ID: 1121253086

View in Genome Browser
Species Human (GRCh38)
Location 14:92513911-92513933
Sequence TGCCGCCGGCAGCTCCGGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 147}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121253086_1121253095 9 Left 1121253086 14:92513911-92513933 CCGTCCCGGAGCTGCCGGCGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 1121253095 14:92513943-92513965 ACGCCGGGGCGCCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 25
4: 165
1121253086_1121253091 -6 Left 1121253086 14:92513911-92513933 CCGTCCCGGAGCTGCCGGCGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 1121253091 14:92513928-92513950 GCGGCATGATCCGACACGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 317
1121253086_1121253092 -5 Left 1121253086 14:92513911-92513933 CCGTCCCGGAGCTGCCGGCGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 1121253092 14:92513929-92513951 CGGCATGATCCGACACGCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 14
1121253086_1121253090 -7 Left 1121253086 14:92513911-92513933 CCGTCCCGGAGCTGCCGGCGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 1121253090 14:92513927-92513949 GGCGGCATGATCCGACACGCCGG 0: 1
1: 0
2: 0
3: 0
4: 7
1121253086_1121253100 20 Left 1121253086 14:92513911-92513933 CCGTCCCGGAGCTGCCGGCGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 1121253100 14:92513954-92513976 CCCGCGCGCGGGGACCCCACGGG 0: 1
1: 0
2: 0
3: 3
4: 110
1121253086_1121253094 8 Left 1121253086 14:92513911-92513933 CCGTCCCGGAGCTGCCGGCGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 1121253094 14:92513942-92513964 CACGCCGGGGCGCCCGCGCGCGG 0: 1
1: 0
2: 0
3: 24
4: 131
1121253086_1121253103 30 Left 1121253086 14:92513911-92513933 CCGTCCCGGAGCTGCCGGCGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 1121253103 14:92513964-92513986 GGGACCCCACGGGGTAAGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 75
1121253086_1121253102 21 Left 1121253086 14:92513911-92513933 CCGTCCCGGAGCTGCCGGCGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 1121253102 14:92513955-92513977 CCGCGCGCGGGGACCCCACGGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1121253086_1121253098 19 Left 1121253086 14:92513911-92513933 CCGTCCCGGAGCTGCCGGCGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 1121253098 14:92513953-92513975 GCCCGCGCGCGGGGACCCCACGG 0: 2
1: 0
2: 1
3: 15
4: 122
1121253086_1121253096 10 Left 1121253086 14:92513911-92513933 CCGTCCCGGAGCTGCCGGCGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 1121253096 14:92513944-92513966 CGCCGGGGCGCCCGCGCGCGGGG 0: 1
1: 0
2: 4
3: 27
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121253086 Original CRISPR TGCCGCCGGCAGCTCCGGGA CGG (reversed) Exonic
900592838 1:3467593-3467615 TGGCGCCCGCAGCTCCCTGAAGG - Intronic
900804131 1:4756266-4756288 TGCCGAAAGCAGCTCAGGGAGGG + Intronic
