ID: 1121254330

View in Genome Browser
Species Human (GRCh38)
Location 14:92520193-92520215
Sequence CTTGACCACAACCACGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121254330_1121254337 30 Left 1121254330 14:92520193-92520215 CCTAGGCCGTGGTTGTGGTCAAG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1121254337 14:92520246-92520268 ACACTCAGGCCACATCCTATGGG 0: 1
1: 0
2: 0
3: 11
4: 134
1121254330_1121254336 29 Left 1121254330 14:92520193-92520215 CCTAGGCCGTGGTTGTGGTCAAG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1121254336 14:92520245-92520267 CACACTCAGGCCACATCCTATGG 0: 1
1: 0
2: 0
3: 7
4: 164
1121254330_1121254335 16 Left 1121254330 14:92520193-92520215 CCTAGGCCGTGGTTGTGGTCAAG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1121254335 14:92520232-92520254 TGACGTGACGGCACACACTCAGG 0: 1
1: 0
2: 0
3: 1
4: 37
1121254330_1121254334 4 Left 1121254330 14:92520193-92520215 CCTAGGCCGTGGTTGTGGTCAAG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1121254334 14:92520220-92520242 GTTGTCTGTAAGTGACGTGACGG 0: 1
1: 0
2: 0
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121254330 Original CRISPR CTTGACCACAACCACGGCCT AGG (reversed) Intronic
900575020 1:3378795-3378817 CCTGGCCAGAACCACGGCCCAGG + Intronic
900837664 1:5018232-5018254 CTTGAGGACACCCATGGCCTGGG + Intergenic
901060252 1:6468541-6468563 CTCTACCACAACCATGGCCAGGG + Exonic
902747443 1:18483025-18483047 TTTGACCTCAACCGCAGCCTGGG + Exonic
903096010 1:20974381-20974403 CTTGATTTCAACCACTGCCTTGG - Intronic
906223637 1:44103376-44103398 CTTCTTCACAACCACGGCCCTGG + Intergenic
906423055 1:45686874-45686896 CTTGCCCACTTCCAGGGCCTGGG + Intronic
906674636 1:47684358-47684380 CATGACCACAAGCATGTCCTTGG + Intergenic
909879014 1:80848722-80848744 CTTGAGCACACCCACACCCTTGG + Intergenic
911524084 1:98963607-98963629 TTTGACCACAGCCTCTGCCTGGG + Intronic
913211192 1:116583951-116583973 CGTGACCCCCACCACCGCCTCGG - Intronic
915898998 1:159833138-159833160 CTTGGCCACAGTCACGCCCTGGG + Exonic
917585661 1:176424736-176424758 CTTGGCCACAACCACCGCTAAGG - Intergenic
921012906 1:211160981-211161003 CTTGGCCACAACCACTGCTAAGG - Intergenic
921641490 1:217560074-217560096 CCTGACCTCAGCCACTGCCTTGG + Intronic
924037719 1:239953877-239953899 CATGACCAGGACCATGGCCTGGG - Intergenic
1062899596 10:1132826-1132848 CTCAGCCACAGCCACGGCCTGGG - Intergenic
1064593628 10:16921027-16921049 ATTGAACACAACCACGGAGTTGG - Intronic
1066696592 10:38084552-38084574 CTTGGCCACAACCACTACCAAGG - Intergenic
1067313194 10:45134688-45134710 CTTGAACACAACCACGGAGTTGG + Intergenic
1070300895 10:75202783-75202805 CTTGACCACCCCAACGGCTTAGG - Intergenic
1070870640 10:79748569-79748591 CTTGACCACAACCACTACTAAGG + Intergenic
1072714966 10:97744888-97744910 CTTCACCTCAGCCACGGCCTCGG - Exonic
1073763808 10:106659745-106659767 CTTGCCCACATCAATGGCCTTGG - Intronic
1074767254 10:116708349-116708371 CTTGACCACAAGTATTGCCTTGG - Intronic
1077196832 11:1285194-1285216 CTTGGCCACTTCCATGGCCTGGG + Intronic
1077236048 11:1482470-1482492 CCTGACCACAGCCAGAGCCTGGG - Intronic
1077502543 11:2915969-2915991 CTGGGCCACTACCAAGGCCTGGG - Intronic
1079522354 11:21342994-21343016 GCTCACCACAACCACAGCCTAGG + Intronic
1081345942 11:41986277-41986299 CTTGACCACAGCCAGGCCATGGG + Intergenic
