11735929 CCGATAAACAATTGGGACCCAGG - Intronic
1155681856 18:28496959-28496981 CGAATTCACACTTGGGATCTAGG - Intergenic
1160067151 18:75586216-75586238 CAGATGCCCACTTGGGATTCGGG - Intergenic
1166438750 19:42791933-42791955 TGGATACACCTCTGGGATCCTGG + Intronic
1166473764 19:43102721-43102743 TGGATACACCTCTGGGATCCTGG + Intronic
1166487714 19:43227786-43227808 TGGATACACCTCTGGGATCCTGG + Intronic
1166494546 19:43289658-43289680 TGGATACACCTCTGGGATCCTGG + Intergenic
924974343 2:159351-159373 CGTTTACAAACTTGGGACCCTGG + Intergenic
927980127 2:27369906-27369928 CTGATGCAGACTCGGGATCCGGG - Exonic
932118725 2:69078350-69078372 AGGCTACAGACTTGGGGTCCAGG + Intronic
935367609 2:102310839-102310861 GGTATAGACACTTTGGATCCTGG + Intergenic
936021693 2:109000097-109000119 AGGATACACACTCTGGATTCAGG - Intergenic
936284877 2:111174066-111174088 CGGGGACAGACTGGGGATCCAGG + Intergenic
942397593 2:175568178-175568200 GGCATGCACACTTTGGATCCAGG - Intergenic
947711142 2:232316620-232316642 AGGAGGCACACTTGGGTTCCCGG + Intronic
948632041 2:239308566-239308588 CGGAACCACACTTCGTATCCAGG + Intronic
1170652313 20:18253920-18253942 CTGATGGACACTTGGGTTCCTGG - Intergenic
1174072547 20:47909194-47909216 AGACGACACACTTGGGATCCAGG - Intergenic
1179550779 21:42142150-42142172 CAGAGAGACACTGGGGATCCCGG - Exonic
1180969517 22:19807852-19807874 GGGATTCAGACTTGGGGTCCCGG - Intronic
952321508 3:32282075-32282097 CAGATACAAATCTGGGATCCAGG - Intronic
956180743 3:66516001-66516023 AGGATATAAACTTAGGATCCTGG + Intergenic
960870094 3:122239442-122239464 CAGAGACACAGTTGGGAGCCAGG - Intronic
966955192 3:184869660-184869682 CAGACACACACTTGGGGTCAGGG + Intronic
982987403 4:162228117-162228139 AGGATTCACTCTTGGGATCATGG + Intergenic
986145055 5:5070329-5070351 CACATACACACTTAGGATCGGGG - Intergenic
986796246 5:11215191-11215213 CAGATTCACACTTGGGAACAAGG + Intronic
986984438 5:13484277-13484299 CACATACACAGTGGGGATCCAGG + Intergenic
991475014 5:67010160-67010182 GGGATACACGTTTGGGATACTGG - Intronic
997040648 5:130249166-130249188 AGGATAAACACTTGGGATGATGG - Intergenic
997234566 5:132265398-132265420 AGGGTACCCACTTGGGAGCCTGG + Intronic
1004031298 6:11871873-11871895 AGGATACACACTAGGGCACCAGG - Intergenic
1010132072 6:72505975-72505997 TGTGTAAACACTTGGGATCCAGG + Intergenic
1012184477 6:96196067-96196089 AAGATACATACTTTGGATCCTGG + Intronic
1019132547 6:169887966-169887988 CTGATGCACACTTGGATTCCGGG + Intergenic
1022350515 7:29563541-29563563 TAGTTACAAACTTGGGATCCCGG + Intergenic
1035722408 8:1802117-1802139 CGGATGCTCACATGGGAGCCTGG - Intergenic
1038276078 8:26122046-26122068 CGGAAACACACTTGTGAATCTGG - Intergenic
1042023650 8:64399621-64399643 CCCATGTACACTTGGGATCCTGG + Intergenic
1054864124 9:69982416-69982438 CCTGAACACACTTGGGATCCAGG + Intergenic
1057242102 9:93420249-93420271 CGGATCCACAGTTGGGTTCATGG + Intergenic
1188814516 X:34694962-34694984 CGGCTTCATACTGGGGATCCAGG - Intergenic
1193533646 X:82686644-82686666 AAGATAGACACTTTGGATCCAGG - Intergenic
1198837546 X:140820491-140820513 CGGATGCACCTTGGGGATCCTGG + Intergenic