ID: 1121252049

View in Genome Browser
Species Human (GRCh38)
Location 14:92506536-92506558
Sequence CCAAGAAGACGGCCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121252049_1121252059 20 Left 1121252049 14:92506536-92506558 CCAGGCCAGGGCCGTCTTCTTGG No data
Right 1121252059 14:92506579-92506601 CACAGAGCTTGTGCTTAGAGGGG No data
1121252049_1121252058 19 Left 1121252049 14:92506536-92506558 CCAGGCCAGGGCCGTCTTCTTGG No data
Right 1121252058 14:92506578-92506600 GCACAGAGCTTGTGCTTAGAGGG No data
1121252049_1121252057 18 Left 1121252049 14:92506536-92506558 CCAGGCCAGGGCCGTCTTCTTGG No data
Right 1121252057 14:92506577-92506599 TGCACAGAGCTTGTGCTTAGAGG No data
1121252049_1121252060 21 Left 1121252049 14:92506536-92506558 CCAGGCCAGGGCCGTCTTCTTGG No data
Right 1121252060 14:92506580-92506602 ACAGAGCTTGTGCTTAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121252049 Original CRISPR CCAAGAAGACGGCCCTGGCC TGG (reversed) Intergenic
No off target data available for this crispr