ID: 1121252683

View in Genome Browser
Species Human (GRCh38)
Location 14:92511620-92511642
Sequence CTCCGCCGTCTCCCTCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121252683_1121252686 0 Left 1121252683 14:92511620-92511642 CCCTGTTGAGGGAGACGGCGGAG No data
Right 1121252686 14:92511643-92511665 GAGATGACTCATTCCCATCCAGG No data
1121252683_1121252691 21 Left 1121252683 14:92511620-92511642 CCCTGTTGAGGGAGACGGCGGAG No data
Right 1121252691 14:92511664-92511686 GGAGGAAATAATTCAGCCTCTGG No data
1121252683_1121252693 29 Left 1121252683 14:92511620-92511642 CCCTGTTGAGGGAGACGGCGGAG No data
Right 1121252693 14:92511672-92511694 TAATTCAGCCTCTGGAGGAGAGG No data
1121252683_1121252687 3 Left 1121252683 14:92511620-92511642 CCCTGTTGAGGGAGACGGCGGAG No data
Right 1121252687 14:92511646-92511668 ATGACTCATTCCCATCCAGGAGG No data
1121252683_1121252692 24 Left 1121252683 14:92511620-92511642 CCCTGTTGAGGGAGACGGCGGAG No data
Right 1121252692 14:92511667-92511689 GGAAATAATTCAGCCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121252683 Original CRISPR CTCCGCCGTCTCCCTCAACA GGG (reversed) Intergenic
No off target data available for this crispr