1082802289 11:57424124-57424146 CTTGACCGCACCCTCAGCCTGGG + Intronic
1083726767 11:64632563-64632585 CTTGACCACCATCACTGCCTGGG - Intronic
1085465231 11:76719214-76719236 ATTGACCACACCCAGGGACTAGG + Intergenic
1090771091 11:129920483-129920505 CTTCTCCACACCCACTGCCTCGG + Intronic
1092749674 12:11707006-11707028 GTTGGCCACAACCACCCCCTGGG - Intronic
1096626181 12:52897485-52897507 CTTCTTCACAACCACGGCCCTGG + Exonic
1098641224 12:72839988-72840010 CTCTACCACAACCACTGCCAAGG + Intergenic
1099667686 12:85653263-85653285 CTTGACCACAACCACTACTAAGG - Intergenic
1102731017 12:115109830-115109852 CTTGTCCACTCCCACAGCCTGGG + Intergenic
1104747498 12:131219548-131219570 AGTGACCACAGCCACAGCCTTGG + Intergenic
1104837057 12:131798420-131798442 CCTTCCCAGAACCACGGCCTTGG - Intronic
1105445953 13:20457159-20457181 CTGGACCACAGCCTCGGCCCTGG + Intronic
1105669518 13:22596674-22596696 CATGACCACAGCCACGGCCATGG + Intergenic
1121254330 14:92520193-92520215 CTTGACCACAACCACGGCCTAGG - Intronic
1126105466 15:45144261-45144283 CTTGTCCACAGCCAAGGCCAGGG + Intronic
1126467364 15:48973208-48973230 CTTGACCTCAGCTAAGGCCTGGG + Intergenic
1127222507 15:56894825-56894847 CTTCACCACAACCACATCATAGG + Intronic
1127222617 15:56896222-56896244 CTTGACCAACACCACTGCTTTGG + Intronic
1133389644 16:5399272-5399294 CTTGACCTCATCCACGGCTAAGG - Intergenic
1133512043 16:6469009-6469031 CTTGACCACTTCCAATGCCTGGG - Intronic
1137055871 16:35746484-35746506 CTGCACCAACACCACGGCCTGGG + Intergenic
1138415685 16:56870171-56870193 CATGGCCACACCCACGGCATTGG - Exonic
1140753660 16:78048537-78048559 CTTCTTCACAACCACGGCCTTGG + Intronic
1142586588 17:978678-978700 CTCGGCCACAGCCACGGCCACGG + Intronic
1143541165 17:7570217-7570239 CTTGCCCACAATCTAGGCCTTGG + Intronic
1143978157 17:10845276-10845298 CTCGACCACAGCCCCGCCCTTGG - Intergenic
1145999947 17:29125072-29125094 CCTCACCACACCCAAGGCCTGGG + Intronic
1150689543 17:67352848-67352870 CTTGAGCACAAGCACTGCCCTGG - Intronic
1151425557 17:74028966-74028988 CTTGACCACATCCACTAGCTGGG + Intergenic
1157626921 18:49058526-49058548 CTTGACCACAAAACCAGCCTGGG - Intronic
1161745398 19:6056542-6056564 CTTGAGTACACCCACGCCCTCGG - Intronic
1165935597 19:39386730-39386752 TTTGACCACAAGCAGGGCGTTGG + Exonic
1166853444 19:45771028-45771050 CTGGCCCACAGCCACGGCCGGGG + Exonic
1167668406 19:50836218-50836240 CTTCACCTCCACCGCGGCCTGGG + Intronic
932971609 2:76550068-76550090 CTTGAGAACAACCAGTGCCTGGG - Intergenic
935233767 2:101120791-101120813 CTGGCTCACAACCACGGGCTAGG + Intronic
937932478 2:127218079-127218101 CTTCACCACACCCAGGGCCCTGG - Intronic
941890829 2:170579694-170579716 CTGGAGCACCACCACAGCCTGGG + Intronic
942558710 2:177198474-177198496 CTTCTTCACAACCACGGCCCTGG - Intergenic
943064375 2:183071097-183071119 CTTCTTCACAACCACGGCCCTGG + Intergenic
1169968574 20:11244150-11244172 CCAGGCCACAACCACTGCCTTGG - Intergenic
1170114862 20:12846486-12846508 CGTGATCCCAACCACGGGCTGGG - Intergenic
1183689452 22:39380342-39380364 CTGGACCACTTCCACAGCCTTGG - Intronic
1184442979 22:44529878-44529900 CTTTACCCCAACCCCAGCCTTGG - Intergenic
950395815 3:12733091-12733113 CTTGACCAAAATCACAGCCAGGG + Intergenic
953735793 3:45493068-45493090 CTTGCCCAACACCAAGGCCTAGG - Intronic
954007518 3:47603564-47603586 CTTGACCACACCCTGGGCCATGG - Intronic