901238634 1:7680502-7680524 CGCCGCCAGCAGTTCCGCGAAGG - Intronic
901325033 1:8360681-8360703 TGGCGCCGGCAGCTGGGGGATGG + Exonic
901537076 1:9889441-9889463 TGCAATCGGCAGCTCCGAGATGG - Intronic
901650275 1:10739214-10739236 TGCAACCTGCAGCTGCGGGACGG + Intronic
912955559 1:114152648-114152670 TGGCGGCGGGAGCTGCGGGAGGG - Exonic
914410316 1:147421123-147421145 CGCCGTAGGCAGCTCCTGGAAGG - Intergenic
917438511 1:175045196-175045218 TGCCTCCGGCCTCTCCGGCAGGG - Intergenic
919987943 1:202688956-202688978 TGTGGCCTGCAGCTCCAGGAAGG + Intronic
920612364 1:207454351-207454373 AGCGTCCGGCAGCTCTGGGAGGG - Exonic
920886847 1:209938043-209938065 TGCCAGCGGCGGCCCCGGGAAGG + Intergenic
923561823 1:235047462-235047484 TGCCCCCGCAAGCTCTGGGAGGG - Intergenic
1067113948 10:43420555-43420577 CGCCGCCGGCAGCGCTGGAAGGG - Intergenic
1067342892 10:45418999-45419021 GGGCGGGGGCAGCTCCGGGAAGG + Intronic
1074852886 10:117453013-117453035 TGCAGGTGGCAGCTCAGGGACGG + Intergenic
1076134378 10:128035672-128035694 TGCCCCCTGCAGCTCCAAGAGGG - Intronic
1076668240 10:132104858-132104880 GGCCGCCTGCAGCGCCGCGAGGG - Exonic
1076793214 10:132787344-132787366 CGCCGTCGGCCGCTCCTGGATGG + Intergenic
1076834622 10:133014823-133014845 TGCTGGCGGCAGGGCCGGGATGG + Intergenic
1081671655 11:44945877-44945899 GGCCGACGGCAGCCCTGGGAGGG - Intronic
1083599561 11:63938635-63938657 TGCCGCCGGCTGCTACGCGCGGG + Intergenic
1083638285 11:64132018-64132040 TGGCCCCAGCAGCTCCGGCATGG - Intronic
1084008408 11:66334980-66335002 TGCCCCTGGCAGCACGGGGACGG + Exonic
1084860514 11:72014947-72014969 TGCCTCCTGCAGCTCCTGGCGGG + Exonic
1085273410 11:75283545-75283567 TGCCGGCAGCAGCCCTGGGACGG + Intronic
1089243210 11:117098673-117098695 TCCCACCGCCAGCTCCCGGAGGG - Intergenic
1089350982 11:117821620-117821642 TGCCCGTGGCAGCTCCCGGAGGG - Intronic
1096580730 12:52583060-52583082 TCCCACTGGCAGCTCCGCGAGGG + Intergenic
1102011548 12:109622229-109622251 TGCCTCCTGCAGCTCGGGGAGGG + Intergenic
1103907927 12:124336835-124336857 TGGCGCCGGCGGGTCCGGGCTGG + Exonic
1104471314 12:129032171-129032193 TTCCGCAGGCAGCTCCCGGGTGG + Intergenic
1105492417 13:20902144-20902166 TGCAGCCGGCAGCACGTGGAAGG - Intronic
1106458568 13:29948651-29948673 AGCCGTGGGCAGCTCCGGGAGGG + Intergenic
1113014394 13:105811293-105811315 TGCCGCCAGCATCTCCTTGACGG - Intergenic
1113302480 13:109037262-109037284 CGCCGCCTCCAGCTCCAGGAAGG - Intronic
1114187369 14:20413208-20413230 TCCTCCCGGCGGCTCCGGGAAGG - Intronic
1121253086 14:92513911-92513933 TGCCGCCGGCAGCTCCGGGACGG - Exonic
1123173771 14:106399022-106399044 TCGCGCCGGCGCCTCCGGGAAGG - Intergenic
1123182024 14:106480296-106480318 TCGCGCCGGCGCCTCCGGGAAGG - Intergenic
1202944881 14_KI270726v1_random:16434-16456 TCGCGCCGGCGCCTCCGGGAAGG + Intergenic
1124240750 15:28025706-28025728 TCCCACCGGCTGCTCCGTGAGGG + Intronic
