ID: 1121251348

View in Genome Browser
Species Human (GRCh38)
Location 14:92501913-92501935
Sequence TGTCACTAGCTCTTACGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121251347_1121251348 1 Left 1121251347 14:92501889-92501911 CCTGCTCATCAGAAAGAAGGTCT No data
Right 1121251348 14:92501913-92501935 TGTCACTAGCTCTTACGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121251348 Original CRISPR TGTCACTAGCTCTTACGTCA TGG Intergenic
No off target data available for this crispr