956106591 3:65825347-65825369 CTTCAGCACAACCACTGCTTAGG - Intronic
959414092 3:106062312-106062334 CTGGACCCCACCCAGGGCCTGGG + Intergenic
959839814 3:110961418-110961440 CTTGAACACAACCAGGGGCAGGG + Intergenic
963751039 3:149180303-149180325 CATAACCACACCCTCGGCCTTGG + Intronic
964802297 3:160569167-160569189 CTTCTTCACAACCACGGCCCTGG - Intergenic
965369995 3:167850093-167850115 CTTGAACTCAACCACTGCCATGG + Intergenic
970770460 4:19606247-19606269 CTTGACCACCACTGTGGCCTAGG + Intergenic
970826024 4:20276457-20276479 CTTGACAACACCTATGGCCTAGG + Intronic
972922047 4:43955984-43956006 CTTGACCACTCCCAGGGCTTTGG - Intergenic
977002125 4:91518194-91518216 CTTGAACACAACCACTGCTAAGG - Intronic
979745337 4:124205918-124205940 CTTGGCCACAACCACTGCCAAGG - Intergenic
979746772 4:124224732-124224754 CTTGGCCACAACCATTACCTAGG + Intergenic
981449590 4:144880824-144880846 ATTGACCTCAACCCCAGCCTCGG - Intergenic
987644375 5:20649207-20649229 CTTGGCCACAACCACTGCTAAGG + Intergenic
990672631 5:58150061-58150083 CTTGACCAAAAGCAGGCCCTTGG + Intergenic
993280766 5:85921552-85921574 CTTTGCCACAACCACTGCCAAGG + Intergenic
998451579 5:142238749-142238771 CATGACTACAACCTCGGCCTTGG + Intergenic
999075982 5:148795989-148796011 CATTTCCACAACCACAGCCTTGG - Intergenic
1000115820 5:158152193-158152215 GTTGACCAAAACCACAGCCTAGG + Intergenic
1003744319 6:8982521-8982543 CTTGACCACAAGGAAGGCCTAGG + Intergenic
1005958187 6:30679174-30679196 CTTACCCACAATCAGGGCCTTGG + Exonic
1006003963 6:30988051-30988073 CATGGCCTCAACCATGGCCTTGG + Exonic
1006009979 6:31034717-31034739 CATGGCCACAGCCACAGCCTTGG + Exonic
1013458249 6:110351708-110351730 CTTGACCTAAACAAAGGCCTAGG - Intronic
1015223749 6:130833045-130833067 ATTTTCCACAACCACGACCTTGG + Intronic
1017579038 6:155840324-155840346 TTTGACCACAGCCAAGTCCTGGG + Intergenic
1019165203 6:170094012-170094034 CTCGATCAGAACCACAGCCTGGG + Intergenic
1019545549 7:1573314-1573336 CTGGACCACCACCTCAGCCTAGG - Intergenic
1026829205 7:73600881-73600903 CCTGACCACATCCCGGGCCTGGG + Intronic
1032241427 7:130162286-130162308 TTTGACCTCATCCACGGTCTAGG + Intergenic
1039562292 8:38522355-38522377 CTTGGCCACCACAACGCCCTTGG - Intronic
1041012841 8:53560415-53560437 CCTGACCACAACCACTGCTAGGG + Intergenic
1041781207 8:61579592-61579614 CTTCTTCACAACCACGGCCCTGG - Intronic
1044781864 8:95751839-95751861 CTTGGACACAAACACTGCCTAGG - Intergenic
1046830568 8:118741446-118741468 ATTGCCCACAAGCAGGGCCTGGG + Intergenic
1047426290 8:124749860-124749882 GTTGACAATAACCATGGCCTAGG - Intergenic
1047931135 8:129728932-129728954 CTTGACCACCGCCACCACCTCGG - Intergenic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1051104953 9:13568990-13569012 CTTCGACACAACCAGGGCCTGGG - Intergenic
1052486949 9:29113789-29113811 CTGGACCACTACCACTGCTTGGG - Intergenic
1057943722 9:99306532-99306554 CTTCCTCACAACCACGGCCCTGG - Intergenic
1058983070 9:110188087-110188109 CCTGATTACAACCACTGCCTTGG + Intergenic
1060072612 9:120563450-120563472 GTTGACTACAACCACTGCCCTGG - Intronic
1062066725 9:134532167-134532189 CTTGTCCTCTGCCACGGCCTCGG - Intergenic
1062302390 9:135882125-135882147 CCTTCCCACAACCACGACCTGGG - Intronic
1194703993 X:97152240-97152262 CTTGAACACAACCAAGTCATGGG + Intronic
1200608685 Y:5297729-5297751 CGTGGCCACAACCAGGGGCTGGG + Intronic