1127142593 15:55993261-55993283 AGGCGGCGGCCGCTCCGGGAAGG + Intronic
1127867136 15:63042341-63042363 GGCCTCCGGCAGCTCAGGGCGGG + Intergenic
1128604749 15:69028273-69028295 TGCCTCCTGCAGCTCCTGGAGGG - Exonic
1129323818 15:74789197-74789219 TGCTGACGGGAGCCCCGGGATGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1129862336 15:78872659-78872681 TGCCCCCGGCTGCTGCGGGTTGG - Intronic
1132557801 16:580086-580108 TCCCGACTGCAGCTCCGGGATGG + Intronic
1133315959 16:4884222-4884244 CACCGGCGGCAGCTCCTGGAGGG - Exonic
1136110946 16:28063424-28063446 TGCCGCCCGCGCCGCCGGGACGG + Exonic
1136637962 16:31537676-31537698 TGCGGCCGGCGGCTGCGGGCTGG - Intergenic
1139572344 16:67821091-67821113 TGCTGCTGGCAGCTCCTGCAGGG - Exonic
1139593846 16:67947224-67947246 TGCCCCGGGCAGCCCCAGGATGG + Intronic
1141452748 16:84116738-84116760 CGCCGCCGGGAGCTCAGGGCCGG + Exonic
1141609134 16:85171254-85171276 CGACGCCGGCAGCTCGGAGAGGG - Exonic
1141669739 16:85485508-85485530 TGCCGCCTGCCGTTCTGGGAGGG + Intergenic
1142143646 16:88483519-88483541 TGCCGCCGGTAGATCTCGGAGGG - Intronic
1142169926 16:88616396-88616418 TGCTGCTGGCAGCTCCGAGAAGG - Intronic
1142428018 16:90011088-90011110 TGCTGCTGGCAGCAACGGGAAGG - Intronic
1143202540 17:5122617-5122639 TGCAGCCGGCCGTTCCGGGAGGG - Intronic
1144771768 17:17763437-17763459 TGCTGCCAGCAGCTCCTTGAGGG - Intronic
1147183627 17:38702279-38702301 CGCAGCCCGCAGCTCCGGGCCGG + Intergenic
1147429460 17:40362739-40362761 TGCCGCCGGCAGCCACTGGGAGG + Intronic
1148912528 17:50950456-50950478 TGCCGCAGGCACCCCCTGGACGG + Intergenic
1150624786 17:66835009-66835031 TGCAGCTGGCAGCGCCGGGGTGG + Intergenic
1151917336 17:77127968-77127990 TCCCTCCTGCAGCTCTGGGAAGG - Intronic
1152269533 17:79315953-79315975 GTCCGCCAGCAGCTCTGGGAGGG + Intronic
1152727903 17:81956700-81956722 TGCCGACGCCAGTTCCAGGAGGG - Exonic
1152882958 17:82830780-82830802 TCCGGACGACAGCTCCGGGATGG - Exonic
1154201337 18:12302597-12302619 TGACCCCGCCAGCTCAGGGAGGG + Intergenic
1160196200 18:76757873-76757895 TGCCCCCGGTGGCTCCTGGAGGG - Intergenic
1160509150 18:79443698-79443720 TGCCGACGGCATCTGTGGGAGGG + Intronic
1160765684 19:806495-806517 TGCCCCCGCCAGGCCCGGGATGG - Exonic
1160779021 19:869636-869658 TGGCTCCGGGACCTCCGGGAAGG - Intronic
1160826735 19:1083640-1083662 GGCTGCAGGCAGCACCGGGATGG - Intronic
1161262797 19:3346801-3346823 TGGCGAGGGCAGCTCCGGGGAGG + Intergenic
1162311847 19:9912723-9912745 TGCCTCCAGAAGCTCCAGGATGG - Intronic
1162506765 19:11090363-11090385 TTCCGCCGCGTGCTCCGGGACGG + Intronic
1162805341 19:13135401-13135423 AGCCGCCGGCAGCTCCACCACGG - Exonic
1163453046 19:17390531-17390553 GGCCGCCGGCAGCCCCCGGAGGG + Intergenic
1163725177 19:18919303-18919325 GGCCTCCGGCGGCTCCGGGGAGG - Exonic
925101099 2:1246390-1246412 AGCCGGCGCCAGCTCCAGGATGG - Intronic
925288811 2:2732913-2732935 TGCAGCCGTCAGGACCGGGAAGG + Intergenic
926551670 2:14309095-14309117 TGCCTCTGGCTGCTCCTGGAAGG - Intergenic
927920774 2:26970705-26970727 TCCGGCCGGCGGCTCCGGGGCGG - Exonic
928097780 2:28415182-28415204 GGCTGCAGGCAGCTCTGGGACGG + Exonic
935032491 2:99336309-99336331 AGCCGCCGGCAGCTACTGCAAGG - Exonic
938100195 2:128493170-128493192 TTGCGCTGGCAGCTCCCGGAGGG + Intergenic
938144502 2:128822332-128822354 TGCCCCTGGCAGCACCAGGAGGG - Intergenic
948822117 2:240555329-240555351 TGCCGCCAGCAGGCCCGGGCTGG - Intronic
1174066860 20:47871888-47871910 TGACACCGGCAGCTCTGGGAGGG + Intergenic
1176075250 20:63245362-63245384 CGCCACGGCCAGCTCCGGGATGG - Intronic
1177775526 21:25562162-25562184 CGCCGCCTGCAGCCTCGGGAAGG + Intergenic
1177788283 21:25695616-25695638 TGCCGCCGCCCCATCCGGGAGGG - Intronic
1179183249 21:39062653-39062675 TGAAGCTGGCAGCTCCCGGAGGG - Intergenic
1179988173 21:44932524-44932546 GGGGGCCGCCAGCTCCGGGAAGG + Intergenic
1180824545 22:18853570-18853592 TGCCTCCACCTGCTCCGGGAGGG + Intronic
1180988050 22:19917216-19917238 TGCCCTGGGCAGCTCCTGGACGG - Intronic
1181124967 22:20696725-20696747 TGCCTCCACCTGCTCCGGGAGGG + Intergenic
1181188190 22:21120978-21121000 TGCCTCCACCTGCTCCGGGAGGG - Intergenic
1181211008 22:21289515-21289537 TGCCTCCACCTGCTCCGGGAGGG + Intergenic
1181398492 22:22637373-22637395 TGCCTCCACCTGCTCCGGGAGGG - Intergenic
1181501230 22:23316731-23316753 TGCCTCCACCTGCTCCGGGAGGG - Exonic
1181650922 22:24258687-24258709 TGCCTCCACCTGCTCCGGGAGGG + Intergenic
1181706458 22:24652052-24652074 TGCCTCCACCTGCTCCGGGAGGG - Intergenic
1182304912 22:29361247-29361269 TCCTGCCAGCAGCTCCGGGAAGG - Intronic
1182312226 22:29417382-29417404 TCCTGCCAGCAGCTCCGGGAAGG - Intronic
1182688041 22:32135860-32135882 TCCTGCCAGCAGCTCCGGGAAGG + Intergenic
1184037659 22:41926323-41926345 TGGCCCCGGCTGCTTCGGGAGGG + Exonic
1184172534 22:42768507-42768529 TGCCGCTGCCGGCTCCGAGACGG + Intergenic
1203215938 22_KI270731v1_random:5915-5937 TGCCTCCACCTGCTCCGGGAGGG - Intergenic
1203274685 22_KI270734v1_random:79475-79497 TGCCTCCACCTGCTCCGGGAGGG + Intergenic
949260493 3:2098813-2098835 AGCCGCCGCGAGCGCCGGGAGGG + Intronic
949552399 3:5122248-5122270 TGCCGACGGCGGCGCCGGGACGG + Exonic
950138075 3:10596788-10596810 TGCCAGCAGCAGCTCAGGGATGG + Intronic
950442742 3:13019468-13019490 GGCCGCCGGCAGCTCCGCCTTGG + Intronic
953917676 3:46930939-46930961 TGCACCAGGCAGCTCCAGGAGGG + Intronic
961007198 3:123413064-123413086 TGACGCCGGCTCCTCCGGGACGG + Intronic
961603362 3:128076894-128076916 GGACGCCGGCAGCTGCGGGGAGG - Intronic
966497894 3:180601739-180601761 TTCAACCGGCTGCTCCGGGAAGG - Intergenic
969468405 4:7371257-7371279 GGGCGCAGGCAGCTGCGGGACGG - Intronic
969702061 4:8773203-8773225 GGCCTCCGGCTGCTCCAGGATGG - Intergenic
969720743 4:8892112-8892134 AGCCGCCCGCAGCTCCGGGAGGG - Intergenic
972726804 4:41751832-41751854 TGCTGCCGGCCGCCCCGGGTCGG + Intergenic
973619525 4:52712719-52712741 TGCCTCGCGCAGCCCCGGGACGG - Intergenic
976297356 4:83485280-83485302 TGCTGCCGGCCTCTCCCGGAAGG + Intronic
981286555 4:143025278-143025300 TGCTGCCTGCAGCTGGGGGAGGG - Intergenic
991216866 5:64165896-64165918 GGCGGCCGGGAGCGCCGGGACGG + Exonic
992039676 5:72817108-72817130 TGCAGTCGGCTGCCCCGGGACGG + Intronic
998523404 5:142820494-142820516 TACCGCCTTCAGCTCCAGGATGG - Intronic
1004690460 6:17988058-17988080 TGCCACCCGGAGCCCCGGGACGG + Intergenic
1006452093 6:34111168-34111190 TGCCTCCACCAGCTCCTGGAAGG - Intronic
1007363224 6:41373209-41373231 TGCCACCCGCAGCTCCGGCGCGG - Intergenic
1013679581 6:112508982-112509004 TGCCGCCGCCCCGTCCGGGAGGG - Intergenic
1019233089 6:170584803-170584825 TGCCTCCGGGTGCTCTGGGATGG + Intergenic
1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG + Intronic
1027995754 7:85423777-85423799 TGCCGAAGGCAGCTCAGGGTGGG + Intergenic
1034494320 7:151410657-151410679 AGCCGCCGGGCGCTCCGGGAGGG - Intronic
1034618119 7:152436146-152436168 TGCCGCGGGCGGCTCGGGGGAGG - Intergenic
1035355256 7:158272794-158272816 TGCCGGCGGCACCTCCCCGATGG - Intronic
1035727185 8:1831927-1831949 TTCCACAGGCAGCTGCGGGAAGG - Intronic
1038266746 8:26044165-26044187 GGCGGCCGGGAGCTCTGGGAGGG - Intronic
1038540428 8:28386109-28386131 GGCCGCGGGCCGCGCCGGGAGGG - Intronic
1045016961 8:98008657-98008679 TGCTGCAGCCAGCTCAGGGAGGG + Intronic
1045112704 8:98949155-98949177 CGCCGCCGCCATCTCCGTGATGG - Exonic
1049341401 8:142114502-142114524 TGCAGGCTGCAGCTCCAGGAAGG - Intergenic
1051254000 9:15192987-15193009 TGCTGCCGGAAGCTGTGGGATGG - Intronic
1052609914 9:30758961-30758983 TGCCAAGGGCAGCTCGGGGAAGG - Intergenic
1054769772 9:69072671-69072693 TGCGGCCAGCAGCTCATGGAGGG - Exonic
1056588297 9:87943939-87943961 TGCAGCCCTCAGCTTCGGGAGGG + Intergenic
1056994475 9:91443460-91443482 TGCTGACGGCAGCTCAGGCATGG - Intergenic
1057230804 9:93320268-93320290 TCCCGTCGGCAGCTCCTGGGAGG + Intronic
1060826182 9:126689299-126689321 TTCTGACGGCAGCTCCAGGAAGG + Intronic
1061682467 9:132249864-132249886 GCCCACCGGGAGCTCCGGGAGGG - Intergenic
1203744809 Un_GL000218v1:35816-35838 TGTCCCCGGCAGTTCAGGGAGGG - Intergenic
1203442513 Un_GL000219v1:22598-22620 TGCCGGCGGCAGGTGCGGGAAGG + Intergenic
1203513321 Un_KI270741v1:141507-141529 TGCCGGCGGCAGGTGCGGGAAGG + Intergenic
1203565295 Un_KI270744v1:83668-83690 TGTCCCCGGCAGTTCAGGGAGGG + Intergenic
1187533520 X:20116849-20116871 CGGCGGCGGCGGCTCCGGGACGG - Exonic
1189281473 X:39822137-39822159 TTACGCCGGCTGGTCCGGGAAGG + Intergenic
1192082432 X:68061279-68061301 TGCCGCCAGCAGCCCAGGGTAGG + Intronic
1195410795 X:104566465-104566487 TGCCGCCTGCACCTCCGTTAGGG + Exonic
1200121736 X:153794284-153794306 CGTCGCCGGCAGCGCCGCGAAGG - Exonic
1200253190 X:154564591-154564613 TGCCGCGGCCAGCTCCTGGGTGG - Exonic
1200264577 X:154639824-154639846 TGCCGCGGCCAGCTCCTGGGTGG + Intergenic